Prognostic impact of allogeneic hematopoietic stem cell transplantation for
acute myeloid leukemia patients with internal tandem duplication of FLT3
Po-Han Lin1,2,4,8, Ching-Chan Lin2,4, Hwai-I Yang4, Long-Yuan Li6, Li-Yuan Bai2,
Chang-Fang Chiu2,5, Yu-Min Liao2, Chen-Yuan Lin2,4, Ching-Yun Hsieh2,4,
Chien-Yu Lin3, Cheng-Mao Ho3, Shu-Fen Yang3, Ching-Tien Peng3, Fuu-Jen Tsai1,7,
Su-Peng Yeh2,5
1
Department of Medical Genetics; 2Division of Hematology and Oncology,
Department of Internal Medicine; 3Department of Laboratory Medicine; China
Medical University Hospital, Taichung, Taiwan
4
Graduate Institute of Clinical Medicine; 5Internal Medicine, College of Medicine;
6
Center for Molecular Medicine and Graduate Institute of Cancer Biology;
7
Graduate Institute of Integrated Medicine, College of Chinese Medicine; China
Medical University, Taichung, Taiwan
8
Department of Medical Genetics, National Taiwan University Hospital, Taipei,
Taiwan
Correspondence to:
Su-Peng Yeh, Department of Internal Medicine, China Medical University Hospital,
Taichung, Taiwan
2, Yu-De Rd. 404, Taichung City, Taiwan
Tel: +886-4-22052121 ext. 5031
Fax: +886-4-22337675
E-mail: supengyeh@gmail.com
Running title: Allogeneic HSCT for AML with FLT3-ITD
Text number: 2887
Total tables and figures: 6
1
Abstract
The FLT3 gene with internal tandem duplication (ITD) is a poor prognostic factor in
patients with acute myeloid leukemia (AML), and the efficacy of allogeneic
hematopoietic stem cell transplantation (HSCT) for AML patients with FLT3-ITD is
controversial. We examined 122 AML patients; 34 patients had FLT3-ITD and 39
patients received allogeneic HSCT. The median overall survival (OS) of patients
with
wtFLT3/nonHSCT,
wtFLT3/HSCT,
FLT3-ITD/nonHSCT
and
FLT3-ITD/HSCT was 40.7 months, 53.4 months, 9.8 months and not reached,
respectively (p=0.006). Compared to the wtFLT3/nonHSCT patients, the hazard
ratio
(95%
CI)
of
OS
for
wtFLT3/HSCT,
FLT3-ITD/nonHSCT
and
FLT3-ITD/HSCT was 1.39 (0.61-3.18), 3.57 (1.58-8.10) and 0.40 (0.11-1.59),
respectively, after adjustment of age, sex, WBC, LDH, karyotype, NPM, and FAB
classification. This result indicated that patients with FLT3-ITD/nonHSCT had a
significantly worse outcome, but allogeneic HSCT improved the prognosis for
patients with FLT3-ITD.
Key words: Acute myeloid leukemia; FLT3; Allogeneic hematopoietic stem cell
transplantation
2
Introduction
Acute myeloid leukemia (AML) is a heterogeneous disease characterized as impaired
differentiation and an accumulation of myeloid blasts. In recent decades, the survival
of younger AML patients (less than 60 years) has improved because of the application
of intensive treatment and the best supportive care [1]. The complete remission rate
(CR) rate is about 80% after the first induction chemotherapy; however, AML
relapses in more than half of patients, and most of these patients die from AML [1, 2].
To reduce the relapse rate, attention over the past decade has been focused on
post-remission strategies to consolidate remission; including high-dose cytarabine,
autologous hematopoietic stem cell transplantation (HSCT) and allogeneic HSCT
[3-6].
