IMS: Immunogenetic Management Software
User Manual
Table of Contents
Availability and Setup ................................................................................................................................................ 4
IMS User Interface ..................................................................................................................................................... 4
New User Registration ........................................................................................................................................... 4
User Login .............................................................................................................................................................. 5
Colony Selection..................................................................................................................................................... 5
Search Hierarchy ........................................................................................................................................................ 6
Name Search .......................................................................................................................................................... 6
Multiple Name Selection ....................................................................................................................................... 7
Matching by Microsatellite-based MHC Haplotype Pattern .................................................................................. 7
Zero Microsatellite-based MHC Haplotype Match Search ................................................................................ 7
One Microsatellite-based MHC Haplotype Match Search ................................................................................. 7
Two Microsatellite-based MHC Haplotype Match Search ................................................................................. 8
MHC Search by Microsatellite-based MHC Haplotype Pattern Name, Allele-specific PCR or MHC
Expression Alleles................................................................................................................................................... 9
Microsatellite-based MHC Haplotype Pattern ................................................................................................... 9
Allele-Specific PCR MHC Alleles ......................................................................................................................... 9
Expression Sequence Derived MHC Alleles...................................................................................................... 10
All Sires and All Dams ........................................................................................................................................... 10
Selecting an Animal for Further Analysis ................................................................................................................. 10
Pedigree Chart ..................................................................................................................................................... 10
Sire-Centric View .............................................................................................................................................. 11
Dam-Centric View ............................................................................................................................................ 12
Offspring-Centric View ..................................................................................................................................... 13
Full/Half Siblings View.......................................................................................................................................... 14
Data Views ....................................................................................................................................................... 14
Color Coding ..................................................................................................................................................... 15
Shared MHC Allele-Specific PCR Allele Score .................................................................................................. 16
Shared MHC Expressed Allele Score ................................................................................................................ 17
Degree of Microsatellite-based MHC Haplotype Matching ................................................................................. 18
2
Analysis ................................................................................................................................................................ 19
Animal Name Search ........................................................................................................................................ 19
Data Export .............................................................................................................................................................. 20
Administrative Login ................................................................................................................................................ 21
User Management ............................................................................................................................................... 21
Colony Management............................................................................................................................................ 22
Add Colony Site ................................................................................................................................................ 22
List Colony Sites ............................................................................................................................................... 22
Add Species ...................................................................................................................................................... 22
List Species ....................................................................................................................................................... 23
Add Colony ....................................................................................................................................................... 23
List Colonies ..................................................................................................................................................... 23
Data Upload ......................................................................................................................................................... 23
Excel Template ................................................................................................................................................. 23
Upload Process................................................................................................................................................. 28
Data Validation................................................................................................................................................. 28
Upload Failure .................................................................................................................................................. 28
User Password Management ............................................................................................................................... 29
Delete Colony Data .............................................................................................................................................. 29
Edit Application Properties .................................................................................................................................. 29
Appendix A. Navigating Immunogenetic Management Software (IMS).................................................................. 30
Appendix B. Primer Sequences of Microsatellites Used in Sample Data ................................................................. 30
3
Availability and Setup
Immunogenetic Management Software (IMS) is freely available for distribution to non-commercial users
by contacting the authors. Those wishing to obtain a copy of the software must sign a Materials
Transfer Agreement (MTA). An installation package or hyperlink to download the installation files and
detailed instructions will then be sent via email. The installation package will include:
 MySQL
 Tomcat
 Compiled IMS code
 IMS database
 Upload Excel template
 Installation instructions
The IMS demonstration site is available at https://nhpcsg.emory.edu/typing_demo and can be accessed
with the following login information:
username: imsdemo7@gmail.com
password: imsdemo
The software demonstration site is implemented in Java, MySQL and Tomcat, with supported browsers
including Internet Explorer and Firefox on Windows and Safari on Mac OS. The demonstration site does
not allow guest users to upload data, but contains a sample data set for demonstration purposes. Users
wishing to upload data must install a local version of IMS.
IMS User Interface
The Immunogenetic Management Software (IMS) interface works best with FireFox or Internet Explorer
on Windows and Safari on Mac OS.
The Immunogenetic Management Software (IMS) landing page provides two hyperlinks to gain access to
the system. The first links to the user registration page; the second links to the login page. Users are
required to log in to access the software.
New User Registration
Each instance of the software will be operated independently by the requesting site, with each site
designating a local administrator to perform data management, upload and access tasks. All new users
can register and request access from their designated administrator through the registration form.
When completing the form, new users must include name, company, department, job title, valid email
address and password.
Located at the bottom of the form is a table listing the names of all available colonies. To request access
to colony data, check the boxes next to the desired colony names in the table and click Submit.
4
When the registration form is submitted, an email message is sent to the site administrator, who
subsequently logs in to activate the new user account and grants the user access to the requested
colonies. The site administrator should contact the new user when access is granted.
User Login
Existing users can login with valid usernames and passwords. Upon successful user login, the application
advances to the colony selection screen.
Colony Selection
The Colony Selection screen lists all colonies the user is authorized to view. To view colony data, select
the radio button next to the colony name and click Submit.
5
Search Hierarchy
The application provides search functionality with the end goal of selecting a single animal for further
analysis. Such an animal is designated as the “selected” animal, and the analysis tools included in the
software provide different perspectives to compare the selected animal with other animals in the
colony.
Search capabilities include the following:



