1) Introduction:
Molecular Genetics
a) Behavioral Genetic Research answers the question: How much do genes matter in the formation of the
phenotype?
b) Molecular Genetic Research answers the question: What specific genes matter?
2) A Primer on Genetics
a) Deoxyribonucleic Acid (DNA): Is a chemical code found in the nucleus of all cells except red blood cells
and contain the genetic blueprint that allows humans and all other living organisms to form, develop,
function and live.
b) Implicated in physical and non-physical features
c) Consists of two genetic fibers called polynucleotides
3) A Primer on Genetics
a) Polynucleotides consist of four bases: adenine ,guanine, thymine, cysosine
b) Based on one poly bond with the bases on the other.
c) A bonds with T , G bonds with C.
4) A Primer on Genetics
a) When base pair work together to carry out a particular function in the body, they are known as a gene.
b) About 20-25 thousand genes per person.
c) A gene is on average about 3000 base pairs.
5) What do genes do?
a) Genes DO NOT code for behavior
b) Genes code for the production of proteins
c) Proteins: organic compounds essential to life implicated in many body and brain process
d) Proteins are chains of amino acids.
e) Amino acids coded by 3 contiguous base pairs, or codons. (20 different AAs)
6) How does “coding” work?
a) While genes do in fact “code” for proteins, 90% of each gene is non-coding.
b) So, if a gene is on average 3000 bp long, only 1200 actually code for proteins.
c) Exons: Part of the gene that code for protein production
d) Introns: parts of the gene that don’t code for protein production
e) “Coding” means providing the instruction to the creation of a protein not direct.
i) Ex: recipe book
7) Steps from DNA  Protein
a) Transcription & Translation
i) Transcription: where genes duplicate themselves onto messenger ribonucleic acid (mRNA).
ii) Only exons are retained for mRNA.
iii) mRNA is single strand, not double helix
iv) Uracil (U) in place of Thymine (T)
v) After duplication, mRNA leaves the cell ( nucleus )
8) Steps from DNA  Protein
a) Transcription & Translation
i) Translation: mRNA meets up with and attaches to the ribosome in the cytoplasm
ii) Ribosome: protein manufacturing machines found in the cytoplasm.reads genetic information
carried by mRNA and works in conjunction with another type of RNa which is tRNA to produce the
appropriate amino acid
iii) Cytoplasm: space between cell nucleus and the wall
iv) Ribosome works with tRNA (transfer RNA) to read mRNA and create the appropriate amino acid
v) On average, 400 amino acids make a protein.
9) Human Genetic Variation
a) Differences in DNA sequence  which proteins are manufactured variation in phenotype .
b) Still, different proteins are not necessarily “functionally ” in the cell.
c) How do we all end up with different DNA?
d) Inherited on thread-like structures called chromosomes.
10) Process of Inheritance
a) 23 chromosomes inherited from each parent.
b) One pair (2) are sex chromosomes (XX or XY).
c) Genes located on a specific part of specific chromosome
i) (ex: chromosome 5, b.p. 1,349 - 4,126)
d) Maternal and paternal chromosomes that are homologous (matching) have same combinations of
genes in the same order, but the nucleotides can differ.
11) Chromosome vs. DNA
a) REMEMBER: A gene is like a row of empty seats. The nucleotides like the people who sit in them.
b) Chromosomes are basically pieces of DNA inherited on threads that are tightly coiled in order to fit in
the cell nucleus
c) All DNA uncoiled in a straight line = 6 ft.
12) Genetic Polymorphisms
a) Often, maternal and paternal copies of genes are the same. For most genes there is only one version
for all humans
b) Alternative copies of a gene are called alleles
c) About 1-10 %of genes have “variants” (ex: Ab, AB, aB, ab)
d) Genes with two or more possible alleles are called polymorphism.