The post-remission treatment strategies are generally guided by the prognostic
classification [2, 7]. For younger patients with an unfavorable karyotype and a
suitable available donor, allogeneic HSCT is a preferred option [6, 8, 9]. The
beneficial effect of allogeneic HSCT in those with an unfavorable karyotype was
documented in a previous meta-analysis [10]. However, about 50% of AML patients
do not have cytogenetic changes, and several genetic mutations have also influenced
patient survival [2, 11]. One of these genetic mutations is an internal tandem
duplication (ITD) in the juxtamembrane domain of the tyrosine kinase receptor
gene fms-like tyrosine kinase receptor-3 (FLT3) [12]. The ITD is mainly the
duplication of the FLT3 exon 14 sequence and the transcript is always preserved,
causing disruption of the auto-inhibition of the tyrosine kinase domain [13]. This
genetic change leads to constitutive activation of downstream signaling, increasing
the proliferation and survival of leukemic cells as well as inferior patient survival [12,
13].
3
Whether allogeneic HSCT can overcome the poor risk of FLT3-ITD in AML
patients is still controversial. One prior retrospective study showed a lack of
evidence of FLT3-ITD as an indicator for patients receiving allogeneic HSCT [14].
However, a few studies considered that allogeneic HSCT could improve the survival
of patients with FLT3-ITD [15-17]. To further investigate this question, we
retrospectively analyzed the prognostic role of allogeneic HSCT in AML patients
with and without FLT3-ITD in our institution. Our results suggested that AML
patients with FLT3-ITD might benefit from allogeneic HSCT in terms of survival.
4
Materials and Methods
Patients
A total of 122 patients who were newly diagnosed as having de novo AML and
received intensive chemotherapy with or without allogeneic HSCT at China Medical
University Hospital from January 2003 to December 2010 were retrospectively
analyzed. The diagnosis of AML was based on the World Health Organization (WHO)
definition. At diagnosis, all patients underwent blood testing for their hemogram and
biochemistry panel. Bone marrow cells were aspirated for morphologic examination,
myeloperoxidase
and
non-specific
esterase
staining,
cytogenetic
and
immunophenotyping study. Bone marrow samples were also collected after the
patients had signed informed consent. The mononuclear cells were isolated by
Ficoll-Hypaque gradient and cryopreserved in the biobank. This study was approved
by the Institutional Review Board of China Medical University Hospital.
Chemotherapy
Patients who received intensive chemotherapy were enrolled in this study. The
definition of intensive chemotherapy was anthracycline for 3 days and cytarabine
100-200 mg/m2 per day on days 1-7 as induction chemotherapy. After complete
remission (CR) was achieved, patients received high-dose cytarabine (HDAC; 2-3
g/m2 per day on days 1, 3 and 5) with or without one anthracycline treatment, as
consolidative chemotherapy.
For patients with relapsed AML, salvage chemotherapy was used, based on patient
performance and physician decision at the time, and the treatment goal was planned as
a second remission. The salvage chemotherapy regimen included MEC (mitoxantrone
8 mg/m2 on days 1-3, etoposide 100 mg/m2 on days 1-5, and cytarabine 75 mg/m2/q
5
12 hrs on days 1-5), FLAG (fludarabine 30 mg/m2 on days 1-5, cytarabine 2000
mg/m2 on days 1-5 and G-CSF 300 μg QD on days 0-6), as well as N3A7
(mitoxanthrone 8 mg/m2 on days 1-3 and cytarabine 100-200 mg/m2 per day on days
1-7) and N3-HDAC (mitoxanthrone 8 mg/m2 on days 1-3 and HDAC).
Allogeneic HSCT
Allogeneic HSCT was performed on the basis of consensus in this institute. The main
reasons for patients with a first remission undergoing HSCT were suitable donor
availability and poor risk factors, including unfavorable karyotype, extramedullary
involvement and high white blood cell (WBC) count at the initial diagnosis. Allogenic
HSCT was planned for all relapsed patients. Patients with relapsed disease were
treated with salvage chemotherapies first. Then, if a suitable donor was available,
patients would receive allogeneic HSCT when their disease status achieved CR or at
least a good partial response (the bone marrow blast > 50% reduction).
