Department of Physics, Chemistry and Biology
Final Thesis Draft 1
Assessing the β1:β2 ratio of desensitized cardiac β
adrenergic receptors in the embryonic cardiac tissue of
hypoxia-treated Broiler chicken (Gallus gallus
domesticus)
Alexandra Lee
Supervisor: Jordi Altimiras, Linköpings universitet
Examiner: Matthias Laska, Linköpings universitet
Department of Physics, Chemistry and Biology
Linköpings universitet
SE-581 83 Linköping, Sweden
Content
1 Abstract ...………………………….……………….............................................
2 List of abbreviations ………………………….......………..................................
3 Introduction ………………………………..……………………………….....…
4 Material and Methods ………………….……….………………………….…....
4.1 Phylogenetic tree construction ........…………………...…………….......
4.2 Incubation conditions and sampling ....………………...………………..
4.3 Sample preparation and analysis ....…………………..….……………....
4.4 Total RNA isolation ………………………………………………….….
4.5 Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) ………....
4.5.1 Reverse Transcription …………………………………..……….
4.5.2 Polymerase Chain Reaction (PCR) ……………………………...
4.6 Agarose gel electrophoresis ……………………………………………..
4.7 Quantitative Polymerase Chain Reaction (qPCR) ……………………....
4.8 Analysis of qPCR results ……………………………………………......
4.9 Statistical analysis ……………………………………………………….
5 Results …………………………………………………………….......................
5.1 Egg sampling and effects of hypoxia on chicken fetuses ………….........
5.2 Evolutionary phylogeny of β adrenergic receptors …………….……......
5.3 RT-PCR and agarose gel electrophoresis results …………………….….
5.4 Quantitative PCR expression analysis ...……..……………….…….…...
5.5 Effects of hypoxia on relative β1:β2 expression (rβ1/rβ2) …....……...…...
6 Discussion ………………………………………………………………….....…
6.1 Evolutionary phylogeny of chicken β adrenergic receptors...... ……..….
6.2 Effects of hypoxia on chicken fetuses ...…….....………………….....….
6.3 Effects of hypoxia on β adrenergic expression in chicken cardiomyocytes
6.4 Effects of age on β adrenergic expression in chicken cardiomyocytes .....
6.5 Perspectives ……………………………………………………………...
7 Acknowledgements ………………………………………………………….…..
8 References…………………………………………………….……………….....
9 Appendix ...……………………………………………………….………...…....
1
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
x
1. Abstract (incomplete)
Keywords: β1 adrenergic receptors, β2 adrenergic receptors, cardiomyocytes, hypoxia.
2. List of abbreviations
βAR – β adrenergic receptor
bp – base pairs
E15 – embryonic day 15 of development
E19 – embryonic day 19 of development
GAPDH – Glyceraldehyde 3-phosphate dehydrogenase
H – hypoxic
N – normoxic
P – p-value
r – relative
3. Introduction
During the growth and developmental period, a developing embryo is sensitive to alterations
and perturbation in the environment, such as nutritional insufficiencies and environmental
inadequacies, each variable individually having long-term consequences that could potentially
cause significant ramifications in the future growth and survivability of the organism as an
adult. Prenatal stress is an important etiological factor in the onset of adult hypertension but
the mechanisms responsible for this, and other related pathologies that may arise from the
influence of environmental stress on an embryo, are poorly understood.
‘Fetal programming’ was described by Barker as “a stimulus or insult at a critical period of
development that has lasting or lifelong effects” (Barker, 2000). The theory of developmental
programming suggests that insults during the prenatal period, such as hypoxia or malnutrition,
might not show adverse effects in the infant, but will increase the risk of adult disease, such as
ventricular hypertrophy and pulmonary hypertension. Previous research in mammals (REF)
and chickens (Lindgren and Altimiras, 2009) has indicated that a deficiency of oxygen during
prenatal development causes fetal growth restrictions and catecholaminergic overstimulation
that, in turn, alter signaling pathways associated with adrenergic receptors. This change in
sensitivity has subsequently been further investigated in chicken models, with findings that
strongly demonstrate that chronic prenatal hypoxia sensitizes βARs in the embryonic heart but
causes postnatal desensitization (Lindgren and Altimiras, 2009). Though indirect, it is a
possible consequence of the change in the relative density of βARs present in the myocardial
tissue of the chickens, reported by Lindgren and Altimiras, following hypoxia treatment. This
would have important implications for the cardiovascular function in the organism exposed to
such an insult in its surrounding prenatal environment later in life. During this period of
development in organisms such as chickens, they are particularly sensitive to such
deficiencies as they are limited in terms of the protective mechanisms or barriers present to
ensure that perturbations will be corrected for while it is enclosed within its porous,
2
environmentally-vulnerable eggshell; where the implication of heart disease is of particular
importance (REF).
βARs belong to the family of G-protein-coupled receptors. These receptors are responsible for
the inotropic and chronotropic function of the heart, and are functionally important in the
homeostatic regulation of the cardiovascular system. β1 adrenergic receptors have a mainly
contractile, inotropic function, while both β1 and β2 adrenergic receptors share a chronotropic
function in the heart (Post et al., 1999), though β2 adrenergic receptors are thought to function
in a modulatory manner depending on the point in development at which these receptors are
being observed (pers comm., Jordi Altimiras, IFM, Linköping University) and the
physiological state of the organism at the time of interest. Catecholamines regulate cardiac
performance through the positive stimulation of βARs. Under periods of stress, such as
exposure to hypoxic conditions during embryonic growth, chronic elevated levels of
circulating plasma catecholamines hyperstimulate the βARs. Chronic hyperstimulation of the
receptors results in the desensitization of the receptors, which is seen as a decrease of the
adrenergic response upon stimulation due to uncoupling of the receptor from its G-protein,
and sequentially leads to sequestration of the receptors from the cell surface (Rockman et al.,
2002). The long-term response to hyperstimulation is the downregulation of the receptors
through suppression of mRNA expression and an increased degradation of sequestered
proteins. Loss of receptor numbers and function is the foundation for a spectrum of heart
disease. This has been confirmed by studies showing that heart failure is associated with
chronic increases in circulating catecholamines, which leads to βAR desensitization and
downregulation (Rockman et al., 2002).
