Supplementary Materials and Methods
Patients
We used eight case-control series, in total 1,712 bladder cancer cases and 2,020 controls
that have been collected by the IfADo and its cooperation partners from 1995 to 2011. The
sample collection was approved by the local Ethics Committee and by the IRB (institutional
review board). Exclusion criteria were a missing written informed consent, age of less than
20 years and, in case of the German and Hungarian study groups, non-Caucasian descent.
Cigarette smoking was defined as non-smokers, former smokers, i.e. smokers that quit
smoking at least one year before diagnosis (cases) or examination (controls), and current
smokers. Age was defined as “age at diagnosis” for the cases and “age at examination” for
the control persons. All bladder cancer cases and controls were genotyped for NAT2 by PCR
and RFLP-based methods and/or for the NAT2 tag SNP rs1495741 by TaqMan® assay as
part of an ongoing case-control series on genetic and occupational risk factors for urinary
bladder cancer. Data on NAT2 7-SNP and tagSNP genotypes and phenotypes was
published elsewhere (Selinski et al. 2011). Data on NAT2 7-SNP genotypes was included in
Selinski et al. (2013). Data on the NAT2 tagSNP was part of the data set analysed in
Schwender et al. (2012).
Hungary
The Hungary case-control series contains 226 bladder cancer cases and 76 controls from
the Department of Urology, Semmelweis University, Budapest. The median age at diagnosis
was 71 (range 38-95) years. 63% of the participants were males. The controls (74% males,
median age 63, range 30-81 years) were cancer free. Data were collected from 2004 to
2006. Data on tumour stage and grade were obtained through the cancer registry. Controls
without malignant disease were frequency-matched for age (time of examination) with the
cases. Caucasian descent was confirmed by questionnaire-based documentation of
nationality. Data collected in cases and controls include age, gender, a documentation of
1
occupational activities and exposures to known or suspected occupational bladder
carcinogens and lifetime smoking habits.
East Germany
The Wittenberg case-control series (Lutherstadt Wittenberg bladder cancer study) as
described in Golka et al. (2009) was used. In brief, 216 patients with a confirmed bladder
cancer from the Department of Urology, Paul Gerhardt Foundation, Lutherstadt Wittenberg,
Germany, were included. Patients were enrolled from December 1995 to January 1999. The
median age at diagnosis was 66 (range 20-91) years. 86% of the participants were males.
Controls (N=212, 84% males, median age 68, range 29-91 years) were from the same
department of urology, but were admitted for treatment of benign urological diseases.
Exclusion criteria were a malignant disease in the medical history. Caucasian descent was
confirmed by questionnaire-based documentation of nationality. Data were collected from
July 2000 to May 2005. Cases and controls were matched for age and gender. Data
collected for cases and controls include age, gender, a complete documentation of
occupational activities performed at least for six months, documentation of work places with
known bladder cancer risk over the entire working life, exposures to known or suspected
occupational bladder carcinogens, lifetime smoking habits, family history of bladder cancer,
numbers of urinary infections treated by drugs during the previous 10 years, place of birth
and places of residency for more than 10 years. In the case of bladder cancer cases, data on
tumour stage, grade and treatment were taken from the records. Bladder cancer was
diagnosed from July 1979 to January 1999.
West Germany
West Germany-ongoing case-control series (W. Germany-ongoing)
The West Germany ongoing case-control series contains bladder cancer cases and controls
from the Department of Urology, St.-Josefs-Hospital Dortmund-Hörde, the Department of
2
Urology, Klinikum Dortmund, the Department of Urology, Lukasklinik Neuss, the Department
of Urology at the Heinrich-Heine University of Düsseldorf and from the department of Urology
at the Johannes Gutenberg University of Mainz, Germany. Caucasian descent was
confirmed by questionnaire-based documentation of nationality (Lehmann et al. 2010). Data
on tumour stage and grade were obtained through the cancer registry. All study groups
besides Dortmund-Hörde are still ongoing. Controls were frequency-matched for age (time of
examination) with the cases. Data collected for cases and controls include age, gender, a
complete documentation of occupational activities performed at least for six months,
documentation of work places with known bladder cancer risk over the entire working life,
exposures to known or suspected occupational bladder carcinogens, lifetime smoking habits,
family history of bladder cancer, numbers of urinary infections treated by drugs during the
previous 10 years, place of birth and places of residency for more than 10 years.