In this cohort, all patients were treated with myeloablative conditioning chemotherapy,
from either a sibling or an unrelated donor. The myeloablative conditioning regimen
was composed of busulfan at 3.2 mg/kg/day intravenously, given at daily divided
doses on days -7 to -4, followed by cyclophosphamide at 60 mg/kg intravenously on
days -3 and -2; or fludarabine at 30 mg/kg/day intravenously, given in daily divided
doses on days -6 to -2, and busulfan at 3.2 mg/kg/day intravenously on days -5 and -2.
Antithymocyte globulin (ATG) was administrated when a donor was unrelated. The
total dose of ATG was 6-8 mg/kg divided into 5 consecutive days.
Graft-versus-host disease (GVHD) prophylaxis was the institutional standard for
intravenous cyclosporine 4 mg/kg/day given from day -1, and methotrexate 15 mg/m2
6
on days +1, +3, and +6 for sibling donors. For unrelated donors, patients received
intravenous cyclosporine 4 mg/kg/day given from day -1 and mycophenolate mofetil
was added post-transplantation. All of the supportive managements were given
according to the protocol. Granulocyte colony-stimulating factor was given daily till
the WBC count was more than 4000/mm3. For infection prophylaxis, all patients
received ciprofloxacin, fluconazole, acyclovior and sulfamethoxazole-trimethoprim
till the WBC count was more than 4000/mm3. Parenteral nutrition and glutamine were
provided when patients had severe mucositis. Cytomegalovirus (CMV)-pp65 antigen
was monitored every week till 100 days post-transplantation or the patient was
seronegative. Ganciclovir was used for pre-emptive therapy when CMV antigenemia
and anti-CMV gammaglobulin was used for CMV disease, such as CMV pneumonitis
or colitis.
Detection of FLT3-ITD mutation
FLT3-ITD was detected by polymerase chain reaction carried out with a master
mixture (Roche Diagnostics), DNA templates and a pair of primers: Forward:
GCAATTTAGGTATGAAAGCCAGC
and
Reverse:
CTTTCAGCATTTTGACGGCAACC. The temperature cycling parameters were:
95°C for 2 min; 30 cycles of 95°C for 30 s, 56°C for 30 s; followed by 72°C for 2 min.
The amplified products were separated in a 3% gel of Agarose 3:1 High Resolution
Blend. The size of wild-type FLT3 (wtFLT3) was 329 bp. FLT3-ITD was longer than
wtFLT3, and two bands were identified for heterogeneous FLT3-ITD patients. Then,
all of the FLT3-ITD was confirmed by two-sided direct dye sequencing.
Statistical analysis
OS was estimated by Kaplan-Meier analysis. The X2 test and Fisher's exact test were
7
used to calculate the significance of variances between each group. Cox proportional
hazards regression analysis was used to estimate the hazards ratios of OS and
corresponding 95% confidence interval (CI) for various combinations of FLT3-ITD
and HSCT status. All p values are 2-sided and p values less than 0.05 are considered
as significant.
Results
Patient characteristics
One hundred twenty-two patients, consisting of 57 females and 65 males with a
median age of 45.0 years (range, 11.7-79.0 years), were enrolled in this study.
FLT3-ITD was detected in 34 patients (27.9%). Patients with FLT3-ITD had a
significantly higher WBC count (mean ± S.D.; 37.2 ± 75.0 x 106/L vs. 85.7 ± 83.8 x
106/L, p=0.002) and a higher serum lactate dehydrogenase level (452.4 ± 455.5 vs.
1021.7 ± 2301.4, p=0.028), but the levels of hemoglobin and platelets did not differ.
There were no differences in other clinical and laboratory characteristics, including
age, sex, FAB classification, karyotype, immunophenotype and NPM mutation (Table
1).