A potential explanation for these differences in sensitivity is a shift in the relative expression
of β1 and β2 adrenergic receptors, measured with respect to the relative gene expression of
these receptors in the cardiomyocytes of the developing embryos at different developmental
ages. The purpose of this study is to investigate whether low fetal oxygen conditions have a
programming affect on βAR signaling, by studying the changes in mRNA expression at
different stages of development relative to embryos incubated under ambient oxygen level
conditions. We postulate that the restriction of oxygen during critical periods in embryonic
development may cause an altered βAR subtype ratio in the heart, which in turn could
potentially result in an altered contractile response. An observed change could thus explain
the switch from prenatal βAR sensitivity of the heart to increased catecholaminergic
stimulation to adult insensitivity to increased plasma catecholamine levels.
According to current literature, the β1 adrenergic receptors constitute roughly 75-80 % of
functional βARs in mammalian cardiac tissue, with the remaining 20-25 % comprising of β2
adrenergic receptors (Wallukat, 2002) (Post et al., 1999). In the broiler chicken heart the ratio
of β1/β2 adrenergic receptors has been previously determined to be approximately 50/50 in
specimens incubated under regular environmental conditions and oxygen levels (pers comm.,
Isa Lindgren, IFM Linköping University).
3
Previous studies have confirmed that broiler chickens are a viable model for this line of
research (pers comm., Jordi Altimiras, IFM, Linköping University) and we have chosen to
continue and further explore potential studies that contribute towards cardiovascular disease
treatment and the identification and understanding of the underlying causes that manifest in
cardiac disease, such as hypertension.
4. Materials and Methods
4.1 Phylogenetic tree construction
Coding sequence homologues of chicken βARs were extracted from GenBank using
reciprocal best BLAST hits for select mammalian and non-mammalian species. The
corresponding nucleotide alignments were extracted and aligned using ClustalW, the resulting
nucleotide sequence alignment was used to construct phylogenetic tree using the NeighbourJoining method (Saitou and Nei, 1987). A bootstrap test of phylogeny was run on the
calculated phylogenetic tree to test the reliability of the inferred tree, which is evaluated using
Efron’s (1982) bootstrap resampling technique that gives a resulting bootstrap consensus tree
that summarises the main findings of the test. The bootstrap consensus tree inferred from 500
replicates (Felsenstein, 1985) with random seeding is taken to represent the evolutionary
history of the taxa analyzed (Felsenstein, 1985). Branches corresponding to partitions
reproduced in less than 50% bootstrap replicates are collapsed. The percentage of replicate
trees in which the associated taxa clustered together in the bootstrap test (500 replicates) are
shown next to the branches (Felsenstein, 1985) shows the degree of reliability of each branch
and its placement within the inferred evolutionary tree. The phylogenetic tree was linearized
assuming equal evolutionary rates in all lineages (Takezaki et al., 2004). The tree is drawn to
scale, with branch lengths in the same units as those of the evolutionary distances used to
infer the phylogenetic tree. The evolutionary distances were computed using the Maximum
Composite Likelihood method (Tamura et al., 2004) and are in the units of the number of
base substitutions per site. There were a total of 808 positions in the final dataset.
Phylogenetic analyses were conducted in MEGA4: Molecular Evolutionary Genetics Analysis
software (Tamura et al., 2007).
4.2 Incubation conditions and sampling
The study was conducted on fertilized eggs from broiler chickens (Gallus gallus domesticus)
of the fast-growing strain Ross 308 obtained from a local hatchery (Svenska Kläckeribolaget,
Väderstad, Sweden). The eggs were stored at a constant temperature of 18 ºC and turned twice
daily until incubation (Hova-bator, Invansys, USA). Periodic candling of the eggs was
performed to monitor fetal development and viability, with the subsequent removal of nonfertile and dead eggs. Prior to incubation the eggs were weighed to the nearest hundredth of a
gram and split up alternatively into two experimental conditions: incubation in normoxia (21
4
% O2) and in hypobaric hypoxia (14 % O2). The normoxic control group (N) was provided
with ambient air whereas the hypoxic treatment group (H) was supplied with a mixture of
nitrogen and air using standard rota-meters (B-125-50, Porter Instruments company, Hatfield,
Pennsylvania, USA) achieving a final isobaric oxygen concentration of 14 %, which was
chosen based on previous studies (Lindgren and Altimiras, 2009) which found that oxygen
concentrations of 12 % resulted in a mortality rate greater than 75 % before developmental
day 5. The oxygen concentration was monitored every ten seconds using a galvanic oxygen
sensor (Pico Technology Inc, Cambridgeshire, UK). Eggs were incubated at 37.8 ºC with a
relative humidity of 45 % and turned automatically once every hour (model 25 HS, Masalles
Comercial, Barcelona, Spain). Embryos were sampled at two developmental ages: 15 days
and 19 days of a total of 21 days of incubation which make a total of four experimental
groups: 15 days Normoxic (15N), 15 days Hypoxic (15H), 19 days Normoxic (19N) and 19
days Hypoxic (19H), each group having a total sample size of eight embryos (n=8).
Masses of the eggs and embryos are presented in Table 2.
4.3 Sample preparation and analysis
Once the developmental age of interest was reached, the embryos were removed from the
incubators and the mass of the eggs were recorded. The embryos were euthanized by
decapitation and weighed (Sartorius BP 221S, Sartorius, Goettingen, Germany). The yolk sac
was removed subsequent to weighing the chicken embryos to obtain their embryonic mass.
The animals were immediately dissected by cutting rostrally from the neck down, on the
ventral side of the body, directly through the rib cage. Once the abdominal cavity was
exposed, the hearts were excised and rinsed in modified Ringer's buffer solution (138 mM
NaCl, 3 mM KCl, 3 mM CaCl2, 1.8 MgCl2, 10 mM HEPES, Tris to pH 7.4). The hearts were
blotted using tissue paper to remove any residual residue and weighed to the nearest
milligram. The total RNA of the cardiac tissue was immediately extracted from the tissue
sample.