Single or multiple name search
Comparison by Microsatellite-based MHC haplotype matching
MHC search by Microsatellite-based Haplotype Pattern Name, Allele-Specific PCR MHC Alleles,
or Expression Sequence Derived MHC Alleles
 All sires
 All dams
Search results for the options described above include the data reported as follows:





Demographics Summary, which lists demographic information about the animal, including
animal name, sire, dam, year of birth, weight, date weight last updated, MHC haplotype 1
pattern name and MHC haplotype 2 pattern name, availability and animal status
Detailed Microsatellite Haplotype View, which lists animal name, MHC microsatellite pattern
names for haplotypes 1 and 2, microsatellite markers, and base pair lengths
Detailed Pedigree Data, which lists animal name, microsatellite markers and unparsed base pair
lengths used to determine animal pedigree
Allele-Specific PCR Alleles, which lists animal name and MHC alleles assayed by allele-specific
PCR and grouped by Class I and Class II, and their statuses (positive or negative)
MHC Expressed Alleles, which lists allele lineage groups and relative frequency of sequence
reads, and expression haplotypes for each animal and its parents
Name Search
The first search option is a single name search. The Name Search tab contains a drop-down listing the
names of all animals found within the colony. To search for an animal, select the animal name from the
drop-down. The application responds to the name selection and executes the search automatically.
6
Multiple Name Selection
The Multiple Name Selection tab provides the capability to search for multiple animals at once by
specifying a list of animal names.
To perform the search:
1. Use the form to build a list of animals one at a time by either
typing in the animal name into the available text box or
selecting it from the dropdown list.
2. After typing in the animal name or selecting it from the
dropdown, click the Add to List button. This adds the animal
name to the running list stored in the combo box.
3. To remove an animal name from the search list, select the
animal name in the combo box, and click Remove.
4. When the search list is complete, click Submit to execute the
search.
Matching by Microsatellite-based MHC Haplotype Pattern
The Microsatellite-based MHC Haplotype Matching tab provides functionality to search for animals
based on zero, one or two matching microsatellite-based MHC haplotype patterns.
Zero Microsatellite-based MHC Haplotype Match Search
The zero haplotype match search looks for all animals having haplotype patterns in which neither of the
microsatellite patterns are shared when compared with a selected animal.
To perform a zero haplotype match search:
1. On the Microsatellite-based MHC Haplotype Matching tab, from the Degree of Microsatellitebased MHC Haplotype Match dropdown, select 0-Microsatellite-base MHC Haplotype Match.
2. Select a name from the Animal Name dropdown.
3. Click Submit.
Depending on the number of animals that meet the search criteria, it may take a few minutes for the
entire search results to display.
One Microsatellite-based MHC Haplotype Match Search
The one and two microsatellite-based MHC haplotype match searches compare animals within the
colony to search for groups of animals that have one or two matching microsatellite haplotype patterns
and return results showing animals grouped by their matching patterns. To perform a one haplotype
match search:
1.
Select the 1-Microsatellite-based MHC Haplotype Match option from the Degree of
Microsatellite-based MHC Haplotype Match dropdown.
7
2. Leave the Animal Name dropdown blank.
3. Click Submit.
The search results for the one-haplotype match search return the microsatellite haplotype pattern
names shared by the animals followed by animal data displayed in tables below the pattern names.
Two Microsatellite-based MHC Haplotype Match Search
To perform a two haplotype match search:
1.
Select the 2-Microsatellite-based MHC Haplotype Match option from the Degree of
Microsatellite-based MHC Haplotype Match dropdown.
2. Leave the Animal Name dropdown blank.
3. Click Submit.
The search results (shown on next page) for the two-haplotype match search returns the microsatellite
haplotype pattern names shared by the animals followed by animal data displayed in tables below the
pattern names.
8
MHC Search by Microsatellite-based MHC Haplotype Pattern Name, Allelespecific PCR or MHC Expression Alleles
The MHC Search tab provides access to the following independent search options:



Microsatellite-based MHC Microsatellite Pattern
MHC Alleles determined by allele-specific PCR
Expression Sequence Derived MHC Alleles
Microsatellite-based MHC Haplotype Pattern
The Microsatellite-based MHC Haplotype Pattern search option provides the capability to search for
animals by microsatellite-based haplotype pattern name. The user can select from a dropdown that lists
every haplotype pattern name assigned within the selected colony. To execute the search, select a
pattern from the dropdown and click the Microsatellite-based Haplotype Pattern Search button. Search
results include animals that have the selected pattern name.
Allele-Specific PCR MHC Alleles
The second search option on the MHC Search tab is searching MHC Allele-specific PCR alleles. This
enables searching by positive or negative status of Allele-Specific PCR MHC alleles. To perform the
search:
1. Under the MHC Allele-specific PCR heading, click Show Items to expand the view to display all
searchable alleles.
2. Select the option in the positive (+) or negative (-) column that reflects with the desired allele
status. Multiple alleles having different statuses can be searched in combination.
3. To execute the search, click the PCR Allele Search button.
9
Expression Sequence Derived MHC Alleles
The third search option on the MHC Search tab is searching by Expression Sequence Derived MHC
alleles. This enables searching for animals by the presence or absence of expressed MHC allele lineages.
An MHC lineage group represents groups of closely related MHC alleles and is designated as present (or
positive) if the frequency of its alleles is greater than or equal to 1%. An MHC lineage group is absent (or
negative) if the frequency of its alleles is less than 1% or not reported.
To perform the search:
1.
Under the Expression Sequence Derived MHC Alleles heading, click Show Items to expand the
view to display all available MHC Lineage groups.
2. Select the positive (+) or negative (-) options next to the corresponding MHC lineage groups to
include in the search.
3. To execute the search, click MHC Allele Search.
All Sires and All Dams
The All Sires tab lists all animals within a colony that have the role of sire. Similarly, the All Dams tab
lists all animals within a colony that have the role of dam.
Selecting an Animal for Further Analysis
All of the searches described above return results under the Demographics Summary view. This view
displays demographic data in tabular format, and on the right hand side of every row is a Select
hyperlink. Clicking this hyperlink on the row of the corresponding animal designates the animal as the
“selected” animal, and the subsequent analysis perspectives show the selected animal compared with
other animals.
Pedigree Chart
After an animal is selected, the application advances to the analysis section. The first tab in this section
is the Pedigree tab in which all available options for viewing an animal in a pedigree chart are listed. The
options are based on roles an animal has within the colony – either as a sire, dam or offspring. To open
the pedigree chart, click on the animal name and role hyperlink.
Depending on your browser, the pedigree chart for the selected animal opens in a separate window or
tab. There are three different variations of the pedigree chart that reflect different familial roles an
animal can have: Sire-centric, Dam-centric, or Offspring-centric
10
Sire-Centric View
In the sire-centric view, the sire appears as the center node, and the outer nodes represent the dams.
Segments representing mating lines join the sire node with each of the dam nodes, and the intermediate
nodes attached to the mating lines represent the offspring.
Gender is represented by the shape of the nodes, with rectangles representing males and ovals
representing females.
Each of the nodes contains the name of the animal that it represents along with two color-coded circles
that represent the microsatellite patterns assigned to MHC haplotypes 1 and 2 for that animal.
This visualization enables investigators to establish relationships between the animals and identify
matching or mismatched haplotype patterns shared between full and half siblings. In addition, the
graph is interactive so that when a node is moused over, information about the animal is displayed in a
pop-up. While the data can be customized, by default, the year of birth and haplotype pattern names
are displayed, which further allows users to verify haplotype pattern assignments and compare them
between animals.
11
Dam-Centric View
The dam-centric view looks like the sire-centric view, but central and outer nodes appear to be
swapped, with the central node representing the dam, outer nodes representing the sires, and
intermediate nodes representing the offspring.
12
Offspring-Centric View
The offspring-centric view focuses on a selected animal as an offspring and displays the complete
pedigrees of both the animal’s sire and dam. The parent nodes are joined by a mating line to which the
selected animal and its full siblings are attached. This combined view enables investigators to see full
and half siblings of a selected animal related through both its sire and its dam.
If an animal has two roles in any given pedigree (for instance, the animal is both an offspring and a sire
in an offspring-centered view, shown for animal ID# C17 in the Figure, below) that animal will be shown
twice on the pedigree chart. To indicate that the chart is displaying a single animal twice (given the
animals two distinct roles in the pedigree), the outline of the oval or square that corresponds to this
animal will be highlighted in red in the pedigree.
13
Full/Half Siblings View
The Full/Half Siblings displays animal data in tabular format with animals grouped by:






Selected animal: Animal that was selected from the search hierarchy and was designated as the
“selected” animal
Sire: Sire of the selected animal
Dam: Dam of the selected animal
Full Siblings: Animals sharing both sire and dam with the selected animal
Half Siblings through Sire: Animals sharing sire only with the selected animal
Half Siblings through Dam: Animals sharing dam only with the selected animal
Data Views
There are six views available under the Full/Half Siblings tab, including:







Demographics Summary, which lists demographic information about the animal, including
animal name, sire, dam, year of birth, weight, date weight last updated, MHC haplotype 1
pattern name and MHC haplotype 2 pattern name
Detailed Microsatellite Haplotype View, which lists animal name, Microsatellite-based MHC
haplotype pattern names for MHC haplotypes 1 and 2, microsatellite markers, and base pair
lengths
Detailed Pedigree Data, which lists animal name and raw microsatellite data used to determine
parentage
MHC allele specific PCR Alleles, which lists animal name with MHC alleles determined by allelespecific PCR that have been grouped by Class I and Class II and their statuses (positive or
negative)
MHC Expressed Alleles, which lists allele lineage groups and relative transcript frequencies, and
expression haplotypes for each animal and its parents
Shared PCR Alleles, which calculates and reports the number of positive and negative alleles
animals share with the selected animal
Shared MHC Expressed Alleles, which calculates and reports the number of positive (present at
>1% of all class I transcripts) and negative (<1% or absent) MHC expressed allele lineage groups
animals share with the selected animal
14
Color Coding
Color coding is used to highlight MHC haplotype patterns that match those of the selected animal. By
convention, MHC haplotype 1 is designated as the microsatellite pattern inherited from the sire and
MHC haplotype 2 as the pattern inherited from the dam. MHC haplotype 1 on the selected animal is
always color coded as orange and MHC haplotype 2 is color coded as blue. If a matching pattern is
found on either of the sire chromosomes, they are color coded as orange. Similarly, if a matching
pattern is found on either of the dam chromosomes, they are color coded as blue. For the remaining
groups of animals (full siblings and half siblings through the sire and dam) haplotype patterns that match
the selected animal are assigned the corresponding color – blue or orange.
15
Shared MHC Allele-Specific PCR Allele Score
The application implements an algorithm that calculates a score based on the number of shared PCR
alleles that two animals have in common. First, the algorithm identifies the MHC Allele-specific PCR
alleles of the selected animal that have positive or negative results and counts them. After evaluating
the selected animal, the algorithm compares every animal in the view with the selected animal and
calculates the following separately for Class I and Class II alleles:




