Characterization of genetic variation in the VGLL4 gene in Anorexia Nervosa
Supplemental Information
Methods
AN participants
396 female AN DNA samples from participants of European descent were
genotyped and all individuals met DSM-IV criteria for AN (including AN without DSMIV criterion D- Amenorrhea).
A further 554 AN DNA samples (97.9% female) (mean age =26.2 ±8.14) were
added to the replication cohort to obtain the 950 individuals which were subject to NGS.
These were obtained from the Price Foundation Anorexia Nervosa Affected Relative Pair
(AN-ARP) dataset (Kaye et al., 2000) and the AN Trios study (Reba et al., 2005), which
were collected from sites located across the USA and Northern Europe.
These
individuals also met DSM-IV criteria for AN (including AN without DSM-IV criterion D
– Amenorrhea); however, they were not limited to female participants. Eating disorder
profiles were obtained by using a modified version of the Structured Interview for
Anorexic and Bulimic Disorders (SIAB) (Fichter et al., 1998) and an expanded version of
module H of the Structured Clinical Interview for DSM-IV Axis I Disorders (SCID)
(First et al., 1997). Inclusion criteria included low weight that is/was <5th percentile for
Body Mass Index (BMI) for age and gender according to the National Health and
Nutrition Examination Survey (NHANES) (Hebebrand et al., 1996), onset of AN prior to
age 25, age 13-65 at the point of entry to study, and study criteria met for at least 3 years
prior to entry into the study. Further inclusion criteria used for the AN trios study
included weight being controlled through restricting or purging and participants were
excluded if they reported a BMI >27kg/m2 for females and >27.8kg/m2 for males.
Control participants
Six hundred and ninety female control samples were collected at the same sites as
the AN Trios dataset in proportion to the number of AN participants entered at that site
and were aged 18-65 years (mean age = 26.34 ± 8.33). Control participants had a lifetime
adult BMI of 19-27kg/m2. Exclusion criteria included a score of greater than 20 on the
Eating Attitudes Test-26 (Garner et al., 1982) and a possible or probable Axis 1 disorder
according to the SSPQ-X and the reported presence of a treated Axis 1 disorder in a first
degree relative. All data and samples were collected using IRB-approved consent.
SNP selection
The six genes selected for genotyping from the GWAS were AKAP6
(NM_004274.4),
FAM155A
(NM_001080396.2),
LRP2
(NM_004525),
NTNG1
(NM_001113228), VGLL4 (NM_001128220) and ZNF804B (NM_181646.2). These
genes contained SNPs that were most significantly associated with AN. 5 genes were not
chosen for replication from the GWAS study as the SNPs associated with AN for these
genes were located >29 kb away from the gene locus. Significantly associated SNPs from
within each of the six genes were genotyped, as were any non-synonymous SNPs with a
sufficiently high minor allele frequency (MAF) (>0.05) located within the GWAS
associated genes. Only SNPs which lay in coding genes were considered. For any SNPs
for which a Taqman® SNP Genotyping assay was not available, a SNP in perfect linkage
disequilibrium (LD) (r2 =1) was selected and genotyped as a proxy. LD information was
obtained from the HapMap Genome Browser release #27 (Phase 1, 2 and 3 merged
genotypes and frequencies) CEU population. These included rs11842161 which tags
rs957798 in FAM155A, and rs830997 which tags rs830995 in LRP2. The SNPs selected
for genotyping are summarized in Table 1.
Next Generation Sequencing – SOLiD 4
950 DNA samples from individuals with AN were used as part of the NGS of
VGLL4 (396 DNA samples from the replication cohort and 554 individuals from the ANARP dataset). DNA was pooled into 95 pools (10 individuals/pool) with a final DNA
concentration of 10ng/ul (each individual contributing 25ng of DNA to the pool). A 9384
basepair (bp) amplicon of VGLL4 (chr3:11597356-11606739, UCSC Feb 2009 [hg19])
was amplified using SequalPrep long PCR kit (Life Technologies, Carlsbad, CA) on each
of the 95 pools. Only VGLL4 was selected for NGS, as this is the only association from
the original AN GWAS (Wang et al, 2011) that we were able to replicate in our cohort.