Survival analysis
The median OS for the entire cohort was 23.0 months (Figure 1A). In the
conventional karyotype stratification, the median OS for favorable, intermediate and
unfavorable cytogenetic patients was not reached, 32.3 and 17.7 months, respectively
(p=0.048). The median OS of patients with FLT3-ITD was significantly shorter than
that for patients with wtFLT3 (Figure 1B; median OS 44.0 months vs. 18.0 months,
p=0.023). Subgroup analysis showed that FLT3-ITD was associated with shorter OS
in patients with an intermediate-risk karyotype (N=80) and in those with a normal
8
karyotype (N=80, median OS 53.4 months vs. 13.0 months, p=0.003; N=60, median
OS not reached vs. 9.8 months, p=0.009).
Association of allogeneic HSCT with disease outcome
Thirty-nine patients (32.0%) received allogeneic HSCT, including 21 with a first CR
(CR1), 8 with a second CR, 8 with a third CR and 2 without remission. The median
OS of patients with allogeneic HSCT was longer than that of patients without HSCT
(Figure 1C; 53.4 months vs. 19.1 months, p=0.043).
Prognostic values of allogeneic HSCT in context with or without FLT3-ITD for
patients
In order to study the prognostic impact of allogeneic HSCT on FLT3 gene status, we
divided this cohort into 4 subgroups, based on FLT3 and HSCT (Table 2):
wtFLT3/nonHSCT (N=59), wtFLT3/HSCT (N=29), FLT3-ITD/nonHSCT (N=24) and
FLT3-ITD/HSCT (N=10). The patients with wtFLT3 (N=88) treated with allogeneic
HSCT were significantly younger (years; 33.4 ± 9.9 vs. 48.2 ± 14.5, p<0.001) and
tended to have higher WBC and LDH than those without allogeneic HSCT. The
patients with FLT3-ITD (N=34) treated with allogeneic HSCT also were significantly
younger (years; 40.3 ± 12.5 vs. 48.5 ± 8.4, p<0.001), had a higher WBC count (mean
± S.D.; 152.4 ± 107.9 x 106/L vs. 57.9 ± 52.7 x 106/L, p=0.002) and tended to have
higher LDH than those without allogeneic HSCT. Other clinical variances, including
FAB types, karyotypes and NPM mutation, did not differ.
The chemotherapy CR rate did not differ among the 4 subgroups (wtFLT3/nonHSCT,
wtFLT3/HSCT, FLT3-ITD/nonHSCT and FLT3-ITD/HSCT: 79.7%, 93.1%, 75.0%
and 90.0%, respectively; p=0.266). Fifty-six of the patients died during an overall
9
follow-up period of 238.77 years; the death rate (death/person-year) was 19.28%,
18.36%, 65.69% and 11.20% in patients with wtFLT3/nonHSCT, wtFLT3/HSCT,
FLT3-ITD/nonHSCT and FLT3-ITD/HSCT, respectively (Table 3). The median OS
of patients with FLT3-ITD/nonHSCT (9.8 months) was significantly shorter than the
median OS of those with wtFLT3/HSCT (53.4 months), wtFLT3/nonHSCT (40.7
months), and FLT3-ITD/HSCT (not reached; p=0.006). This survival result shows
that
when
FLT3-ITD
patients
received
allogeneic
HSCT
(subgroup:
FLT3/ITD-HSCT), the death rate and median OS were similar to that of patients with
wtFLT3 and significantly better than that of patients with FLT3-ITD without
allogeneic HSCT (Figure 1D). Subgroup analysis was performed for limiting patients
with CR1 status. 21 of 39 patients of HSCT group received HSCT at CR1 disease
status and 65 of 83 patients of nonHSCT group archived CR after induction
chemotherapy. Among all the 86 patients evaluated following CR1, the median OS of
patients with FLT3-ITD/nonHSCT (N=18, 17.1 months) was also significantly shorter
than the median OS of those with wtFLT3/HSCT (N=17, 53.4 months),
wtFLT3/nonHSCT (N=47, not reached), and FLT3-ITD/HSCT (N=4, not reached,
p=0.047; figure 1E). This result was similar to the total patient cohort.