Dortmund bladder cancer study, St.-Josefs-Hospital Dortmund-Hörde, Germany
The case-control series consists of 195 patients with a confirmed bladder cancer from the
Department of Urology, St.-Josefs-Hospital Dortmund-Hörde, located in an area of former
coal, iron and steel industries and 235 controls from the same Department of Urology,
admitted for treatment of benign urological diseases, enrolled from July 2009 to December
2010. The median age at diagnosis was 71 (range 35-89) years. 75% of the participants
were males. The 235 control individuals (77% males) were cancer free and frequencymatched for age with the cases (median age 71, range 22-100).
Dortmund bladder cancer study, Klinikum Dortmund, Germany
Twenty-six bladder cancer cases and five controls from the Department of Urology, Klinikum
Dortmund, Germany, located in an area of former coal, iron and steel industries, enrolled
from July 2007 to July 2010 were included. The median age at diagnosis was 69 (range 4184) years. 69% of the participants were males. Data were collected from July 2007 to April
2010. The five controls (three males) were cancer free (median age 71, range 49-83).
3
Neuss bladder cancer study, Lukasklinik Neuss, Germany
The ongoing case-control series consists of 284 bladder cancer cases and 197 controls from
the Department of Urology, Lukasklinik Neuss, Germany. The median age at diagnosis was
73 (range 26-93) years. 78% of the participants were males. Data on tumour stage and
grade were obtained through the cancer registry. The 197 male controls (59% males, median
age 49, range 21-89 years) were cancer free. Data was collected from June 2009 to
November 2011.
Düsseldorf bladder cancer study, Heinrich-Heine University, Germany
The ongoing case-control series consists of 84 bladder cancer cases and 59 controls from
the department of Urology at the Heinrich-Heine University of Düsseldorf, Germany. The
median age at diagnosis was 70 (range 27-95) years. 80% of the participants were males.
The controls (15% males) were cancer free (median age 61, rage 23-85). Data was collected
from November 2009 to March 2011.
Mainz bladder cancer study, Johannes Gutenberg University, Germany
Thirty bladder cancer cases and 21 controls from the department of Urology at the Johannes
Gutenberg University of Mainz, Germany, were included. The median age at diagnosis was
64 (range 35-81) years. 70% of the participants were males. Data on tumour stage and
grade were obtained through the cancer registry. The 21 control individuals (62% male) were
cancer free (median age 65, range 30-78 years). Data was collected from January 2010 to
September 2010.
West Germany–industrial burdened case-control series (W. Germany-industrial)
The West Germany – industrial burdened case-control series (W. Germany - industrial)
consists of two independent case groups and one control cohort.
4
Dortmund hospital based case-series (DO-hospital)
Ninety-one patients with confirmed bladder cancer from the Department of Urology, Klinikum
Dortmund, Germany, located in an area of former coal, iron, and steel industries, were
included. Data were collected from November 1993 to June 1995. All items of the
questionnaire applied in Dortmund were also included in the extended version of the
questionnaire presented to the cases and controls in the Lutherstadt Wittenberg group.
Bladder cancer was diagnosed from July 1981 to June 1995. The median age at diagnosis
was 67 (range 45-84) years. 85% of the participants were males. Caucasian descent was
confirmed by questionnaire-based documentation of nationality.
Dortmund occupational case-series (DO-occupational)
The Occupational case-series (study on patients with suspected occupational bladder
cancer) as described by Golka et al. (2009) was used. Details of the ongoing study on 342
suspected cases of occupational bladder cancer from Germany, mainly from the Federal
State of North Rhine-Westphalia, reported to the authorities and surveyed for recognition of
an occupational disease (in Germany named “Berufskrankheit BK 1301”) from February
1996 to May 2011 were reported recently. Bladder cancer was diagnosed from January 1984
to March 2011. The individuals were suspected to be exposed to occupational bladder
carcinogens, mostly carcinogenic aromatic amines, azo dyes based on carcinogenic
aromatic amines or polycyclic aromatic hydrocarbons. According to the situation at
workplaces in former decades, 93% of the patients were males. The median age at diagnosis
was 60 (range 32-83) years. All surveyed bladder cancer patients gave informed consent for
genotyping of enzymes relevant for bladder cancer and N-acetyltransferase 2 phenotyping
by caffeine metabolites. Therefore, urine samples were obtained in addition to the blood
samples. Occupational and concurrent non-occupational risk factors for bladder cancer as
well as Caucasian descent were explored by three medical specialists in a personal
interview.