All procedures were approved by the local Ethical Committee (Linköping, Sweden) diary
number 48-04.
4.4 Total RNA isolation
Total RNA isolation from the embryonic broiler chicken cardiac tissue specimens (100-200
ng) was performed using the Fast RNA Pro Green Kit (MP Biomedicals) following the
manufacturer’s protocol. In short, 1 ml of RNAproTM solution (Phenol pH 7.9 and Guanidine
Thiocyanate) was added to the dissected hearts in a tube containing Lysing Matrix D. The
tubes were processed in the FastPrep Instrument for 40 s at a setting of 6.0, and then
centrifuged at a minimum of 12,000 g (13,000 RPM) for 10 min at room temperature. The
upper phase was transferred to new sterile microcentrifuge tubes and incubated for 5 min at
5
room temperature to increase RNA yield. 300 µl of chloroform was added to the solution
followed by 10 s of vortexing. To permit nucleoprotein dissociation and increase RNA purity,
a 5 min incubation step at room temperature was performed. The tubes were then centrifuged
for 10 min at 4 ºC at a minimum of 12,000 g. The upper phase was again transferred to new
sterile tubes without disturbing the interphase. 500 µl of cold absolute ethanol (100 %) were
added to the solution, which was inverted 5 times and stored at -20 ºC for at least 30 min,
followed by a centrifugation step at a minimum of 12,000 g for 15 min at 4 ºC. The
supernatant was removed and the pellet washed with 500 µl of cold 75 % ethanol made with
DEPC water (DEPC: Di-ethyl-propyl carbonate used to treat water to remove RNases and all
RNA inhibitors). A centrifugation step at 12,000 g at room temperature for 7 min was
performed before removing the ethanol and air-drying the RNA pellet for 5 min at room
temperature. The RNA was resuspended in 100 µl of DEPC water, and allowed to incubate at
room temperature for a period of 5 min to facilitate RNA resuspension. The RNA
concentration and purity of the samples was determined using the NanoDrop ND-1000
Spectrophotometer (NanoDrop Technologies©) to validate RNA quality. Quantification of the
total RNA concentration is calculated in ng.µl-1. Total RNA isolated was stored at -80 ºC
before use.
4.5 Reverse Transcriptase Polymerase Chain Reaction (RT-PCR)
4.5.1 Reverse Transcription
The first strand cDNA (total reaction volume of 20 µl) of the total extracted RNA obtained
from the 15 day and 19 day embryonic chicken cardiac tissue samples was synthesized
according to instructions from the manufacturer using the RevertAid™ Reverse Transcriptase
(Fermentas). 1 µl of total RNA was mixed in a sterile, nuclease-free tube on ice to 1 µl 0.5 µg
(100 pmol) Oligo(dT)18 primer, and 10.5 µl DEPC-treated water to reach a total volume of
12.5 µl. The solution was gently mixed, briefly centrifugated and incubated at 70 ºC for 5 min,
chilled on ice for 30 s, briefly centrifugated and placed on ice. The following reagents were
added to the solution: 4 µl of 5x RevertAid™ reaction buffer; 0.5 µl 20 u RiboLock™ RNase
Inhibitor; 2 µl 1mM dNTP Mix (of a final concentration of 1 mM for each nucleotide). The
solution was incubated for 5 min at 37 ºC before adding 1 µl 200 u RevertAid™ Reverse
Transcriptase. After a gentle mix and a brief centrifugation step, the solution was incubated at
42 ºC for 60 min. The reaction was terminated by heating the solution at 70 ºC for 10 min.
4.5.2 Polymerase Chain Reaction (PCR)
Primers were designed using OligoPerfect™ Designer, an online software tool (Invitrogen).
All primers were designed for amplicon lengths between 100 and 250 bp, an annealing
temperature around 60ºC, a GC content around 55 % and a primer length of about 20 bp. The
complete list of primers used is found in Table 1. A PCR reaction using the cDNA samples of
6
both the 15 day and 19 day embryonic chicken cardiac tissue samples is done to test the
effectiveness of the designed primers in recognizing the β1 and β2 adrenergic receptor
sequences of the experimental samples, and to test the melting temperature gradient of the
different primer pairs. 1 µl of the template cDNA of each sample was reverse transcribed in a
total reaction volume of 10 µl following the manufacturer’s instructions (Fermentas). Briefly,
the following reagents were added to a sterile 200 µl PCR tube on ice: 1 µl of the 10x Dream
Taq buffer; 0.1 µl 10 mM dNTP Mix; 0.2 µl 10 µM forward primer; 0.2 µl 10 µM reverse
primer; 1 µl of template cDNA (10 pg-1 µg); 0.1 µl of Dream Taq DNA Polymerase (1.25 u)
and 7.4 µl nuclease-free water to reach 10 µl total volume. No template water controls were
included for each reaction. The solution was gently vortexed and quickly centrifugated to
collect drops. The PCR protocol included an initial denaturation step at 95 ºC for 3 min, an
amplification phase made of three steps repeated 35 times (a denaturation step at 95 ºC for 30
s, an annealing step at around 60 ºC, temperature varying with the primers annealing
temperature [53-62 ºC] for 30 s, an extension step at 72 ºC for 1 min), and a dissociation
program was run at 72 ˚C for 7 min cooling to 30 ºC for 3 min after amplification was
complete in the PalmCycler instrument (Corbett Life Sciences).
Table 1. β1, β2 and GAPDH primer sequences used for PCR and qPCR analysis. Primer sequences
given in a 5’-3’ direction. Length of expected PCR products expressed in bp, and location of the
designed primer pairs in the 1587 nucleotide length coding region of the proposed chicken β1
adrenergic receptor mRNA sequence. Success and uses of the primer pairs indicated in the final
column as follows: †did not work; *worked for PCR only; **worked in both PCR and qPCR.
