1
Methods S1
Constructs
AtSerpin1-GFP was constructed by combining the respective forward oligonucleotide
5’–ACGCGTCGACATGGACGTGCGTGAATCAAT–3’, with the reverse
oligonucleotide 5’–TGCTCTAGAATGCAACGGATCAACAACTTG–3’ in PCR
amplification of AtSerpin1. The resultant clone was fused upstream to GFP-HA by
SalI-XbaI in a pPZP111 vector and used to transform Agrobacterium tumefaciens
strain EHA105. GFP-AtSerpin1 was constructed by fusion of AtSerpin1 sequence
downstream to GFP-HA into pMLBart by HindIII and used to transform
Agrobacterium tumefaciens strain GV3101. RD21-RFP was constructed by
combining pRD21 upstream to the mRFP coding sequence into the pART7 vector
containing the omega translational enhancer (Gallie and Kado 1989). pRD21 was
cloned by PCR using the respective forward oligonucleotide 5’–
CCATGGGGTTCCTTAAGCCAACTATGG–3’ (including 5’ NcoI), and the reverse
oligonucleotide 5’–GGATCCGGCAATGTTCTTTCTGC–3’ (including 5’ BamHI).
The mRFP sequence was cloned by PCR using the respective forward oligonucleotide
5’–CGGGATCCGCCTCCTCCGAGGACGTCATC–3’ (including 5’ BamHI), and
the reverse oligonucleotide 5’–CGTCTAGAGGCGCCGGTGGAGTGG–3’
(including 5’ Xba1). The sequence RD21-RFP was cloned into pMLBart by NotI and
used to transform Agrobacterium tumefaciens strain GV3101. Stable plant
transformation lines RD21-1 and RD21-2 were isolated from the RD21-RFP
construct.
Native promoter-AtSerpin1-GFP was constructed by combining three PCR fragments
into the pART7 vector: 1) a fragment of genomic DNA 761 bp upstream to ATG of
AtSerpin1 flanked by NotI and AvrII, 2) AtSerpin1 fused to GFP (GFP was fused in
AtSerpin1 C- terminus) flanked by AvrII and AflII, and 3) OCS terminator flanked by
AflII and NotI. The sequence Native promoter-AtSerpin1-GFP was cloned into
pMLBart by NotI and used to transform Agrobacterium tumefaciens strain GV3101.
Subcellular fractionation
Two week-old seedlings of AtSerpin1-HA were minced in 10 mM HEPES-KOH, pH
7.5, and 10% (w/w) sucrose, and then filtered through cheesecloth. The filtrate was
2
subjected to differential centrifugation to obtain a 1,000x g pellet (P1), an 8,000x g
pellet (P8), a 100,000x g pellet (P100), and a 100,000x g supernatant (S100). Each
fraction was subjected to SDS-PAGE and was subsequently subject to immunoblot
with anti AtSerpin1 antibodies.
Pathogenicity assays
Pathogenicity assays for all lines were performed as follows: detached leaves of 3week-old plants were inoculated with 7 µl of 106 B. cinerea (strain B.05.10) or C.
higgisianum (strain IMI-349063) conidia/ml, one spot per leaf. S. sclerotium (strain
1980) infection plug inoculation was carried out on 3-week-old Arabidopsis detached
leaves with 5 mm diameter plug discs of the fungus mycelium that were previously
grown on ½ strength potato dextrose agar media for 5 d. Following inoculation, the
leaves were incubated in humid chambers (95% RH).