5
Dortmund controls (DO-controls)
The control group consists of persons from the greater Dortmund area, Germany, who did
not present a malignancy in the medical history. Dortmund is a city with approximately
600,000 inhabitants located in North Rhine-Westphalia, which is the westernmost and - in
terms of population and economic output - the largest Federal State of Germany. Briefly, 191
patients of the Department of Surgery of the Klinikum Dortmund without any malignancy in
the medical history, 272 patients without malignancies from the St. Elisabeth Hospital in
Iserlohn, Germany, 92 former hard coal miners with pneumoconiosis recognized for an
occupational disease surveyed for the course of their disease, 313 persons participating in
an ongoing study on the impact of enzyme polymorphisms on selected brain functions as
well as 96 staff of the Dortmund institute serving as controls in different studies were
included. In total, 964 individuals were combined to a control group representing inhabitants
of the greater Dortmund area. The median age at examination was 68 (range 20-94 years)
and 51 % of the controls were males. Caucasian descent was confirmed by questionnairebased documentation of nationality
Pakistan
The Pakistan case-control series contains 106 bladder cancer cases and 61 population
based controls. All cases and controls are Pakistani, which was confirmed by questionnairebased documentation of nationality. The median age at diagnosis was 61 (range 24-82)
years. 88% of the participants were males. The controls (85% males, median age 56, range
27-77 years) were cancer free. Data were collected from April 2003 to January 2004. Data
on tumour stage and grade were obtained through the cancer registry. Controls without
malignant disease were frequency-matched for age (time of examination) with the cases.
Data collected in cases and controls include age, gender, a documentation of occupational
activities and exposures to known or suspected occupational bladder carcinogens and
lifetime smoking habits.
6
Venezuela
The Venezuelan case-control series contains 112 bladder cancer cases from Departments of
Urology, University Hospital at Central University, Caracas; Domingo Luciani Hospital from
the Venezuelan Institute of Social Security, Caracas; Oncologic Hospital “Padre Machado”,
Caracas, and Policlínica Metropolitana, Caracas. A total of 190 controls were from the same
departments of urology, as well as from the Medical Faculty at Central University, Caracas,
and all were free of any type of cancer. All cases and controls are Venezuelan; though some
of the patients were residents in Venezuela but were of different origin, mainly Colombian,
Ecuadorian, Peruvian, Italian and Portuguese which was confirmed by questionnaire-based
documentation of nationality. The median age at diagnosis was 59 (range 29-87) years. 71%
of the participants were males. The controls (41% males, median age 31, range 20-91 years)
were cancer free. Data were collected from December 2006 to November 2009. Data on
tumour stage and grade were obtained by the cancer registry. Data collected in cases and
controls include age, gender, a complete documentation of occupational activities performed
at least for six months, documentation of work places with known bladder cancer risk over
the entire working life, exposures to known or suspected occupational bladder carcinogens,
lifetime smoking habits, family history of bladder cancer, numbers of urinary infections
treated by drugs during the previous 10 years, place of birth and places of residency for more
than 10 years. In the case of bladder cancer cases, data on tumour staging, grading and
treatment were taken from the records. The local ethics committees approved the study plan
and design.
Subgroups phenotyped for NAT2
A subgroup of 344 Caucasians was phenotyped for NAT2 using the caffeine test consisting
of 267 cases from the Dortmund occupational case-control series, 38 cases from the
Dortmund hospital based case-control series and 39 healthy controls from the Dortmund
control group (IfADo staff). Phenotyping was done routinely for cases from the Dortmund
occupational case-control series as part of the medical examination. Cases from the
7
Dortmund hospital based case-control series were phenotyped additionally to NAT2
genotyping. Controls from the IfADo staff served as long-term quality controls to assure
comparability of genotyping results over time and methodological or technical alterations.