Gene
Forward Primer
Reverse Primer
Beta 1
5-ATCGAGACCTTGTGCGTCAT-3
5-CCAAGATGGACAGGGAAAAA-3
5-AAAAACACCCTGGCAACAAC-3
5-GATGTGGTCTGACTGCAACG-3
5-CTTCAAGAGGCTGCTCTGCT-3
5-GCTACCAGAGCCTGATGACC-3
5-GCTACCAGAGCCTGATGACC-3
5-GGGAGCACAAAGCTCTGAAG-3
5-AGCGACTACAACGAGGAGGA-3
5-ATGGGCACGCCATCACTA-3
Beta 2
GAPDH
Amplicon
size (bp)
Primer
range
5-AAGCAGAGCAGCCTCTTGAA-3
5-CAGTGCCCTGTTGACTTTGA-3
5-CAGTGCCCTGTTGACTTTGA-3
5-TCCCTGTCCATCTTGGACTC-3
5-TCCCTGTCCATCTTGGACTC-3
5-GGAGGGGGATGTAGAAGGAG-3
5-TGATGAGGAGGGGGATGTAG-3
5-GGCAGTAGATGATGGGGTTG-3
5-AAGGCTCATCGTTAGGAGCA-3
692
120
103
102
225
219
225
183
185
385-1076
1265-1384
1282-1384
1179-1280
1056-1280
443-661
443-667
851-1033
–
*
5-TCAGATGAGCCCCAGCCTT-3
129
–
**
4.6 Agarose gel electrophoresis
The PCR products from the 15 day and 19 day embryonic chicken cardiac tissue extraction
samples were loaded and run on an agarose gel prepared according to the manufacturer’s
instructions (Fermentas). A 1 % gel was prepared by mixing 0.5 g of TopVision™ LE QG
Agarose (Fermentas) in 50 ml of 0.5x TBE Electrophoresis Buffer (89 mM Tris, 89 mM Boric
acid, 2 mM EDTA at pH 8). The gel was mixed with 5 µl SYBR® Safe DNA gel stain
(Invitrogen) before casting. Wells were formed with a 15-well comb. The PCR products were
loaded along with 2 µl of 6x DNA loading dye (Fermentas) and run alongside 7 µl FastRuler™
7
†
†
†
†
**
**
*
**
Low Range DNA Ladder (Fermentas). The gel was run in 0.5x TBE buffer in a standard
electrophoresis tank at 100 V for 30 min (400 mA). Gel pictures were visualized and captured
using the SYBR Green filter in the BioDoc-It™ Imaging System from UVP (Upland, CA,
USA).
4.7 Quantitative Polymerase Chain Reaction (qPCR)
With the first strand cDNA synthesized from the extracted mRNA from the 15 day and 19 day
embryonic chicken cardiac tissue samples, qPCR analysis of the β1 adrenergic receptor, β2
adrenergic receptor and housekeeper gene, GAPDH, mRNA expression levels was performed
using the Rotor-Gene™ 6000 instrument (Corbette Life Sciences) and the SYBR Green based
Maxima™ SYBR Green qPCR Master Mix (2X) (Fermentas). A 25μl master mix containing
SYBR Green master mix and nuclease-free water was prepared according to the
manufacturer’s instructions. To each sample a total volume of 12.5 μl Maxima™ SYBR
Green qPCR Master Mix (2X), 8.5 μl nuclease-free water, 1.5 μl forward primer, and 1.5 μl
reverse primer are added to 1 μl cDNA in a sterile 200 μl PCR tube to make a total volume of
25 μl. 2.5 μM β1 adrenergic receptor forward primer and 2.5 μM β1 adrenergic receptor
reverse primer is added to one set of samples, 2.5 μM β2 adrenergic receptor forward primer
and 2.5 μM β2 adrenergic receptor reverse primer is added to a second set of samples, and
finally 2.5 μM GAPDH forward primer and 2.5 μM GAPDH reverse primer is added to a
third set of samples. Triplicates were run for each sample. A standard curve was prepared by
mixing equal amounts (5 µl of each cDNA sample) of all cDNA samples involved in the
experimental study to make a cDNA pool, and a serial dilution of the cDNA pool was
performed. The total volume forming the cDNA pool was divided in two; the first half was
considered the highest concentration of the standard curve (5 x), the second half was used to
make a serial dilution by dividing the concentration each time by two. This was done six
times (5, 2.5, 1.25, 0.625, 0.3125, 0.15625 and 0.07825). Triplicates were run for each
concentration of the standard curve. The volumes were scaled up according to the number of
genes to test. The conditions used during the qPCR entailed a 10 min initial denaturation
program; an amplification and quantification program set at 40 cycles, (95 ˚C denaturation for
15s, 60 ˚C annealing for 30 s, and 72 ˚C extension for 30 s) with fluorescent measurement
taken at the end of each 72 ˚C extension step in the cycle. A melting program was performed
from 72 to 90 ºC (heating ramp of 1 ºC per cycle) with continuous fluorescence measurement,
after amplification was complete. The PCR products are then identified by generating a
melting curve. The Rotor-Gene™ 6000 software automatically calculates the slope of the
standard curve, the mean Ct (Threshold cycles) of each triplicate, the efficiency of each run
and the relative calculated concentrations (copies) of expressed, SYBR Green-labeled DNA
amplified in each sample.
4.8 Analysis of qPCR results
8
Microsoft® Excel 2007 was used to evaluate the difference in mRNA expression of each gene
normalized by the reference gene GAPDH from the qPCR results obtained using RotorGene™ 6000 software. The calculated concentrations of the control and the test samples was
used to determine if there is a difference in the relative expression ratio in mRNA expression
normalized by the reference gene (GAPDH) with respect to different treatment conditions or
age.
4.9 Statistical analysis
Values are expressed as the calculated concentration of amplified DNA, and the mean was
used as a single entity for statistical analysis. Paired Student’s t-test was used to determine the
difference between control (N) and treatment (H) groups.