Univariate analysis of the entire cohort showed that unfavorable karyotype was a poor
prognostic factor (hazard ratio = 2.43; 95% CI, 1.00-5.87; p=0.0492) for OS, and that
FAB-M3 was a factor with a favorable trend (hazard ratio = 0.16; 95% CI, 0.02-1.16;
p=0.0703). Of the 4 subgroups, FLT3-ITD/nonHSCT had the most significant
negative impact on OS (hazard ratio = 3.28; 95% CI, 1.56-6.89; p=0.0017), especially
when compared to wtFLT3/nonHSCT. In multivariate analysis of the 4 groups, the
independent favorable prognostic factor for OS was FAB-M3 (hazard ratio = 0.10;
95% CI, 0.01-0.80; p=0.0297), and the significantly poor risk factor was
10
FLT3-ITD/nonHSCT (hazard ratio = 3.57; 95% CI, 1.58-8.10; p=0.0023), after
adjustment for age, sex, WBC, LDH, karyotype, FAB classification and NPM
mutation. However, this poor risk with FLT3-ITD became inconsiderable when those
patients received allogeneic HSCT (subgroup: FLT3-ITD/HSCT; hazard ratio = 0.41;
95% CI, 0.11-1.59; p=0.20).
Discussion
Our results provide evidence that AML patients with FLT3-ITD and without
allogeneic HSCT have the worst survival. Allogeneic HSCT improves the clinical
outcome of AML patients with FLT3-ITD.
FLT3-ITD disrupts the normal auto-inhibition in the tyrosine kinase domain and leads
to AML cell proliferation and survival [12, 13]. From previous clinical studies, the
patients with FLT3-ITD are sensitized to induction chemotherapy, but usually have a
greater relapse rate and a shorter duration after remission [12, 18]. These features are
indeed observed in the present cohort. The CR rates of patients with and without
FLT3-ITD are 84.1% and 79.4%, respectively (p=0.539); the disease relapse rate of
patients with and without FLT3-ITD is 73.5% and 53.4%, respectively (p=0.043).
Therefore, post-remission consolidative treatment is the key factor in deciding the
patient's long-term OS. In our study, we found that patients with FLT3-ITD treated
with allogeneic HSCT had a long-term OS similar to patients with wtFLT3 (Figure
1D). However, a 2.57-fold increase in death and significantly shorter OS were
observed in patients with FLT3-ITD without allogeneic HSCT. These results may
indicate that allogeneic HSCT is a better consolidative therapy than chemotherapy
alone, and is potentially a preferred option to negate the poor risk factor of FLT3-ITD.
11
However, Gale and colleagues at the Medical Research Council of the United
Kingdom concluded that FLT3 status was not evidently an indicator for HSCT in
AML patients [14] (Table 5). They compared the patient group of “auto HSCT versus
non-HSCT”, “autograft versus allograft” and “donor” versus “no donor”, and found
that FLT3-ITD was still a prognostic factor for relapsed status, with or without HSCT.
No direct comparison of allogeneic HSCT and chemotherapy alone was discussed but
the author replied that the OS was not significantly improved in the allograft
recipients when compared with patients received chemotherapy alone and autograft
[15, 16]. They concluded that insufficient evidence to support allogeneic HSCT
improving prognosis of FLT3-ITD patients [14-16]. However, in the “donor” versus
“no donor” analysis, their figure 5 indeed showed the relapsed rate was significantly
decreased in “donor” group of patients with FLT3-ITD (donor vs. no donor: 44.1% vs.
71.1%; hazard ratio = 0.59; 95% CI, 0.40-0.87). The 5-year survival rate was only
43% in the “donor” group, and this might indicate the reasons of death were not all
contributed form AML. In 2 other studies, Bornhauser et al and Amy E. et al [17, 18]
performed retrospective analyses of patients in the AML96 study of the German study
group and from a single medical institution, and found improved OS in patients with
FLT3-ITD when undergoing HSCT. Salut Brunt et al. retrospectively analyzed HSCT
patients from the AML96 study, and found that FLT3-ITD still affected the OS of
patients receiving allogeneic HSCT [19]. However, the 2-year leukemia-free survival
of those with FLT3-ITD and HSCT was 58%, which was much better than the
historical control of FLT3 patients. The author concluded that allogeneic HSCT had a
relevant role in managing the patient group. In the present study, more than half of
FLT3 patients receiving HSCT are alive and free of leukemia (Figure 1D). Taken
together, previous analyses and our results show that allogeneic HSCT might have an
impact on improving OS in patients with FLT3-ITD.
