Combining native MS approaches to decipher archaeal box H/ACA ribonucleoprotein particle structure and activity
Jean-Michel Saliou 1,2§ , Xavier Manival 3§ , Anne-Sophie Tillault 3 , Cédric Atmanene 1,2 , Claude Bobo 3,4 ,
Christiane Branlant 3 , Alain Van Dorsselaer 1,2 , Bruno Charpentier 3 , Sarah Cianférani 1,2 *
1 BioOrganic Mass Spectrometry Laboratory (LSMBO), IPHC, Université de Strasbourg, 25 rue
Becquerel, 67087 Strasbourg, France.
2 IPHC, CNRS, UMR7178, 67087 Strasbourg, France.
3 Ingénierie Moléculaire et Physiopathologie Articulaire (IMoPA), UMR 7365 CNRS Université de
Lorraine, Biopôle, Campus Biologie Santé, 9 avenue de la forêt de Haye, CS 50184, 54505
Vandœuvre-lès-Nancy, France
4 Institut de Biochimie et Génétique Cellulaires, UMR 5095, 1 rue Camille Saint Saëns CS 61390
33077 Bordeaux Cedex, France
§
Authors equally contributed to the work
Detailed experimental section
SI1: Measured masses in denaturing and native conditions of the different individual partners.
SI2: In vitro assembly of H/ACA sRNP followed by Native MS
SI3: Time-resolved native MS to monitor substrate RNA pseudouridine formation.
SI4: Identification of the components(s) processed within the P/L/C/N/S
22 f 5 U complex after pseudouridylation assay
S-1

EXPERIMENTAL SECTION
Protein and RNA production and purification
Recombinant pGEX-4T-1 and pGEX-6P-1 (GE Healthcare) vectors producing respectively the full length P. abyssi proteins L7Ae, and aCBF5, aNOP10, aGAR1 fused to GST were previously
constructed using the BamHI and XhoI restriction sites [1, 2]. The recombinant GST-fusion proteins
were produced in E. coli BL21 CodonPlus RIL cells (Stratagen). They were grown under agitation at
37°C to an OD of 0.8 in LB medium and induced by addition of 0.2 mM IPTG and shifted at 30°C for 5 hours.
For L7Ae purification, the protocol was previously described [1]. For aCBF5, aNOP10, and aGAR1
purifications, cell pellets were individually broken by two cycles of sonication (2 min on, 2 min off on
Branson sonifier 240) in lysis buffer (50 mM Hepes pH 7.5, 1mM EDTA, 1 mM DTT, 600 mM NaCl).
After 45 min centrifugation at 4°C/48 000 g, nucleic acids were precipitated from supernatant by addition of PolyEthylenImine (PEI, Sigma) (0.0125% w/v for aCBF5 and 0.05% w/v for aNOP10 and aGAR1). After a second centrifugation of 30 min at 4°C/37 000 g, the supernatant was incubated overnight at 4°C under agitation with the glutathione-sepharose beads (GE Healthcare). The beads were washed with 100 ml of saline B buffer (25 mM Hepes pH 7.5, 1 mM DTT, 1 M NaCl). After resin equilibration with the cleavage buffer (25 mM Hepes pH 7.5, 1 mM DTT, 300 mM NaCl, 0.005%
TritonX100), the native protein is recovered in the supernatant by cleavage on the resin, using bovine thrombin and PreScission proteases for GST-L7Ae and GST-aCBF5, GST-aNOP10, and GST-aGAR1 respectively (10 U of enzyme per mg of protein). The eluate was then incubated for 20 min at 65°C with 0.0125% PEI. In these conditions, only the archaeal proteins remained soluble and traces of nucleic acids were eliminated by a second treatment with PEI. After centrifugation at 10 000 g for 20 min at room temperature, each protein was concentrated using a Centriprep (Millipore, 3 kDa cut-off) to a concentration of about 10 mg/ml. Protein aCBF5 was mixed with protein aNOP10 at a molar ratio of 1:1.2 and the complex was purified on S200 gel filtration (GE Healthcare). Protein L7Ae and aGAR1 were purified independently on S75 gel filtration (GE Healthcare). An aliquot of 100 ml at 100 mM of each protein was used for native mass spectrometry.
Pab91 guide RNA was obtained by optimized large-scale in vitro transcription [3]. The DNA template is
formed by the hybridization of sense (5’
TAATACGACTCACTATAGGGCTCCCCTCTCACACCTCCGGGATCAGTGACCGGAGGGCGGTCGG
GGAGCCCACA 3’) (T7 promoter is underlined) and antisense (5’
S-2