5. Results (details incomplete)
5.1 Egg sampling and effects of hypoxia on chicken fetuses
Prior to incubation the eggs were weighed and split up alternatively into two experimental
conditions: incubation in normoxia and incubation in hypobaric hypoxia. This alternative
splitting of the eggs based on their weight ensures that the observed differences between the
two group are comparable, preventing a skewing of results in favour of a particular outcome
in either direction.
Fetuses incubated under hypoxic conditions did show a significant difference in egg mass and
in body mass compared to those incubated under normoxic conditions as shown in Table 2,
while there was relatively little difference in heart mass seen in either normoxic or hypoxic
groups for E15 or E19.
The heart:fetal mass ratio showed a significant difference between hypoxic and normoxic
treated samples in E15, but not in and E19 fetuses.
Table 2. Egg mass prior to incubation and the egg, fetal and heart mass from samples at their 15th
(n=16; 8 normoxic, 8 hypoxic) and 19th (n=16; 8 normoxic, 8 hypoxic) day of incubation. Data as
mean ± standard error. Significance indicated at P < 0.05. ‘ns’ denotes no significance found
between control and treated samples.
Fetal
Age
(days)
15
19
Treatment
t-test
(P)
Normoxic
Original
Egg Mass
(g)
61.75 ± 2.10
Hypoxic
62.75 ± 1.47
ns
Normoxic
62.23 ± 1.61
Hypoxic
63.31 ± 0.87
Current
Egg Mass
(g)
54.98 ± 1.99
t-test
(P)
57.51 ± 1.37
0.005
55.88 ± 1.57
t-test
(P)
17.36 ± 0.97
53.74 ± 1.58
ns
Fetal Mass
(g)
14.84 ± 0.91
27.40 ± 2.98
9
t-test
(P)
105.6 ± 12.6
0.00005
32.26 ± 1.82
0.008
Heart Mass
(mg)
108.0 ± 9.90
170.7 ± 26.6
t-test
(P)
0.608
ns
188.2 ± 32.5
0.00096
Heart:Fetal
Mass Ratio
0.727
0.002
0.583
ns
0.623
ns
5.2 Evolutionary phylogeny of the β adrenergic receptors
Figure 1. Constructed β adrenergic receptor phylogenetic tree based on
mRNA sequence homology comparing the β1, β2, and β3 adrenergic
receptors of chicken and turkey to other mammalian species including
additional non-mammalian outliers for β1, β2, and β3. The percentage of
replicate trees in which the associated taxa clustered together in the
bootstrap test (500 replicates) are shown next to the branches. Scale
depicting evolutionary time in mya. Blue, green and red boxes delineate the
evolutionary grouping of similar sequence homologies between taxa into
separate well defined groups.
10
5.3 RT-PCR and agarose gel electrophoresis results
Figure 2. β1 and β2 visualized on a SYBR Safe-stained 1 % agarose gel.
Lane 1 holds FastRuler™ Low Range DNA Ladder, lane 2 holds amplified
β1 PCR product (225 bp amplicon size), and lane 3 holds amplified β2 PCR
product (185 bp amplicon size).
Figure 3. Difference of mRMA expression on agarose gel between samples
incubated in normoxia and hypoxia for β2 in E15 cardiomyocyte samples.
11
5.4 Quantitative PCR expression analysis
Table 3. Results of the qPCR analysis for β1, β2, and GAPDH, and the calculated relative mRNA
expression levels of these genes in chicken fetal cardiomyocytes. Data as mean ± standard error.
Significance indicated at P < 0.05. ‘ns’ denotes no significance found between control and treated
samples.
Treatment
β1
(copies)
15N
0.33 ± 0.15
15H
3.03 ± 1.00
19N
7.09 ± 1.93
19H
8.20 ± 3.37
t-test
(P)
β2
(copies)
t-test
(P)
0.15 ± 0.08
0.0001
1.33 ± 0.60
6.24 ± 2.86
t-test
(P)
0.18 ± 0.08
0.0004
4.67 ± 1.97
ns
GAPDH
(copies)
2.19 ± 0.97
t-test
(P)
1.79 ± 0.46
0.0003
3.04 ± 1.12
Ns
β1/GAPDH
1.59 ± 0.88
ns
1.94 ± 1.11
t-test
(P)
0.94 ± 0.41
ns
2.69 ± 1.33
4.57 ± 1.26
β 2/GAPDH
0.63 ± 0.26
1.40 ± 0.60
0.0490
ns
Figure 4. Relative expression of β1:β2 adrenergic receptors (rβ1/rβ2) of
embryonic chicken cardiomyocytes exposed to normoxic or hypoxic
conditions. The relative calculated concentration expressed in percent of the
concentration of β1 expressed relative to β2. Developmental age is expressed
as days of embryonic development. P < 0.05, significance between relative
β1:β2 concentration of the samples between developmental age groups, same
treatment (*).
7. Acknowledgements (incomplete)
12
2.58 ± 0.87
ns
3.82 ± 1.31
5.5 Effects of hypoxia on relative β1:β2 expression (rβ1/rβ2)
6. Discussion (incomplete)
t-test
(P)
0.68 ± 0.73
1.58 ± 0.71
ns
r β 1/r β 2
1.48 ± 0.58
ns
8. References (Vancouver system format)
Barker, DJP. In utero programming of cardiovascular disease. Theriogenology 53: 555-574,
2000.
Efron B. The jackknife, the bootstrap and other resampling plans. CBMS-NSF Regional
Conference Series in Applied Mathematics, Monograph 38, SIAM, Philadelphia, USA; 1982.
Felsenstein J. Confidence limits on phylogenies: An approach using the bootstrap. Evolution
39:783-791, 1985.
Lindgren I, Altimiras J. Chronic prenatal hypoxia sensitizes β adrenoceptors in the
embryonic heart but causes postnatal desensitization. Am J Physiol Regulatory Integrative
Comp Physiol 297:258-264, 2009; doi:10.1152/ajpregu.00167.2009.
Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time
quantitative PCR and the 2 -∆∆C ͭ method. Methods 25: 402-408, 2001.