12
All of the above studies are retrospective analyses (Table 5), and several same and
different biases are present in our study and prior studies. First, patients without CR1
were not enrolled in previous four studies. In our study, we analyze the total patient
cohort that enrolled CR1 and nonCR1 patients, and also do subgroup analysis limiting
the CR1 patients. Both results show that patients with FLT3-ITD/nonHSCT have the
significant worse prognosis and allogeneic HSCT improves the FLT3-ITD patients’
survival. Among the FLT3-ITD patients of our study, 6 patients received HSCT under
nonCR1 status and 4 of them are alive. Compared with FLT3-ITD/nonHSCT group, 3
primary refractory patients and 13 relapsed patients receiving salvage chemotherapy,
15 of them died on the disease (supplement table 1). Although the patient number is
limited, our data to the first show that patients with FLT3-ITD could get benefit from
allogeneic HSCT even beyond CR1. Second, the FLT3-ITD patients have a higher
relapse rate and shorter remission duration; some FLT3-ITD patients do not have CR
status. Patients with an early relapse or nonCR status have less opportunity to enter
HSCT. This subgroup of patients may also have poor biological characteristics, which
may have contributed to the poor outcome of the patients with FLT3-ITD/nonHSCT.
However, this subgroup is not included in the survival analyses in both previous and
the present studies. That is a reason for the good survival rate (58%) demonstrated by
Salut Brunt et al [19]. Third, other genetic factors also influence patient survival, but
they are not included in the analyses in prior studies and in ours [2, 11]. Even with
those confounding factors, allogeneic HSCT indeed improve the prognosis in some
FLT3-ITD patients. Base on prior and our studies, we suggest that early preparation
and performance of allogeneic HSCT in FLT3-ITD patients is a preferred choice.
In summary, the presence of FLT3-ITD correlates with a higher relapse rate and worse
13
survival [20]. Our study suggests that allogeneic HSCT significantly improves the
outcome of patients with FLT3-ITD. Tyrosine kinase inhibitors of FLT3 have been
developed, but many of them showed only a transient effect in reducing myeloid blast,
and the long-term treatment effect in combination with chemotherapy is still unknown
[21, 22]. On the basis of previous studies and our analysis, we conclude that
allogeneic HSCT is currently the preferred policy for patients with FLT3-ITD.
14
References
1.
4.
Rowe JM, Tallman MS. How I treat acute myeloid leukemia. Blood 2010; 116:
3147-3156.
Dohner H, Estey EH, Amadori S et al. Diagnosis and management of acute
myeloid leukemia in adults: recommendations from an international expert
panel, on behalf of the European LeukemiaNet. Blood 2010; 115: 453-474.
Mayer RJ, Davis RB, Schiffer CA et al. Intensive postremission chemotherapy
in adults with acute myeloid leukemia. Cancer and Leukemia Group B. N Engl
J Med 1994; 331: 896-903.
Levi I, Grotto I, Yerushalmi R et al. Meta-analysis of autologous bone marrow
5.
transplantation versus chemotherapy in adult patients with acute myeloid
leukemia in first remission. Leuk Res 2004; 28: 605-612.
Pfirrmann M, Ehninger G, Thiede C et al. Prediction of post-remission survival
2.
3.
6.
7.
in acute myeloid leukaemia: a post-hoc analysis of the AML96 trial. Lancet
Oncol 2012; 13: 207-214.
Gupta V, Tallman MS, Weisdorf DJ. Allogeneic hematopoietic cell
transplantation for adults with acute myeloid leukemia: myths, controversies,
and unknowns. Blood 2011; 117: 2307-2318.
