Supplemental Figures S1-S11
YUCASIN is a potent inhibitor of YUCCA(s), a key enzyme in auxin biosynthesis
Takeshi Nishimura1,+, Ken-ichiro Hayashi2, Hiromi Suzuki1, Atsuko Gyohda1, Chihiro Takaoka1,
Yusuke Sakaguchi1, Sachiko Matsumoto1, Hiroyuki Kasahara3, Tatsuya Sakai4, Jun-ichi Kato1, Yuji
Kamiya3 and Tomokazu Koshiba1,*
*Corresponding
author:
Tomokazu Koshiba
Department of Biological Sciences, Tokyo Metropolitan University, 1-1 Minami-Osawa,
Hachioji-shi, Tokyo 192-0397, Japan
Tel/Fax: +81-42-677-2565
E-mail: koshiba-tomokazu@tmu.ac.jp
List of supplemental figures
Figure S1. Expression and purification of AtYUC1-His protein analyzed by SDS-PAGE.
Figure S2. Enzymatic properties of recombinant AtYUC1-His proteins.
Figure S3. Effects of methimazole and S-methyl yucasin on AtYUC1-His activity and molecular
docking study of yucasin, Trp, and kyn on TAA1.
Figure S4. Effects of yucasin and kyn on maize and Arabidopsis Trp aminotransferase activity.
Figure S5. Effects on yucasin on high-auxin phenotype induced by the excess exogenous auxin.
Figure S6. Effect of yucasin on DR5::GUS expression in Arabidopsis roots, and on phenotype of
auxin-high production mutant sur2.
Figure S7. Effects of methimazole on IAA levels in maize coleoptile tips.
Figure S8. Estimation of the binding affinity of yucasin on Schizosaccharomyces pombe
flavin-containing monooxygenase (FMO).
Figure S9. Phylogenetic analysis of amino acid sequences of YUC proteins.
Figure S10. Yucasin treatment reduced root apical meristematic activity.
Figure S11. List of primers used for qRT-PCR analysis.
M.W. of AtYUC1 (from amino acid sequence) = 46.0 kD (AtYUC1-6-His=46.8), VC; empty vector
control
Figure S1. Expression and purification of AtYUC1-His protein analyzed by SDS-PAGE.
(a) CBB staining. Whole cell lysate of E. coli harboring the pET3c vector without or with induction
(lanes 1, 2), eluted fraction of the His-tag column of pET3c (lane 3), whole cell lysate of E. coli
harboring the AtYUC1-His-expression plasmid without or with induction (lanes 4, 5), and eluted
fraction of His-tag column of AtYUC1-His (lane 6). About 2-8 g/lane of protein was loaded. (b)
Western-blot analysis with anti-6-His antibody to detect recombinant AtYUC1-His protein. Ten-time
diluted samples were used for analysis. (c) Western-blot analysis with anti-AtYUC1. Samples were
loaded as in b.
Figure S2. Enzymatic properties of recombinant AtYUC1-His proteins.
(a) Rate of IAA production from IPyA correlated with enzyme amount. At least up to 30 g of
partially-purified AtYUC1-His protein, activity increased linearly. (b) Amount of IAA production
from IPyA correlated with enzymatic reaction time. Reaction solution contained 25 g of
partially-purified AtYUC1-His protein. At least up to 50 min, activity increased linearly. (c) Full
mass spectra of authentic IAA (IAA-TMS2; above) and reaction product (below). Authentic IAA and
reaction product were trimethylsilylated with N-methyl-N-trimethylsilyltrifluoroacetamide. Then,
samples were analyzed by GC-Full-MS.
S2 continued
(d) Confirmation of the amount of IAA existed in the IAA peak detected using HPLC-fluorescence
detector. Equal amount of
13
C-IAA to the product IAA calculated according to the peak area was
added in IAA fraction collected from HPLC eluate. The trimethylsilylated samples were analyzed by
GC-SIM-MS. Relative abundance of obtained signals in
13
C-IAA were almost the same to those of
12
C-IAA originated form enzyme reaction, showing that the peak of IAA observed in HPLC analysis
is reliable for quantification of IAA in enzymatic assay. Arrow in the gas-chromatogram indicates
peak of IAA.
Figure S3.
Effects of methimazole and S-methyl yucasin on AtYUC1-His activity and molecular
docking study of yucasin, Trp and kyn on TAA1.
(a) Effect of S-methyl yucasin and methimazole on AtYUC1-His activity. (b) Chemical structure of
S-methyl yucasin. (c) The crystal structure of TAA1 and the predicted binding pose and affinity of
yucasin in active site of TAA1. The structural data of TAA1 (PDB ID: 3BWN) were edited by
Discovery Studio visualizer 3.0 (Accelrys) and then converted to PDBQT file by MGL tools (The
Scripps research institute). The ligands (Trp, kyn and yucasin) were docked into TAA1 binding site
and binding affinity was evaluated by Autodock Vina software (Trott and Olson, 2010). The binding
pose with highest affinity score were shown. Trp, substrate and kyn, inhibitor displayed almost same
binding pose and similar affinity scores (estimated log Kd -6.1 and -5.9). The binding pose of yucasin
is different and showed ten-times lower affinity score (-4.9). (d) Predicted binding affinity (- log Kd
estimated)
of inactive control compounds, 4-chlorobenzoic acid, alanine, methimazole, derivative 2,
glycine, S-methyl yucasin (inactive analog of yucasin) to TAA1.
Figure S4.
Effects of yucasin and kyn on maize and Arabidopsis Trp aminotransferase activity.