Post SR, Hammond HK, Insel PA. Beta-adrenergic receptors and receptor signaling in heart
failure. Annu Rev Pharmacol Toxicol 39: 343–360, 1999.
Rockman H, Koch W, Lefkowitz R. Seven-transmembrane-spanning receptors and heart
function. Nature 415: 206-212, 2002.
Saitou N, Nei M. The neighbor-joining method: A new method for reconstructing
phylogenetic trees. Molecular Biology and Evolution 4: 406-425, 1987.
Takezaki N, Rzhetsky A, Nei M. Phylogenetic test of the molecular clock and linearized
trees. Molecular Biology and Evolution 12:823-833, 2004.
Tamura K, Nei M, Kumar S. Prospects for inferring very large phylogenies by using the
neighbor-joining method. Proceedings of the National Academy of Sciences (USA)
101:11030-11035, 2004.
Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular Evolutionary Genetics
Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24: 1596-1599,
2007.
Wallukat G. The β-adrenergic receptors. Herz 27 (7): 683-690, 2002.
13
9. Appendix
>gi|118097286|ref|XM_425195.2| PREDICTED: Gallus gallus similar to beta-2 adrenergic receptor (LOC427623),
mRNA
ATGGGGGTGGCGGGCACCGAGCTGCCTGGCGGCAACGTCAGCGCCAACCAGAGCGCCGCAGACCCCACGGCGTCGCGGGACGTGTGGGTGGTGGGCATGGGGATCCT
CATGTCGCTGATCGTGCTGGTCACTGTCTTCGGCAACGTGTTGGTGATCACCGCCATCGCCCGCTTCCAGCGCCTGCAGACGGTCACCAACTACTTCATCACCTCGC
TGGCGTGCGCCGACCTGGTGATGGGCCTGGGCGTGGTGCCCTTCGGTGCCTGCCACATCATCATGGAGATGTGGAAGTTTGGGAACTTCTGGTGCGAGTTCTGGACC
TCTCTGGACGTGCTTTGCGTCACGGCCAGCATCGAGACCCTCTGCGTCATCGCTGTGGACCGATACTTTGCCATCACCTCCCCGTTCAAGTACCAGAGCCTGCTGAC
CAAGAGCAAGGCACGCGTGGTCATCCTGGTGGTGTGGGCGATCTCGGCCCTCACCTCCTTCCTGCCCATCCAGATGCACTGGTACCGGGCGGACCGTGACGAGGCCA
TTCTCTGCTATGAGAAGGACACGTGCTGTGACTTCTTCACCAACCAAGCCTATGCCATTGCCTCCTCCATCATCTCCTTCTACCTGCCTCTTGTGGTCATGGTATTT
GTGTACGCCAGGGTCTTCCAGGTGGCCAAGAAGCAGCTGCAGAAGATAGACCAGAGTGAGGGGAGGTTTCACATCCAGAACAAGGAGCAGGACCAGAATGGGAAAGC
CGGGCACCGCCGTTCCTCCAAGTTCTTCCTGAAGGAGCACAAAGCTCTGAAGACCCTGGGCATCATCATGGGCACCTTTACGTTGTGCTGGCTGCCCTTCTTCATCG
TTAACATTGTGCACGTCATCCAGGACGACATCATCCCCAAGTACGTGTACATACTCTTGAACTGGCTGGGCTACGTCAACTCTGCCTTCAACCCCCTGATCTACTGC
CGCAGCCCGGACTTCAGGTACGCCTTCCAGGAGCTCCTGTGCCTCCGCAGGTCTGCTCTGAAGATGTATGCCAACGGCTACTCAAACAGCAACGGCAGGAGCGACTA
CAACGAGGAGGACAACGGCTACCCCTTGGCACCAGATAAAGCCTGCGAGCTGCTCTGCGAAGAGGGCTCCTTCCCTCACCCCGAGGACTTTTTGCACTGCAAAGGTA
CTGTGCCTAGCGGGTAGCTGTGAGACGCGATGGGCTCTGGTGTGGCACACTGCTCCTAACGATGAGCCTTTCTCTAAGGAAAAACAAAAGCCCAGTAATAGTAACAA
TCCTCTCCTAAAGCACACCTAAACCCCAATGGCTGCAAGAAACCTAAAACTCAGCAAACCTCCTGCAAACAGGTGGAAGGCTGCCTCGGGTGGCTCGGGTTGGCTGG
CTTCTTGCAGAGGTTATGAATTTAAGTGCACGACCTTAGGTCCCTTGTGCCGGGGGAGGGAGGGGGTGCTGGGGGAGGATGGTATTTTAAGGCTGTGCAGAAAGCTC
GTCCCGGGAGGAACTTCCTGGCTGTGGCCGGTGTTGAACTACCTCATGAGCTCGGTGCTGGCGACTGCTGCGGGAGCGCTGTGCTCCCCGAGCTGTGCAGCACCTGC
CCCAAAATCCCCCCGAGGGATGCTTAGAGCTCGGTCGGCTGCGTCTGATCCTGTTGCTGTCAGTGGGAAAGTTTAAACAACACCC
>gi|118101360|ref|XM_428541.2| PREDICTED: Gallus gallus similar to beta-4C-adrenergic receptor (LOC430991),
mRNA
ATGGGCGGGGGCTACGCTGTTGGGGGCGTGACCGAAAGAGAGAGGGGCAGCCCGGGGCCGCCCCGTGCCTTTAAAGGCTCCTCCTCCGAGCAGGGGCCGCGGACTGA