TGTGGGCTCCCCGACCGCCCTCCGGTCACTGATCCCGGAGGTGTGAGAGGGGAGCCCTATAGT
GAGTCGTATTA 3’) oligonucleotides. After centrifugation, the RNA was ethanol precipitated and the pellet was dissolved in A buffer (20 mM TrisHCl, pH=8, 8 M Urea, 1 mM EDTA) and then purified by denaturing ion exchange chromatography on a Q-HR column (GE Healthcare). After the NaCl gradient, fractions with the RNA were pooled, dialyzed against water and lyophilized.
S
22
(22-nt oligomer substrate RNA) and S
22 f 5 U oligomers (22-nt oligomer substrate RNA with 5fluorouridine) were chemical synthesized by GE Healtcare (Dharmacon) and then purified by PAGEpurification, eluted and precipitated.
For MS analysis, protein and RNA buffer was exchanged against 250 mM ammonium acetate buffer, pH 7.5, using microcentrifuge gel-filtration columns (Zeba 0.5 ml, Thermo Scientific, Rockford, IL,
USA). Protein concentration was determined by UV absorbance using a NanoDrop spectrophotometer
(Thermo Fisher Scientific, Illkirch, France). Proteins were diluted to 5 μM in 250 mM NH4OAc at pH
7.5 In the case of H/ACA particle reconstruction, P, L, C/N and S were incubated at equimolar ratios of
1:1:1 after buffer exchange.
RNA labelling and hydrolysis
RNAs were recovered by phenol-chloroform extraction and ethanol precipitation. They were labeled either at their 5’ end with T4 polynucleotide kinase and [Ɣ32 P]ATP, or at their 3’ end with T4 RNA ligase and [ 32 P]pCp. After gel purification and ethanol precipitation, recovered radioactivity was measured with a scintillation counter and diluted in H
2
O. RNA alkaline hydrolysis ladders (cleavage after each nucleotide) were generated by incubating the labeled RNA in 1 M sodium carbonate at pH 9 for 3 min at 96°C. In order to generate RNase T1 ladders (cleavage after each guanosine), the labeled
RNA was incubated in 1 M sodium hydroxyde citrate in presence of 2 µg of tRNAs for 5 min at 65°C and then treated by 1 U of RNase T1 for 10 min at 65°C. The cleavage products were separated on 10
% polyacrylamide (acrylamide:bis ratio 38:1) 8 M urea-containing gels and visualized by phosphorimaging.
[1] Charron, C., Manival, X., Charpentier, B., Branlant, C., Aubry, A., Purification, crystallization and preliminary X-ray diffraction data of L7Ae sRNP core protein from Pyrococcus abyssi. Acta Crystallogr.
D 2004, 60, 122-124.
[2] Manival, X., Charron, C., Fourmann, J. B., Godard, F., et al., Crystal structure determination and site-directed mutagenesis of the Pyrococcus abyssi aCBF5-aNOP10 complex reveal crucial roles of
S-3

the C-terminal domains of both proteins in H/ACA sRNP activity. Nucleic Acids Res 2006, 34, 826-
839.
[3] Milligan, J. F., Uhlenbeck, O. C., Synthesis of small RNAs using T7 RNA polymerase. Methods
Enzymol 1989, 180, 51-62.
SI1: Measured masses in denaturing and native conditions of the different individual partners.
n.d.: not determined; n.a.: not analyzed
Partner
RNA guide
(P)
L7Ae
(L) aCBF5/ aNOP10 dimer
(C/N)
Name
Pab91
L7Ae aCBF5 aNOP10
Expected
Mass
(Da)
18 597.1
14 201.5
38 139.6
7 577.9 7 577.7 ± 0.1 aCBF5/aNOP10 45781.0
Measured Mass (Da) in denaturating conditions in native conditions
14 n.d.
201.5 ±
0.1
38 138.1 ±
0.4
Sequence detail
(Uniprot Accession number for protein)
18 597 ± 1
GGGCUCCCCUCUCACA
CCUCCGGGAUCAGUGA
CCGGAGGGCGGUCGG
GGAGCCCACA (5’triP,
3’OH)
14 201 ± 1 GSMEGWM-L7Ae(1-123) n.a. n.a.
45 781 ± 1
GPLGS-aCBF5(1-334)
GPLGS-aNOP10(1-60)
C/N + one Zn 2+ aGAR1
(G) aGAR1
S
22
11 363.5
7 137.3 n.a.
11 363.6 ±
0.1 n.d.
11
7
364 ± 1
137 ± 1
RNA substrat
S
22
f 5 U n.d. 7 155 ± 1
GPLGS-aGAR1(1-94)
GGGUUUAGACCGUCGU
GAGAGA (5’OH, 3’OH)
GGGUUUAGACCG(f 5 U)C
GUGAGAGA (5’OH, 3’OH)
7 156.2
S-4

