Results
MBL expression is regulated by PPARγ in epithelial cells
The mechanisms of MBL-2 expression in epithelial cells were investigated. Besides the
established role of PPARγ in the expression of several receptors and in the regulation of the
mucosal immune response, PPARγ activation reduces C. albicans colonization in the murine
digestive tract. We assessed MBL-2 expression after stimulation of PPARγ expression by
multiple agonists in Caco-2 cells using both microarray and qRT-PCR assays (Fig. 1 and
Table 1). qRT-PCR analysis showed that MBL-2 mRNA expression was upregulated after
treatment of Caco-2 cells with GED (1 mM or 30 mM) or 5-ASA (30 mM) by a mean of 2.6fold (p<0.0001), 4.5-fold (p<0.0001), and 7.69-fold (p<0.0001), respectively, compared to
control cells. In addition, microarray analysis showed that MBL-2 mRNA was upregulated in
response to PPARγ agonists. With GED treatment (1 µM), MBL-2 was ranked 6th among 57
upregulated genes. With GED treatment (30 µM), MBL-2 was placed 10th among 355
upregulated genes. MBL-2 was ranked 6th gene among 121 upregulated genes with
pioglitazone (1 µM) and finally 16th among 1574 genes with 5-ASA. These data show that the
activation of PPARγ allows MBL-2 expression in the epithelial cells. To further support our
evidence of the involvement of PPARγ in MBL-2 expression, we downregulated the
expression of PPARγ in Caco-2 cells using a short hairpin RNA strategy that allows the
creation of a stable cell line in which the expression of PPARγ was significantly diminished
compared with the control cell line (ShLuc). Downregulation of PPARγ was found to lead to
a significant reduction in MBL expression compared with ShLuc control cells.
MBL expression in non-inflamed colon biopsies collected from CD patients
We analyzed the expression of MBL in two non-inflamed colons collected from CD patients
(Fig.2). Our preliminary results show that after C. albicans or C. albicans+pioglitazone (0.1
1
mM) incubation for 4hrs, these samples produced a level of MBL, similar to that observed in
mouse tissue culture.
Figure 1: Expression of MBL-2 is regulated by PPARγ in Caco-2 human colorectal cells.
(A) PPARγ activation led to MBL-2 expression in Caco-2 cells. MBL-2 transcripts were
quantified by qRT-PCR in Caco-2 cells treated with either GED (1 mM or 30 mM) or 5-ASA
(30 mM). Results are expressed as the mean ± SD of three different experiments. (B) Knockdown of Caco-2 cells for PPARγ (ShPPAR) resulted in a decrease in MBL-2 expression
compared with control Caco-2 cell luciferase (ShLuc). Results represent the mean ± SD of the
fold change in MBL-2 expression. (C) MBL-2 rank and up-regulated genes expressed in
Caco-2 cells in response to PPARγ agonist treatment by microarray analysis.
2
Figure 2: Expression of MBL in the non-inflamed colonic tissue collected from CD
patients after incubation with C. albicans combined or not with PPARγ agonist
treatment.
Table 1: Microarray analysis showing MBL expression after stimulation of Caco2 cells
with PPAR-γ agonists
Microarray analyses
Stimulation of Caco2 cells
Microarray (fold change in
with PPARg agonists
MBL-2 mRNA)
(MBL-2 rank among upregulated genes)
GED (1 mM)
2.8
6/57
GED (30 mM)
5.1
10/355
Pio (1 µM)
6.2
6/121
5-ASA (30 mM)
6
16/1574
.
3
Materials and methods
Cell culture
The Caco-2 colonic adenocarcinoma cell line was grown in Dulbecco’s modified Eagle’s
medium (DMEM; Invitrogen, Cergy-Pontoise, France) supplemented with 20% fetal calf
serum (FCS; Dutscher, Brumath, France), 1% penicillin-streptomycin (5 ml/L) (Invitrogen)
and 1% non-essential amino acids (5 ml/L) (Invitrogen). Cells were cultured as confluent
monolayers at 37°C in a controlled, 5% CO2 atmosphere. Each week, the confluent monolayer
was treated with trypsin (Invitrogen) and then replated after a 1:10 dilution.
Cell stimulation
The cells were plated in 6-well plates at a density of 1 x 106 cells/well. Serum deprivation was
used 16 h prior to stimulation in order to synchronize the cells. The cells were treated with
amino-phenyl-methoxy-propionic acid (GED) at a concentration of 1 mM and 30 mM, and 5aminosalycilate (5-ASA) at a concentration of 30 mM, or pioglitazone (1 µM) in DMEM
without serum. When necessary, the vehicle, DMSO (Sigma), was used as the control. After
24 h stimulation, the wells were rinsed three times with sterile PBS at 4°C. The cells were
then lysed with lysis buffer (RA1; Macherey-Nagel) containing 1% β-mercaptoethanol. The
plates were frozen at -80°C for subsequent RNA extraction.