GCCCGACGTCGGTGCAGCCTCGACGGCGGCGGCCGCCCCGAGTCCCGCTCCGGCGCCGGCAGCCGTGGAGCGCACGGGGGGCAAAAGAGTGCACGGAGCGGGACCGC
CCCCCCCTGCCGAAGCGATGACCCCGCTTCCCACAGGCAACGGCACAGCCTGGGGGGCGGCCGCCCCCGGCACCGTCCCCAATTGCAGCTGGGCTGCCATCCTGAGC
CGGCAGTGGGCGGTGGGAGCCGCGCTGAGCATCACCATTCTGGTCATCGTGGCCGGCAACCTGCTGGTGATCGTGGCCATCGCCAAGACGCCGCGGCTGCAGACCAT
GACCAACGTCTTTGTCACCTCGCTGGCCTGCGCCGACCTCATCATGGGCTTGCTGGTGGTGCCACCGGGGGCCACCATCCTGCTGAGCGGCCACTGGCCCTATGGCA
CGGTGGTGTGCGAGCTGTGGACCTCTCTGGACGTGCTGTGTGTGACGGCGAGCATTGAGACGCTGTGCGCCATCGCCGTGGATCGCTACCTGGCCATCACGGCGCCG
CTGCAGTACGAGGCGCTGGTGACCAAGGGCAGAGCGTGGGCTGTGGTGTGCATGGTGTGGGCCATCTCCGCCTTCATCTCCTTCCTGCCCATCATGAACCACTGGTG
GCGGGATGGAGCAGACGAGCAGGCGGTGCGCTGCTACGATGACCCGCGCTGCTGTGACTTTGTCACCAACATGACCTACGCCATCGTCTCCTCCACCATCTCCTTCT
ACGTGCCGCTGCTCGTCATGATCTTTGTCTACGTCCGTGTCTTTGCTGTGGCCACACGCCACGTCCAGCTCATCGGCAAGGACAAGGTGAGGTTCCTGCAGGAGACC
CCCAGCCTCAGCTCCAGGGCTGGGAGGCGGCGGCGGCCCTCCCGCCTGTTGGCCATCAAGGAGCACAAGGCGCTCAAGACCTTGGGCATCATCATGGGCACCTTCAC
GCTCTGCTGGCTGCCCTTCTTTGTGGCCAACATCATCAAGGTGTTCTGCCGGCCGCTGGTGCCCGACCAGCTGTTCCTCTTCCTCAACTGGTTGGGTTACATCAACT
CAGCCTTCAACCCCATCATCTACTGCCGCAGCCCCGACTTCAGGAGCGCTTTCCGCAAGCTGCTGTGCTGCCCGCGCCGCGCCGACCGCCGGCTGCACGCCGCCCCA
CAGGACCCGCAGCACTGCTCCTGTGCCTTCAGCCCCCGGGCGGACCCCATGGAGGACAGCAAGGCTGCGGCCCCCGGGCGGCCCGGGGAGGACAGCGAGGTGCTGGG
GAGAAGCAGGAGGGAGGAGAATGCCTCATCCCACGGTGGTGGCCACCAGCAGCGGCCCCTGGGCGAGTGCTGGCTGCAGGGCACGCAGACCACGCTGTGCGAGCAGC
TGGATGAGTTCACCAGCAGAGAGATGCCGTTGGGTCCCTCAGTCTGA
>gi|50749926|ref|XM_426540.1| PREDICTED: Gallus gallus similar to beta-adrenergic receptor - turkey
(LOC428983), mRNA
ATGGGAGATGGGTGGCTGCCGCCCGACTGCGGCCCCCACAACCGCTCCGGAGGCGGCGGGGCGACGGCGGCGCCGACCGGGAACCGTCAGGTGTCCGCCGAACTGCT
GTCGCAGCAGTGGGAGGCGGGCATGAGCCTGCTGATGGCCCTGGTGGTGCTGCTCATCGTGGCCGGCAACGTGCTGGTGATCGCGGCCATCGGGCGCACGCAGCGGC
TGCAGACGCTCACCAACCTCTTCATCACCTCGCTGGCCTGCGCCGACCTGGTGATGGGGCTGCTGGTGGTGCCCTTCGGGGCCACGCTGGTGGTGCGGGGCACCTGG
CTGTGGGGCTCCTTCCTCTGCGAGTGTTGGACGTCGGTGGACGTGCTCTGCGTGACGGCCAGCATCGAGACCTTGTGCGTCATCGCCATCGACCGCTACCTGGCCAT
CACTTCGCCTTTCCGCTACCAGAGCCTGATGACCAGGGCTCGGGCCAAGGGCATCATCTGCACCGTCTGGGCCATCTCCGCCCTGGTCTCTTTCCTGCCCATCATGA
TGCACTGGTGGCGGGACGAGGACCCTCAGGCACTCAAGTGCTACCAGGACCCGGGCTGCTGCGACTTCGTCACCAACCGGGCTTACGCCATCGCTTCGTCCATCATC
TCCTTCTACATCCCCCTCCTCATCATGATCTTCGTGTACCTGCGGGTGTACCGGGAGGCCAAGGAGCAGATCAGGAAGATCGACCGCTGCGAGGGCCGGTTCTATGG
CAGCCAGGAGCAGCCGCAGCCACCCCCGCTCCCCCACCAACAGCCCATCCTCGGCAACGGCCGCGCCAGCAAGAGGAAGACGTCCCGTGTCATGGCCATGAGGGAGC
ACAAAGCTCTGAAGACATTGGGTATCATCATGGGGGTGTTCACCCTCTGCTGGCTCCCTTTCTTCTTGGTGAACGTTGTCAACGTCTTCAACAGAGACCTGGTGCCG
GACTGGCTCTTTGTTTTCTTCAACTGGTTGGGCTACGCCAACTCCGCTTTCAACCCCATCATCTACTGCCGCAGCCCGGACTTCCGTAAGGCCTTCAAGAGGCTGCT
CTGCTTCCCCCGCAAAGCTGACAGGCGACTGCACGCTGGCGGCCAACCCGCCCCGCTGCCCGGGGGCTTCATCAGCACCCTGGGCTCCCCTGAGCACAGCCCAGGGG
GGATGTGGTCTGACTGCAACGGGGGCATGCAGGGTGGCAGTGAGTCGAGCCTGGAGGAGAGACATAGCAAAACATCCCGCTCGGAGTCCAAGATGGACAGGGAAAAA
AACACCCTGGCAACAACAAGATCTTACTGCACATTTTTGGGGAGCGGCAACAAAGCTGTTTTTTGCACAGTATTAAGGATTCAAAGTCAACAGGGCACTGCAGGTGC