SI2: in vitro assembly of H/ACA sRNP followed by Native MS:
Native nanoESI mass spectra of simultaneous (A) or sequential (B) addition of guide RNA Pab91 (68mer), L7Ae, aCBF5/aNOP10 and S
22 substrate RNA. Equimolar amounts of partners (10 µM) were mixed together or sequentially added one to the other to build the H/ACA particle with its RNA substrate. Native mass spectra were recorded under native conditions at an interface pressure of 6 mbar and an accelerating voltage of 120 V.
S-5

SI3: Time-resolved native MS to monitor substrate RNA pseudouridine formation.
Full scale mass spectra of real-time native MS monitoring of RNA reaction products and effect on
H/ACA particle. 10 µM of each partners (P, L and C/N) and a 2-fold excess of S
22 f 5 U substrate RNA substrate were incubated and analyzed by native MS at different time points: before reaction (A) after
60 min (B) or 120 min (C) of reaction.
S-6

SI4: Identification of the components(s) processed within the P/L/C/N/S
22 f 5 U complex after pseudouridylation assay
Panel A: Products of the reaction analyzed by gel electrophoresis. RNA guide Pab91 (P), L7Ae (L), aCBF5/aNOP10 (CN), and RNA substrate S
22 f 5 U were mixed together (5 µM each) and separated by gel electrophoresis immediately or after 2 h at 65°C. Proteins of the enzyme-substrate complex were analyzed on 12% SDS PAGE and stained with Coomassie blue, whereas RNAs were analyzed on
Acrylamide/Urea 12.5% gel and stained with toluidine blue. Asterisks show the four RNA products generated by processing events after pseudouridylation reaction.
Panel B: Analysis of the RNAs by 5’- and 3’-end labelling and fractionation by gel electrophoresis,
Pab91 and S
22 f 5
U were preliminary labelled at their 5’ or 3’ extremities. Then, each of them (400 cps) were individually added to 10 µM of their respective unlabeled partner Pab91, the set of proteins L7Ae and aCBF5/aNOP10 and S
22 f 5 U. After 2 h at 65°C, RNAs were separated on 10 % polyacrylamide gel and visualized by phosphorimaging. Analysis revealed one major cleavage both in the RNA guide
Pab91 and in the RNA product S22f 5 ho 6 ψ.
Panel C: Sequence analysis of the RNA product S
22 f 5 ho 6 ψ. Unlabeled (10 µM) and 5’-end labelled
(100 cps) RNA substrate S
22 f 5 U were submitted to alkaline hydrolysis (lane 1) to generate a full ladder
S-7

of the sequence, and RNase T1 enzymatic cleavage under denaturing conditions to reveal the guanosines (indicated by dotted circles, lane 2) and then separated on 10 % polyacrylamide gel. In parallel, 5’-end labelled RNA substrate S
22 f 5 U (100 cps) incubated with 10 µM of Pab91, proteins L7Ae and aCBF5/aNOP10 and unlabeled S
22 f 5 U during 2 h at 65°C were fractionated in lane 3. Lightening represent the position the phosphodiester bonds cleaved within the RNA product S
22 f 5 ho 6 ψ after pseudouridylation reaction (right sequence).
Panel D: Position of the cleavages on the sequence of RNA product S
22 f 5 ho 6 ψ. RNA sequencing revealed that cleavages occurred mainly between nucleotides 16 and 17 of S
22 f 5 ho 6 ψ allowing to explain the mass loss of ~1900 Da on the P/L/C/N complex.
Panel E: Gel electrophoresis analysis of reaction products. Pab91 guide RNA (P), L7Ae (L), aCBF5/aNOP10 (C/N), and RNA substrate S
22 were mixed together (5 µM each) and separated by gel electrophoresis immediately or after 2 h reaction at 65°C. RNAs were analyzed on Acrylamide/Urea
12.5% gel and stained with toluidine blue.
S-8