PCR was performed using primers F- GAGTCGGGGGCTCCATCTTCTATG and RACCCTTACAACAGTAGGATTTAGTAG
under
the
following
conditions:
1x
SequalPrep buffer with dNTPs, 2% dimethyl sulfoxide, 0.5X Enhancer A, 0.8µg/µl
Bovine Serum Albumin, 0.25µM F and R primers and 1.8 Units of SequalPrep long
polymerase in a 20µl reaction. PCR cycling conditions were as follows: 94°C for 2
minutes, 10 cycles of 94°C for 10 seconds, 59°C for 30 seconds, 68°C for 9 minutes and
30 seconds followed by 30 cycles of 94°C for 10 seconds, 59°C for 30 seconds, and 68°C
for 9 minutes and 30 seconds with a 20 second extension for each cycle at 68°C. A final
extension time of 5 minutes at 72°C was carried out. The amplicon spans a region on
chromosome 3:11597356-11606739 and captures ~80% of the coding region of VGLL4.
It was not possible to capture 100% of the coding region as exon 1 of VGLL4 is >36kb
away from the exons sequenced in this study, and this region was too large to capture by
long-range PCR amplification.
Amplicons were quantified by fluorometry using the Qubit® dsDNA HS assay
kits and the Qubit® 2.0 Fluorometer. After quantification, each amplicon pool was
standardized to 100ng/µl and sonicated to generate 150-160bp fragments using the
Covaris E210 sonicator at a temperature <6°C.
Library preparation of each of the 95 DNA pools containing the sonicated ~9.4kb
VGLL4 amplicons was performed. First end repair of the DNA was carried out using the
conditions suggested by Life Technologies. End repaired DNA was then ligated to the
multiplex P1 and P2 adaptors using the SOLiDTM fragment library barcoding kit module
1-95 so that pool 1 was attached to barcode 1 and pool 2 to barcode 2 et cetera.
Barcoded libraries were then nick translated and amplified according to the Life
Technologies standard protocol.
Pooled DNA was purified using Agencourt Ampure XP (Beckman-Coulter,
Indianapolis, IN) magnetic beads. The purified barcoded pools were quantified and
assessed for quality using the Agilent DNA 1000 chips (Agilent, Santa Clara, CA). A
final pool of DNA was made containing 500pM of DNA. SOLiD TM 4 sequencing was
performed at Penn Genome Frontiers Institute High Throughput Sequencing Facility.
References
Fichter, M. M., Herpertz, S., Quadflieg, N. & Herpertz-Dahlmann, B. (1998) Structured
Interview for Anorexic and Bulimic disorders for DSM-IV and ICD-10:
updated (third) revision. Int J Eat Disord, 24, 227-49.
First, M. B., Spitzer, R. L., Gibbon, M. & Williams, J. B. (1997) Structured Clinical
Interview for DSM-IV Axis I disorders (SCID I). New York: Biometric Research
Department.
Garner, D. M., Olmsted, M. P., Bohr, Y. & Garfinkel, P. E. (1982) The eating attitudes
test: psychometric features and clinical correlates. Psychol Med, 12, 871-8.
Hebebrand, J., Himmelmann, G. W., Heseker, H., Schafer, H. & Remschmidt, H. (1996)
Use of percentiles for the body mass index in anorexia nervosa: diagnostic,
epidemiological, and therapeutic considerations. Int J Eat Disord, 19, 359-69.
Kaye, W. H., Bulik, C. M., Plotnicov, K., Thornton, L., Devlin, B., Fichter, M. M.,
Treasure, J., Kaplan, A., Woodside, D. B., Johnson, C. L., Halmi, K., Brandt, H. A.,
Crawford, S., Mitchell, J. E., Strober, M., Berrettini, W. & Jones, I. (2008) The
genetics of anorexia nervosa collaborative study: methods and sample
description. Int J Eat Disord, 41, 289-300.
Reba, L., Thornton, L., Tozzi, F., Klump, K. L., Brandt, H., Crawford, S., Crow, S.,
Fichter, M. M., Halmi, K. A., Johnson, C., Kaplan, A. S., Keel, P., Lavia, M.,
Mitchell, J., Strober, M., Woodside, D. B., Rotondo, A., Berrettini, W. H., Kaye,
W. H. & Bulik, C. M. (2005) Relationships between features associated with
vomiting in purging-type eating disorders. Int J Eat Disord, 38, 287-94.
Wang, K., Zhang, H., Bloss, C. S., Duvvuri, V., Kaye, W., Schork, N. J., Berrettini, W. &
Hakonarson, H. (2011) A genome-wide association study on common SNPs
and rare CNVs in anorexia nervosa. Mol Psychiatry, 16, 949-59.