Analysis of polymorphisms
For differentiating between the homozygous frequent (A/A), homozygous variant (G/G) and
heterozygous (A/G) form of the sequence of interest venous blood was taken and frozen at
-20°C (Saravana Devi et al. 2008). DNA was isolated out of leucocytes using a QIAamp DNA
blood maxi kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol (Arand et
al. 1996). DNA concentrations were determined using a NanoDrop ND-1000 UV/Visspectrophotometer (PEQLAB Biotechnologie GMBH, Erlangen, Germany). Analysis of A/G
substitution (rs1495741) on chromosome 8p23, position 18 272 881, and differentiating
between the homozygous (A/A), homozygous (G/G) and heterozygous (A/G) form of the
sequence:
AGCTGAAGGATGATTTTCATAATAAT[A/G]TGGGCATTCACAGTAGCTTCAGGGC
was
performed on an ABI7500 Sequence Detection System with the use of TaqMan® SNP
Genotyping Assay (Applied Biosystems, Darmstadt, Germany). Analysis of data was
performed according to the manufacturer’s instructions.
NAT2 genotyping
NAT2 genotyping was performed using PCR- and RFLP based standardized methods
(Blaszkewicz et al. 2004, Cascorbi et al. 1995, 1996). A total of seven SNPs, which are
adequate to genotype Caucasians for NAT2 (Blaszkewicz et al. 2004), were investigated,
namely rs1801279 (G191A), rs1041983 (C282T), rs1801280 (T341C), rs1799929 (C481T),
rs1799930 (G590A), rs1208 (A803G) and rs1799931 (G857A). Leucocyte DNA is isolated
from a sample of human blood. Amplification of two fragments of DNA with 442 and 559
base pairs (bp) is achieved by means of polymerase chain reaction (PCR). In three aliquots
8
the amplification product from the first PCR is cleaved by three different restriction enzymes
(Msp I, Fok I, Dde I), and that of the second PCR with four different restriction enzymes
(Kpn I, Taq I, Dde I, BamH I; Figure M1, Blaszkewicz et al. 2004). After subsequent gel
electrophoresis with the addition of ethidium bromide, the various DNA fragments are
detected in UV light. The results are documented by photography, and the alleles are
assigned according to an evaluation scheme (Blaszkewicz et al. 2004).
Fig. M1: N-Acetyltransferase-2, seven SNPs, two PCR amplifications and applied restriction
enzymes (Blaszkewicz et al. 2004).
NAT2 phenotyping (caffeine test)
For phenotyping NAT2 the caffeine test is applied (Grant et al. 1983, 1984, Rankin et al.
1987, Tang et al. 1987, Golka et al. 1996, Röhrkasten et al. 1997, Blaszkewicz 2004, Bolt et
al. 2005, Rihs et al. 2007). The ratio of the caffeine metabolites 5-acetylamino-6formylamino-3-methyluracil (AFMU) and 1-methylxanthine (1-MX) to each other is
determined in two urine samples voided two and four hours after the administration of
9
caffeine in form of two cups of coffee. For this purpose the analytes were separated from the
urine sample by liquid-liquid extraction. The quantitative determination of both caffeine
metabolites is carried out by means of high performance liquid chromatography (HPLC) with
UV detection. For the quantification the standard addition method is used in this case. The
ratios enable differentiation at a cut-off of 0.85 between so-called slow (<0.85) and rapid
acetylators (0.85).
Supplementary References
Arand M, Mühlbauer R, Hengstler J, Jäger E, Fuchs J, Winkler L et al (1996) A multiplex
polymerase chain reaction protocol for the simultaneous analysis of the glutathione Stransferase GSTM1 and GSTT1 polymorphisms. Anal Biochem 236:184-186
Blaszkewicz M (2004) N-Acetyltransferase 2 (phenotyping: caffeine test). In: Angerer J,
Müller M., Weiss, T. et al. (eds). Analyses of hazardous substances in biological materials,
vol 9. Special issue: Markers of susceptibility. Wiley-VCH, Weinheim, pp 165-182;
(http://onlinelibrary.wiley.com/doi/10.1002/3527600418.bi0nat2phne0009/pdf)
Blaszkewicz M, Dannappel D, Thier R, Lewalter J (2004) N-Acetyltransferase 2 (genotyping).