AGGGGACAGTGGCATAGAGAAGTGGTGGCTGCGTGCATTGGAGGTGGGACAGGATGGGCATTTGCACAGCAGGACGGAGCAGCAGGCTGCAGCCCTCCAGGTGCCTG
GGTGGGAATATCAGCCTGCCAAATTCCTCAACGCCCGGGGAGGAAGCGAGGAGTCCTCCTCTTTGGGTAAACAGCCGCGCGTAATGTAA
>gi|213891|gb|M14379.1|TKYARBR Turkey beta-adrenergic receptor mRNA, complete cds
GGCGGCAGCGGCGGCGGCGCCGCCTTCCTGCCTGCCCGCGGCGCGGCGCGGCCGGAGCGCCCCGCAGCCATGGGCGATGGGTGGCTGCCGCCCGACTGCGGCCCCCA
CAACCGCTCCGGAGGCGGCGGGGCGACGGCGGCGCCGACCGGGAGCCGTCAGGTGTCCGCCGAGCTGCTGTCGCAGCAGTGGGAGGCGGGCATGAGCCTGCTGATGG
CCCTGGTGGTGCTGCTCATCGTGGCCGGCAACGTGCTGGTGATCGCGGCCATCGGGCGCACGCAGCGGCTGCAGACGCTCACCAACCTCTTCATCACCTCGCTGGCC
TGCGCCGACCTGGTGATGGGGCTGCTGGTGGTGCCTTTCGGGGCCACGCTGGTGGTGCGGGGCACCTGGCTGTGGGGCTCCTTCCTCTGCGAGTGCTGGACATCGCT
GGACGTGCTTTGCGTGACGGCAAGCATCGAGACCTTGTGCGTCATCGCCATCGACCGCTACCTGGCCATCACCTCTCCATTCCGCTACCAGAGCCTGATGACCAGGG
CTCGGGCCAAGGTCATCATCTGCACCGTCTGGGCCATCTCCGCTCTGGTCTCTTTCCTGCCCATCATGATGCACTGGTGGCGGGACGAGGACCCTCAGGCGCTCAAG
TGCTACCAGGACCCGGGCTGCTGCGACTTTGTCACCAACCGGGCTTACGCCATCGCCTCGTCCATCATCTCCTTCTACATCCCCCTCCTCATCATGATCTTCGTGTA
CCTGCGGGTGTACCGGGAGGCCAAGGAGCAGATCAGGAAGATCGACCGCTGCGAGGGCCGGTTCTATGGCAGCCAGGAGCAGCCGCAGCCACCCCCGCTCCCCCAAC
ACCAGCCCATCCTCGGCAACGGCCGTGCCAGCAAGAGGAAGACGTCCCGTGTCATGGCCATGAGGGAACACAAAGCTCTGAAGACATTGGGTATCATCATGGGGGTG
TTCACCCTCTGCTGGCTCCCTTTCTTCTTGGTGAACATTGTCAACGTCTTCAACAGAGATCTGGTGCCGGACTGGCTCTTCGTTTTCTTCAACTGGTTGGGCTACGC
CAACTCTGCTTTCAACCCCATCATCTACTGCCGCAGCCCAGACTTCCGTAAGGCCTTCAAGAGGCTGCTCTGCTTCCCCCGCAAAGCTGACAGGCGGCTGCACGCCG
GCGGCCAACCCGCCCCGCTGCCCGGGGGCTTCATCAGCACCCTGGGCTCCCCTGAGCACAGCCCAGGGGGGACGTGGTCCGACTGCAATGGGGGCACGCGGGGCGGC
AGTGAGTCCAGCCTGGAGGAGAGACATAGCAAAACATCCCGCTCGGAGTCCAAGATGGAGAGGGAAAAAAACATCCTGGCAACAACAAGATTTTACTGCACATTTTT
GGGAAATGGCGACAAAGCTGTTTTTTGCACAGTATTAAGGATTGTAAAGTTATTTGAAGATGCTACTTGCACATGTCCACACACACACAAATTAAAAATGAAATGGA
GGTTTAAACAACACCAAGCCTGAAAGTGATCTCTGTTTTTGTCTGATCTGTTATGGGTTTATTGAGAGAGTGACTTTTTATATTATTTTATGAAGGTACTGTAAATA
GATCCGTATTATAAATTAAAATATCTGAAGGGACTTTATTATTTTTATTTCCAAGTGCCCGCGTGAATCCGCTGTTATTTTAGCACTTGTGTGTCATTTCCATTCTC
CTCTGTGTGTATGTTTTATAACCTATTTATACTCTGGTGCAATTTACTACTGTGTAAGTAATTAGTCGATGTGCAATAAATGCCATTGCAGCAC
Figure 5: Currently annotated nucleotide sequence sequences of (i) β2,
(ii) presumed β1, (iii) proposed β1 (currently annotated as β3) and (iv) turkey
βAR mRNA.
14
Table 4. Annotated mRNA nucleotide sequences for both chicken and turkey β1, and chicken β2,
noting also the chromosome location of the sequences
Gene
Chromosome
β2
chr.13
Presumed β1
chr.22
Proposed β1
chr.6
Turkey β
Annotated mRNA nucleotide sequence file
>gi|118097286|ref|XM_425195.2| PREDICTED: Gallus gallus similar to beta-2 adrenergic
receptor (LOC427623), Mrna
>gi|118101360|ref|XM_428541.2| PREDICTED: Gallus gallus similar to beta-4C-adrenergic
receptor (LOC430991), mRNA
>gi|50749926|ref|XM_426540.1| PREDICTED: Gallus gallus similar to beta-adrenergic
receptor - turkey (LOC428983), mRNA
>gi|213891|gb|M14379.1|TKYARBR Turkey beta-adrenergic receptor mRNA, complete cds
15