(a) Typical HPLC profile to detect IPyA, reaction product from Trp by maize Trp aminotransferase
(AT). Detail procedure is described previously (Koshiba et al, 1993). Crude enzyme fraction (30-60%
ammonium sulfate fraction) was prepared from the extracts of 0-5 mm coleoptile tips and Trp AT
activity was assayed with 100 μl reaction mixture containing 0.1 M borate-EDTA (pH 8.5), 5 mM Trp,
0.2 mM PLP, and 0.5 mM -KG. The reaction was performed for 55°C for 30 min, then 100 μl of 100%
methanol was added and after centrifugation an aliquot was analyzed to HPLC with 10-50%
methanol containing 0.2% acetic acid, linear gradient for 40 min at 1 ml/min flow rate. Retention
time of Trp and IPyA are 7.7 and 25.0 min, respectively (arrows). In absence of -KG, IPyA could not
be detected. (b) Full mass spectra of trimethylsilylated authentic IPyA (IPyA-TMS3) and the eluted
product with a retention time at 12.6 min on gas-chromatography. Peaks of m/z 260, 314, 348 (base
peak), 404 and 419 (M+) were detected as major ion fragments. (c) Effects of yucasin and kyn on Trp
AT activity of maize coleoptiles and Arabidopsis etiolated seedlings. Arabidopsis Trp AT was
extracted from 6-day-old dark grown seedlings and 30-60% ammonium sulfate fraction was used as
the enzyme solution. The activity was assayed with 50 μl reaction mixture as same as (a), except
using 2 mM Trp, with and without yucasin or kyn. After the reaction for 30 min, the amount of IPyA
was determined from the peak area at retention time 25.0 min. The values obtained from several
experiments were normalized and indicated as relative values (%) against each complete enzyme
reaction (100%). The values are average ±SE (n=3).
Figure S5. Effects of yucasin on high-auxin phenotype induced by the excess exogenous auxin.
Col-0 and 35S::YUC1 seedlings were grown for 5 days on liquid MS medium containing 20 M
yucasin, 50 M L-AOPP or 50 M 5-methyl Trp (Trp analog, 5-mT) with or without IAA, IAM or Trp.
Yucasin did not suppress the phenotype induced by exogenously-applied excess IAA and IAM. In
contrast, non-specific IAA biosynthetic inhibitor, such as L-AOPP and 5-mT, suppressed high auxin
phenotype because of their toxicity.
Figure S6. Effect of yucasin on DR5::GUS expression in Arabidopsis roots, and on phenotype of
auxin-high production mutant sur2.
(a) Effect of yucasin and PEO-IAA on expression of DR5::GUS in Arabidopsis roots. For the
DR5::GUS reporter assay, seedlings were grown on vertical agar plates for 5 d then incubated in 10
mM KPB containing a specified concentration of yucasin and PEO-IAA, a TIR1/AFB auxin receptor
antagonist (Nishimura et al., 2009; Hayashi et al., 2012), with or without 1 M IAA for 7 h. Bar = 2
mm. (b) Effects of yucasin on sur2 seedlings grown for 5 days in the presence of 50 M yucasin.
Figure S7. Effect of methimazole on IAA level in maize coleoptile tip.
Yucasin and methimazole were applied to the insides of 2-mm coleoptile tips, and then IAA levels in
coleoptile tips were determined by GC-MS. Values are averages of two experiments.
Figure S8. Estimation for the binding affinity of yucasin on Schizosaccharomyces pombe
flavin-containing monooxygenase (FMO).
(a) The conformation of FAD and NADPH or methimazole in the binding site of FMO crystal data
(PDB ID: 2GVC and 2GV8). The yucasin was imposed to fit the coordinates of thiourea moiety in
methimazole (PDB ID: 2GVC) by Swiss PDB viewer. The binding affinity of ligands are estimated by
the DrugScore X software version 0.88 (Neudert and Klebe, 2011). The affinity score of NADPH,
methimazole and yucasin were -98.271, -27.245 and +363.741, respectively. NADPH showed highest
binding affinity in this calculation. p-Chlorophenyl moiety of yucasin would collide with the surface
of binding site, when the thiourea moiety in yucasin was located near the coordinates of methimazole
in crystal data. (b) The position of sulfur atom of thiourea moiety would be crucial for the oxidation of
methimazole by FAD co-factor in FMO binding site (Eswaramoorthy et al., 2006).
Figure S9. Phylogenetic analysis of amino acid sequences of YUC proteins.
The tree was inferred using the UPGMA criterion in MEGA v. 4 (Tamura et al., 2007).
Figure S10. Yucasin treatment reduced root apical meristematic activity.
Arabidopsis Col-0 seedlings were grown on vertical agar plates containing yucasin with or without
IAA for 5 days. Root tip structure was visualized using FM4-64 staining. White dashed lines mark
the division zone of the root tips. Bar = 50 m.
Figure S11. List of primers used for the qRT-PCR analysis.
Gene
spi1
YUCCA-like 1
YUCCA-like 2
vt2
vt2L
Ubiquitin
Fwd
ATGGAGGTCAGCCTGGATTT
Rev
ACGTCGAGAGACCCAGCAT
Fwd
GTTGTCGGGTGTGGAAACTC
Rev
TCCCTGGGCAAGATGTGTA
Fwd
GACCTCTGCGACCACAATG
Rev
AGGAAGCGGAGCAGGAAG
Fwd
TGCGCCATGATCGAGTAGTA
Rev
TCCTGCCCTTGTTCCTACC
Fwd
CAAAGAGATGGCGGTCACTAA
Rev
TCCGCGTCAGTATCCTGTG
Fwd
TAAGCTGCCGATGTGCCTGCGTCG
Rev
CTGAAAGACAGAACATAATGAGCACAG