RNA extraction
Total RNA was extracted with a Nucleospin RNA kit (Macherey-Nagel, Hoerdt, France).
After RNAse inactivation, total RNA was cleaned of traces of genomic DNA using DNAse
and eluted in RNAse-free, DEPC-free water. The purity of the RNA was evaluated by UV
spectroscopy on a Nanodrop system from 220 to 350 nm. Before the microarray experiment,
4
RNAs were also profiled on an Agilent 2100 bioanalyzer. One µg of total RNA was used in
the microarray analysis (minimum concentration: 50 ng/µL).
Microarrays
Dual-color gene expression microarrays were used to compare cRNA from the samples (cells
treated with DMSO (Ctrl) with cells treated with an agonist (Ago)). Briefly, RNA from the
samples was reverse-transcribed into cDNA (Affinity-Script RT; Agilent), which was then
used as the substrate for the synthesis and amplification of cRNA by T7 RNA polymerase in
the presence of cyanine 3-CTP for the Ctrl sample (green fluorescence) and cyanine 5-CTP
for the Ago sample (red fluorescence). The two labelled cRNAs were then mixed and
hybridized on the same array (G4851A Agilent 8 x 44K), which was then scanned (with an
Agilent G2505B scanner). Fluorescence was visualized after laser excitation and the relative
intensities of the two fluorophores was expressed as a ratio, in order to yield the over- or
under-expression status of each gene (using GeneSpring software (Agilent)). This analysis
was performed for each agonist. The transcriptomic profiles obtained for each agonist were
then compared. Expression of genes of interest was quantified by quantitative PCR, in order
to confirm the microarray results. The data have been deposited in NCBI's Gene Expression
Omnibus
1
and are accessible through GEO Series accession number GSE68852
(http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE68852)."
Quantitative PCR
The transcript level of MBL-2 was estimated by quantitative PCR (qPCR). 1 µg of total RNA
was reverse-transcribed into cDNA using a High Capacity cDNA Achive kit (Applied
Biosystems). qPCR was performed using an ABI PRISM 7000 sequence detection system
(Applied Biosystem). Quantification of qPCR signals was performed using the ΔCt relative
5
quantification method using GAPDH as a reference gene. The values are represented as
relative mRNA level variation or fold increase compared to control conditions. The primer
pair was chosen with qPrimer depot software (http://primerdepot.nci.nih.gov). (Fwd primer:
GGAGACCCTGGAAAAAGTCC; reverse primer: TTGTTTGCCCAGAGAGAAGG).
PPARγ knock-down cells generation
PPARγ knock-down Caco-2 cells have been described previously 2. PPARγ knock-down was
obtained using the pSUPER.retro system (OligoEngine). Forward and reverse target
sequences corresponding to nucleotides 105–123 of human PPARγ1 mRNA (50GCCCTTCACTACTGTTGAC-30) were cloned into the BglII/XhoI restriction sites of the
pSUPER.retro vector giving the ShPPAR construct. A negative control pSUPER.retro vector
plasmid containing the sequence 50-ACGCTG AGTACTTCGAAAT-30 targeted against the
luciferase gene was also generated (ShLuc construct). The construct was transfected into
Caco-2 cells (ATCC n°CRL-2102) using Nucleofector technology from Amaxa Biosystems
according to the manufacturer’s protocol. Stably transfected clones were selected 24 h posttransfection with complete culture medium supplemented with puromycin (5 mg/mL). The
silencing of PPARγ expression was checked by quantitative reverse transcription PCR and
western-blot analysis. Once established, ShPPAR, and ShLuc cell lines were maintained in
complete medium supplemented with 2.5 mg/mL puromycin.
Culture of non-inflamed colonic tissue from CD patients
Two human colon biopsies were obtained from surgical specimens after ileo-colectomy.
Biopsies were immediately incubated in DMEM containing 10% of FBS, 1% of
penicillin/streptomycin and 1% of L-Glutamin. These biopsies were then incubated with 108
C. albicans and/or pioglitazone (Sigma) at a concentration of 0.1 mM. Culture supernatants
6
were collected at 30 minutes and 4 hours. The MBL level in the supernatant was determined
using ELISA commercial kit (Bioporto).
References
1.
Edgar R., Domrachev M., Lash A. E. Gene Expression Omnibus: NCBI gene
expression and hybridization array data repository. Nucleic Acids Res. 30, 207-210
(2002).
2.
Bouguen G., Langlois A., Djouina M., Branche J., Koriche D., Dewaeles E. et al.
Intestinal steroidogenesis controls PPARgamma expression in the colon and is
impaired during ulcerative colitis. Gut. 64, 901-910 (2015).
7