Grimwade D, Walker H, Oliver F et al. The importance of diagnostic
cytogenetics on outcome in AML: analysis of 1,612 patients entered into the
MRC AML 10 trial. The Medical Research Council Adult and Children's
Leukaemia Working Parties. Blood 1998; 92: 2322-2333.
8. Schmid C, Labopin M, Nagler A et al. Treatment, risk factors, and outcome of
adults with relapsed AML after reduced intensity conditioning for allogeneic
stem cell transplantation. Blood 2012; 119: 1599-1606.
9. Hamadani M, Mohty M, Kharfan-Dabaja MA. Reduced-intensity conditioning
allogeneic hematopoietic cell transplantation in adults with acute myeloid
leukemia. Cancer Control 2011; 18: 237-245.
10. Yanada M, Matsuo K, Emi N, Naoe T. Efficacy of allogeneic hematopoietic
stem cell transplantation depends on cytogenetic risk for acute myeloid
leukemia in first disease remission: a metaanalysis. Cancer 2005; 103:
1652-1658.
11. Patel JP, Gonen M, Figueroa ME et al. Prognostic relevance of integrated
genetic profiling in acute myeloid leukemia. N Engl J Med 2012; 366:
1079-1089.
12. Kottaridis PD, Gale RE, Frew ME et al. The presence of a FLT3 internal
tandem duplication in patients with acute myeloid leukemia (AML) adds
15
important prognostic information to cytogenetic risk group and response to the
first cycle of chemotherapy: analysis of 854 patients from the United Kingdom
Medical Research Council AML 10 and 12 trials. Blood 2001; 98: 1752-1759.
13. Meshinchi S, Stirewalt DL, Alonzo TA et al. Structural and numerical variation
of FLT3/ITD in pediatric AML. Blood 2008; 111: 4930-4933.
14. Gale RE, Hills R, Kottaridis PD et al. No evidence that FLT3 status should be
considered as an indicator for transplantation in acute myeloid leukemia (AML):
an analysis of 1135 patients, excluding acute promyelocytic leukemia, from the
UK MRC AML10 and 12 trials. Blood 2005; 106: 3658-3665.
15. Meshinchi S, Arceci RJ, Sanders JE et al. Role of allogeneic stem cell
transplantation in FLT3/ITD-positive AML. Blood 2006; 108: 400-401.
16. Gale RE, Hills R,Wheatley K et al. Response: Allogeneic stem cell
transplantation and FLT3/ITD status in AML. Blood 2006; 108: 400-401.
17. Bornhauser M, Illmer T, Schaich M et al. Improved outcome after stem-cell
transplantation in FLT3/ITD-positive AML. Blood 2007; 109: 2264-2265;
author reply 2265.
18. DeZern AE, Sung A, Kim S et al. Role of allogeneic transplantation for
FLT3/ITD acute myeloid leukemia: outcomes from 133 consecutive newly
diagnosed patients from a single institution. Biol Blood Marrow Transplant
2011; 17: 1404-1409.
19. Brunet S, Labopin M, Esteve J et al. Impact of FLT3 internal tandem
duplication on the outcome of related and unrelated hematopoietic
transplantation for adult acute myeloid leukemia in first remission: a
retrospective analysis. J Clin Oncol 2012; 30: 735-741.
20. Yanada M, Matsuo K, Suzuki T et al. Prognostic significance of FLT3 internal
tandem duplication and tyrosine kinase domain mutations for acute myeloid
leukemia: a meta-analysis. Leukemia 2005; 19: 1345-1349.
21. Smith CC, Wang Q, Chin CS et al. Validation of ITD mutations in FLT3 as a
therapeutic target in human acute myeloid leukaemia. Nature 2012; 485:
260-263.
22. Stone RM, Fischer T, Paquette R et al. Phase IB study of the FLT3 kinase
inhibitor midostaurin with chemotherapy in younger newly diagnosed adult
patients with acute myeloid leukemia. Leukemia 2012.
16