In: Angerer J, Müller M., Weiss, T. et al. (eds). Analyses of hazardous substances in
biological materials, vol 9. Special issue: Markers of susceptibility. Wiley-VCH, Weinheim, pp
135-163; (http://onlinelibrary.wiley.com/doi/10.1002/3527600418.bi0nat2gene0009/pdf)
Bolt HM, Selinski S, Dannappel D, Blaszkewicz M, Golka K (2005) Re-investigation of the
concordance of human NAT2 phenotypes and genotypes. Arch Toxicol 79:196-200
Cascorbi I, Brockmöller J, Mrozikiewicz PM, Bauer S, Loddenkemper R, Roots I (1996)
Homozygous rapid arylamine N-acetyltransferase NAT2 genotype as susceptibility factor for
lung cancer. Cancer Res 56:3961-3966
Cascorbi I, Drakoulis N, Brockmöller J, Maurer A, Sperling K, Roots I (1995) Arylamine Nacetyltransferase (NAT2) mutations and their allelic linkage in unrelated Caucasian
individuals: correlation with phenotypic activity. Am J Hum Gene 57:581-592
Golka K, Hermes M, Selinski S, Blaszkewicz M, Bolt HM, Roth G et al (2009) Susceptibility to
urinary bladder cancer: relevance of rs9642880[T], GSTM1 0/0 and occupational exposure.
Pharmacogenet Genomics 19:903-906
10
Golka K, Prior V, Blaszkewicz M, Cascorbi I, Schöps W, Kierfeld G et al (1996) Occupational
history and genetic N-acetyltransferase polymorphism in urothelial cancer patients of
Leverkusen, Germany. Scand J Work Environ Health 22:332-338
Grant DM, Tang BK, Kalow W (1983) Polymorphic N-acetylation of a caffeine metabolite.
Clin Pharmacol Ther 33:355-359
Grant DM, Tang BK, Kalow W (1984) A simple test for acetylator phenotype using caffeine.
Br J Clin Pharmacol 17:459-464
Lehmann ML, Selinski S, Blaszkewicz M, Orlich M, Ovsiannikov D, Moormann O et al (2010)
Rs710521[A] on chromosome 3q28 close to TP63 is associated with increased urinary
bladder cancer risk. Arch Toxicol 84:967-978
Rankin RB, Hudson SA, Fell AF (1987) Caffeine as a potential indicator for acetylator status.
J Clin Pharm Ther 12:47-51
Rihs HP, John A, Scherenberg M, Seidel A, Brüning T (2007) Concordance between the
deduced acetylation status generated by high-speed: real-time PCR based NAT2 genotyping
of seven single nucleotide polymorphisms and human NAT2 phenotypes determined by a
caffeine assay. Clin Chim Acta 376:240-243
Röhrkasten R, Raatz P, Kreher RP, Blaszkewicz M (1997) Synthesis of the caffeine
metabolites
5-acetylamino-6-formylamino-3-methyluracil
(AFMU)
and
5-acetylamino-6-
amino-3-methyluracil (AAMU) on a preparative scale. Z Naturforsch 52b:1526-1532
Saravana Devi S, Vinayagamoorthy N, Agrawal M, Biswas A, Biswas R, Naoghare P et al
(2008) Distribution of detoxifying genes polymorphism in Maharastrian population of central
India. Chemosphere 700:1835-1839
Selinski S, Blaszkewicz M, Agúndez JA, Martínez C, García-Martín E, Hengstler JG
et al (2013) Clarifying haplotype ambiguity of NAT2 in multi-national cohorts. Front
Biosci (Schol Ed) 5:672-684
Selinski S, Blaszkewicz M, Lehmann ML, Ovsiannikov D, Moormann O, Guballa C et
al (2011) Genotyping NAT2 with only two SNPs (rs1041983 and rs1801280)
outperforms the tagging SNP rs1495741 and is equivalent to the conventional 7-SNP
NAT2 genotype. Pharmacogenet Genomics 21:673-678
Schwender H, Selinski S, Blaszkewicz M, Marchan R, Ickstadt K, Golka K et al
(2012) Distinct SNP combinations confer susceptibility to urinary bladder cancer in
smokers and non-smokers. PLoS One 7:e51880
11
Tang BK, Kadar D, Kalow W (1987) An alternative test for acetylator phenotyping with
caffeine. Clin Pharmacol Ther 42:509-513
12