Cloning protospacer adapters into PX330/PX335/PX458/PX459 (Zhang lab, MIT) via BbsI
site.
I.
Anneal top and bottom oligos of adapter
1. Resuspend oligos in water to 1 µg/µl concentration.
2. Combine the following in a 200 µl PCR tube:
a. 5 µl “top” oligo
b. 5 µl “bottom” oligo
c. 10 µl of 10x annealing buffer
d. 80 µl water
(10X Annealing Buffer: 1 M NaCl / 10 mM EDTA pH 8.0 / 100 mM Tris pH 7.5)
3. Mix well. Run the mix in a thermal cycler with an annealing program, such as:
Step (1) 94˚ for 3 minutes; Step (2) cool from 94 ˚ to 25˚ slowly, such as over a
30 minute period. Alternatively to a thermal cyler: Heat a beaker of water to
boiling. Float the tube in the boiling water bath for 5’. Remove the beaker from
the heat and let it cool off naturally on a benchtop, till it is room temperature.
4. Transfer the annealed adapter to a 1.5 ml tube. Add 900 µl water. The final
concentration of annealed adapter is now ~ 10 ng/µl.
II.
Ligate to BbsI-cut vector.
1. Before you start: You will need to have the vector DNA previously cut with
BbsI and gel-purifed, and in 10 mM Tris or Lo-TE at a concentration of at
least 10 ng/µl.
2. I use the NEB Quick Ligation kit, and I reduce the volumes by half to save
reagents. It works great. Combine the following in this order:
a. 2.5 µl of 10 ng/µl BbsI-cut vector
b. 1 µl of 10 ng/µl annealed adapter
c. 1.5 µl of water
d. 5 µl of 2x Quick Ligase buffer
e. 0.5 µl of Quick Ligase enzyme
3. Mix briefly, and incubate at room temp. for 5’. Use immediately for
transformation.
III.
Transform DH5 cells.
1. You will need a 42˚ water bath and LB+AMP plates. You will also need to get
a tube of competent DH5 cells from the 9th floor core in Light Hall. Thaw the
cells on ice.
2. Transfer 100 µl cells to a 1.5 ml tube.
3. Add 5 µl of the ligation reaction. Mix well (do not vortex).
4. Incubate 45’ on ice.
5. Heat-shock the cells at 42˚ for 2’.
6. Transfer cells back to ice.
7. Add 900 µl of LB media to the cells. Transfer the cells to a 15 ml tube.
8. Recover the cells by incubating in a 37˚ shaker incubator for 30’ at 250 rpm.
9. Plate out 100 µl of the cells on an LB+AMP plate. Incubate at 37˚ overnight.
You should get at least a few dozen colonies (e.g. 10-100 is typical). Most of
1
them will contain the correctly cloned product. When I have done negative
controls with no adapter, I get zero or just a couple of colonies.
IV.
Screen colonies for correct insertion of adapter.
1. Inoculate 2 colonies separately into 15 ml tubes with 2 mls of LB+100 µg/ml
AMP. Shake overnight at 37˚.
2. Perform Qiagen minipreps on 1.5 ml of each plasmid culture. Save the
remaining ~0.5 ml for making a glycerol stock to store at -80˚. (see below).
The culture sample can be stored at 4˚ for a few days before you make the
glycerol stock.
3. Spec the DNA. Usually the concentration is about 40-100 ng/ul. Prepare a
sample for direct Sanger sequencing using this primer:
U6F1:
TACGATACAAGGCTGTTAGAGAG
This sequencing will read-through the region of the BbsI site and
verify that the adapter has inserted properly.
V.
Make glycerol stocks of the correct clones. To the remaining ~0.5 ml of the
miniprep culture in step IV above, add 0.5 ml of sterile 30% glycerol. (Glycerol
solutions should be sterilized by filtration, never autoclaving.) Mix and store the
glycerol stock at -80˚.
Doug Mortlock 7/23/14
2