13) 3 types of Polymorphisms
a) Single Nucleotide Polymorphism (SNP)
i) most common type ( 90% of all )
ii) due to single difference and nucleotide base, where two alleles are indistinguishable except for a
one letter difference
(1) AATCTTATGTACGGA
(2) AATCTTGTGTACGGA
iii) slight change may or may not result in different amino acid being produced
b) Microsatellites
i) one allele is longer than the other (more base pair repeats)
(1) TAGGGTAGAAGAAGAAGAAGAAGA
(2) TAGGGTAGAAGAAGA
c) Minisatellites
i) Same as micro, but larger blocks of base pair repeats
14) Allelic v. Phenotypic Difference
a) Sometimes, allelic difference does not result in phenotypic differences. Why?
b) How do allelic differences result in behavioral differences?
c) Effects are probabilistic , not deterministic .
i) Ex: lets say Gene Z has two possible alleles to inherit: A or a.
ii) Perhaps A increases your aggression by 3% and a decreases it by 1%
15) Inheritance Revisited
a) Which allele you inherit from your parents is random.
b) Remember, your parents have two alleles on each gene, but you only inherit a single chromosome
from each parent from each of the 23 chromosomes.
c) Inherited through gametes: sperm and egg cells
d) These cells are different in that they only contain a “random” half parent genetic material
16) Mitosis & Meiosis
a) Mitosis:
b) Meiosis:
c) Includes process of “________”. Homologous chromosomes of parent randomly swap b.p.
combinations to create _____chromosomes.
d) Homologous chromosomes later split up into different cells making__________.
17) Different Genetic Effects
a) Monogenic: one geneone phenotype
i) Ex- sickle cell anemia
ii) In these cases genes determine 100% who will have the disorder or not
b) Polygenic: possession of certain alleles can increase or decrease odds of the phenotype
i) Depending on what alleles a person possesses for each of these genes, their odds of becoming a
criminal may increase or decrease.
c) Pleiotropy: captures the effects that a single gene has on various different phenotypes.
(1) Ex: DAT1 associated with delinquency and number of sex partners.
18) Polymorphisms for Antisocial Behaviors
a) Most “candidate genes” for ASB involve neurotransmission.
b) Brain comprised of billions of nerve cells of neurons .
c) Neurons communicate through electrical impulses that stimulate release of chemical messengers
called neurotransmitter
d) Neurotransmitters cross gap (synapse) between neurons.
19) The “problem” with neurotransmitters
a) Some amount of neurotransmitters inevitably get left behind in the synapse
b) How much gets eliminated determined by:
i) Transporter protein: reuptake collects leftover and return them to the axon terminal
(1) Reuptake is critically important in maintaining normal levels of neurotransmitters in the
synapse and different genetic variants
ii) Enzymes: break down neurotransmitters left in synapse into inactive particles
20) What’s a gene got to do with it?
a) Different polymorphisms correspond to different efficiency in
i) Reuptake process
ii) Enzyme metabolizing process
iii) Post synaptic reception of neurotransmitter
b) Genes most relevant for criminal behavior include:
i)
Dopaminergic genes
(1) Dopaminergic transported gene DAT1 – codes for the production of the dopamine transporter
protein implicated in the reuptake of dopamine
(2) Dopaminergic receptor gene – DRD2,3,4,5, - involved in the detection of dopamine at the
postsynaptice neurone
ii) Serotonergic genes
(1) Serotonin transported gene
(2) Serotonin receptor gene
(3) Tryptophan hydroxylase gene
21) Dopamine v. Serotonin
a) Dopamine: excitatory neurotransmitter
i) Baseline levels vary from person to person.
(1) Not everyone has the same amounts of dopamine some more than others.
(2) The differential levels of dopamine have been able to explain variance in some antisocial
phenotypes
(3) Curvilinear ( U shaped) where both low and high levels or dopamine correspond to increases in
antisocial phenotypes
ii) Largely a function of genes
(1) High baseline level =more risky behavior
(2) Dopamine levels vary in part bc of the different alleles that are inherited for these polymorphic
genes
b) Serotonin: inhibitory neurotransmitter ,
i) Regulates behavioral impulses and innate drives.
ii) Low levels typically associated with antisocial behavior. (vague though)
22) Some genes and their functions
a) DAT1 : Dopamine transporter protein. 10 repeat allele linked to an “over-removal” of dopamine from
synapse.
b) DRD2, DRD4 ( dopamine receptors)– receptor genes – code for receptors on post-synaptic neurons.
c) COMT–enzyme breaks down neurotransmitters in synapse. Met allele associated with antisocial
phenotypes.
d) MAOA: Famous Caspi et al. (2002) study.
i) Codes for the production of enzymes
ii) One of the main enzymes responsible for breaking down neurotransmitters