Lab 13
DNA Extraction and PCR
DNA Extraction – Qiagen DNeasy Plant Mini Kit
1. Using a Mortar & Pestle, grind the tissue in a small quantity of Liquid Nitrogen. Pour tissue into
a sterile 2ml tube.
2. Add 400uL Buffer AP1 and 4uL RNase A. Vortex and incubate for 10minutes at 65C. Invert your
tube 2-3 times during the incubation.
3. Add 130uL Buffer P3. Mix and incubate on ice 5 minutes.
4. Centrifuge at 14,000RPM for 5 minutes.
5. Pipet lysate into a QIAshredder spin column placed in a 2mll collection tube.
6. Centrifuge at 14,000PRM for 2 minutes.
7. Transfer flow-through into a new 2ml tube without disturbing pellet. Add 1.5 volumes of Buffer
AW1. Mix by pipetting.
8. Transfer 650uL of mixture into DNeasy Mini spin column placed in a 2ml collection tube.
Centrifuge at 8000RPM for 1 minute. Discard flow-through. Repeat for remaining sample.
9. Place spin column into a new 2ml collection tube. Add 500uL Buffer AW2. Centrifuge at
14,000RPM for 1 minute. Discard flow-through.
10. Add another 500uL Buffer AW2. Centrifuge at 14,000RPM for 1 minute. Discard flow-through.
11. Place spin column into a new 1.5ml Centrifuge tube.
12. Add 50uL Buffer AE (warm AE at 65C before use). Incubate at room temperature for 5 minutes.
13. Centrifuge 8000RPM for 1 minute.
14. Repeat 12 & 13
PCR:
Each pair of students will prepare one tube of MasterMix, enough for 3 reactions (one for each student
and a negative control).
The two primers to be used are:
FW: FT-ATG – a primer that amplifies at the start codon of both the FT1 and FT3 genes
Sequence: atgtctagcagggagagagaccctc
RVRS: FT-MIDSTOP – an internal primer that amplifies in an intronic region ~600 bp downstream of the
start codon in both FT1 and FT3
Sequence: attccaaggtgatcaatggcacagtg
MasterMix Recipe
Master Mix Recipe
to individual reaction tubes add:
5x green go taq buffer
22 mM MgCl2
5 mM dNTPs
Primer 1 100 ng/µl
Primer 2 100 ng/µl
Taq polymerase
Sterile H2O
per rxn
(µl)
10
5
1
0.5
0.5
0.25
31.75
1:50 dilution DNA
Total
1
50
per 3 rxns
(µl)
30
15
3
1.5
1.5
0.75
95.25
Cycling Parameters:
95° - 2 min
95° - 30 sec
66° - 30 sec
72° - 45 sec - the extension time is determined by the length of the region being
amplified, 1 minute per kb
72° - 5 min
4° - infinite
40 cycles - the number of cycles is the number of times that steps 2-4 are repeated
The PCR products will be saved for next week’s lab.