Number of alleles tested: the number of PCR alleles with positive or negative results
Number of positive alleles: total number of positive alleles
Number of negative alleles: total number of negative alleles
Number of positive alleles intersecting with those of the selected animal: count of positive
alleles an animal has in common with the selected animal
 Number of negative alleles intersecting with those of the selected animal: count of negative
alleles an animal has in common with the selected animal
 Total number of alleles intersecting: total positive and negative alleles an animal has in
common with the selected animal
The actual score is the total number of positive and negative alleles intersecting, or shared, with those
of the selected animal. Class I and Class II allele scores are calculated separately. Analysis assumes that
the higher the score, or more alleles two animals share, the more closely matched the animals are.
To access the shared MHC Allele-specific PCR allele score feature, select an animal, and on any of the
list view tabs, including Full/Half Siblings, Degree of Haplotype Matching or Analysis, select the Shared
MHC Allele-specific PCR hyperlink.
16
Shared MHC Expressed Allele Score
The application implements an algorithm that calculates a score based on the number of shared MHC
Expressed allele lineages that two animals have in common. First, the algorithm looks for positive or
negative MHC Expressed allele lineages of the selected animal and counts them. The positive or
negative status of MHC Expressed allele lineages is defined as positive if the relative frequency of
sequence reads is ≥ 1% of the total reads identified in an animal; allele lineages with read frequencies <
1% or not reported are defined as negative. For every other animal in the view, the algorithm calculates
the following:

Number of allele lineages tested: the number of MHC Expressed allele lineages determined as
positive (≥ 1%) or negative (< 1%)
 Number of positive allele lineages: total number of positive allele lineages
 Number of negative alleles: total number of negative allele lineages
 Number of positive allele lineages intersecting with those of the selected animal: count of
positive allele lineages an animal shares with the selected animal
 Number of negative allele lineages intersecting with those of the selected animal: count of
negative or absent allele lineages an animal shares with the selected animal
 Total number of allele lineages intersecting: total positive and negative or absent alleles an
animal shares with the selected animal
The actual score is the total number of positive and negative allele lineages intersecting with the
selected animal. Analysis assumes that the higher the score, the more closely matched an animal is with
the selected animal.
To access the shared MHC Expressed allele score feature, after selecting an animal, on any of the list
view tabs, including Full/Half Siblings, Degree of Haplotype Matching or Analysis, select Shared MHC
Expressed Alleles hyperlink.
17
Degree of Microsatellite-based MHC Haplotype Matching
The Degree of Microsatelitte-based MHC Haplotype Matching tab provides the capability to identify
animals that match the selected animal by zero, one or two microsatellite-based haplotype patterns.
This search differs from the matching by Microsatellite-based MHC Haplotype described above because
all of the searching performed here is relative to the selected animal.

0-Microsatellite-based MHC Haplotype Match: The zero microsatellite-based MHC haplotype
match search looks for all animals having haplotype patterns that, when compared with those of
a specific animal, none of the patterns found on any of the chromosomes match
 1-Microsatellite-based MHC Haplotype Match: The one microsatellite-based MHC haplotype
match search looks for all animals having patterns that match at least one of the haplotype
patterns of the selected animal
 2-Microsatellite-based MHC Haplotype Match: the two microsatellite-based MHC haplotype
match search looks for all animals having patterns that match both of the haplotype patterns of
the selected animal
Search results display the data in tabular format grouped by the following:

Selected Animal: Animal that was selected from the search hierarchy and was designated as the
“selected” animal
 Sire: Sire of the selected animal
 Dam: Dam of the selected animal
 Full Siblings: Full siblings of the selected animal
 Half Siblings: Half siblings of the selected animal – either through the sire or the dam
 Others: All other animals that are not immediate within the same immediate pedigree as the
selected animal
Consistent with the rest of the application, the following views are available under the Degree of
Haplotype Matching tab:





Demographics Summary
Detailed Microsatellite-based MHC Haplotype View
Detailed Pedigree Data
MHC Allele-specific PCRMHC Expressed Alleles
Shared MHC Allele-specific PCR Shared MHC Expressed Alleles
18
Analysis
The analysis tab enables the user to search for other animals by name to compare with the selected
animal. In addition, this tab provides the same analysis tools as the previous tabs mentioned in this
section, including:



Color coding of matching microsatellite-based MHC haplotype patterns
Shared MHC Allele-specific PCR allele score calculated for any animal returned in the search
results compared with the selected animal
Shared MHC Expressed allele score calculated for any animal returned in the search results
compared with the selected animal
Animal Name Search
To perform the search:
1. Use the form to build a list of animals one at a time by
either typing in the animal name into the available text
box or selecting it from the dropdown list.
2. After typing in the animal name or selecting it from the
dropdown, click the Add to List button. This adds the
animal name to the running list stored in the combo box.
3. To remove an animal name from the search list, select
the animal name in the combo box, and click Remove.
4. When the search list is complete, click Submit to execute
the search.
19
Data Export
All tabular data displayed in the application can be exported into MS Excel. Available export options
available are dependent on how the data is grouped and displayed.
When the data is displayed in a single table, as it is on the All Sires tab, for example, check boxes are
located on the rows of individual animals and can be used to select the animal data to include in the
export. Above the table is a Select All option that, when checked, selects all of the rows in the table that
follows. To export the selected animal data, click on the Export Data hyperlink.
When data is grouped into multiple tables, as it is in a one or two-haplotype match search, the export
can include data from a single table by selecting the rows to export as described above or all data on the
page by clicking the Export All Data On Page hyperlink.
20
Administrative Login
User Management
Located under the administrative login is the User Management tab. The User Management tab
provides a list of all user accounts, account status (active or inactive), and the colonies each user has
requested permission to access.
User account status and colony privileges are managed under the User Management tab. User accounts
can be marked as Active or Inactive by changing the status in the available dropdown. Marking an
account as Inactive disables the user login access.
Colony privileges are managed under the User Management tab. Whenever a user requests access to a
colony, the site administrator receives notification by email. In response to the user request, the site
administrator must log into the application to approve the request before the user can access the colony
data.
On the User Management tab, the name of the requested colony appears in the Colonies Access list next
to the user account. To grant access, the site administrator must check the box next to the colony
name. Similarly, the site administrator can remove access by un-checking the box next to the colony
name.
21
Colony Management
Located under the administrative login is the Colony Management tab, which provides access to the
following functions:






List Colony Sites: List of all colony sites, including the name, short name, street address, city,
state, zip, phone, fax, primary contact and email address
List Species: List of all species, including species abbreviation and description
List Colonies: List of all colonies, which consist of colony-species associations
Add Colony Site: Form for input of new colony site data
Add Species: Form for adding a new species
Add Colony: Options for creating a new colony-species associations
Add Colony Site
Colony site describes the location where a colony or animals reside. It may represent a primate center,
research facility or similar entity. Information that can be stored about a colony site includes site name,
site short name, address, city, state, zip code, phone number, fax, primary contact and email.
To add a colony site:
1. Under the administrative login, on the Colony Management tab, click on the Add Colony Site
hyperlink.
2. Complete the Add Colony Site form.
3. Click the Add Colony Site button.
4. After the form is submitted, the application will return with a message indicating the colony site
was added successfully.
List Colony Sites
The List Colony Sites hyperlink provides a complete list of colony sites. Data listed includes site name,
site short name, street address, city, state, zip, phone, fax, primary contact and email address.
Add Species
To add a species:
1. Under the administrative login, on the Colony Management tab, click on the Add Species
hyperlink.
2. In the fields provided, input the Species Abbreviation and Description. For example, the
following could be used to describe rhesus macaques:
Species Abbreviation: RHESUS
Species Description: Rhesus Macaque
3. Click the Add Species button.
22
List Species
The List Species hyperlink provides a complete list of species. Data listed includes species abbreviations
and descriptions.
Add Colony
In IMS, a colony describes a group of animals that reside or are managed at the same location (colony
site) and are members of the same species. By this definition, a colony consists of a combination of
colony site and species. To add a colony:
1. Under the administrative login, on the tab, Colony Management tab, click on the Add Colony
hyperlink.
2. The Create Colony view consists of two tables. The first table lists colony sites; the second table
lists species.
3. Select an option from the list of colony sites.
4. Select an option from the list of available species.
5. Click the Add Colony button.
List Colonies
The List Colonies hyperlink provides a complete list of colonies. Data listed includes colony site, species
and colony name, which is a hyphenated combination of the colony short name and species
abbreviation.
Data Upload
Data upload privileges are limited to site administrators, and the Upload Data tab is available under the
administrator login.
Excel Template
Included in the IMS distribution is an Excel template for uploading data into the IMS database. The
template file contains nine tabs, including:



Instructions: Provides instructions for populating data on each of the tabs.
Demographics: Use this tab to provide demographics data using one row per animal.
o Encode Sex as M=Male and F=Female
o Use four-digit years to represent YOB (Year of Birth)
o Populate the Available Flag column with ‘Y’ if the animal is available and ‘N’ if the
animal is unavailable
o Populate the Status column using the following codes: 0=Undetermined, 1=Boarder,
2=Breeder, 3=Deceased
Microsat-based MHC Haplotype: Use this tab to provide data on microsatellite-based MHC
markers, including flags for the core markers to be used in pattern analysis and base pair lengths
o Beginning with cell A4, provide animal name
o Most animals will have two rows in the spreadsheet, with each row representing a
single microsatellite-based MHC haplotype
23
o





Beginning with cell B4, provide the microsatellite-based MHC haplotype number, either
1 or 2. By convention, the application designates MHC haplotype 1 as inherited from
the sire and MHC haplotype 2 as inherited from the dam. If unknown, these numbers
can be arbitrarily assigned
o Use the first row beginning with column C to list microsatellite markers in their proper
sequence
o Below the markers in the second row, provide a flag (‘Y’) below the names of the
markers to be included as core markers in the microsatellite-based MHC haplotype
pattern analysis for assigning pattern names and an ‘N’ below the markers to be
excluded from the analysis
o Beginning on the fourth row below the microsatellite markers, provide the base pair
lengths that correspond with the appropriate animals and MHC haplotype numbers
MHC Allele-Specific PCR: Use this tab to provide data on alleles tested through MHC Allelespecific PCR analysis. On each row beginning with row 2:
o Provide the animal name
o Origin (1=sire, 2=dam, 3=both, 4=undetermined)
o Class (I=Class I, II=Class II)
o MHC Allele-Specific PCR allele
o Result (P=positive, N=negative.)
Expression Haplotypes: Use this tab to provide data related to haplotype naming of expressed
allele lineage groups determined by pyrosequencing. On each row,
o List the animal name
o Expression haplotype
o Origin (sire, dam or unknown)
Expression Haplotype Key: Use this tab to list allele lineage groups represented by the
expression haplotypes. On each row,
o List the expression haplotype
o A comma-delineated list of allele groups represented by the haplotype
Lineage Groups: Use this tab to provide data on allele lineage groups and number of reads per
animal. On each row,
o List the animal name
o Lineage group
o Number of reads
Lineage Group Key: Use this tab to list strings of possible alleles represented by allele lineage
groups. On each row,
o List the lineage group. (Note: The lineage group names represented here should match
the names of the groups reported on the previous Lineage Groups tab.)
o Strings of all possible alleles represented by the group
24

Pedigree Haplotypes: Use this tab to provide raw microsatellite data that was used to
determine paternity.
o Use the first row beginning with column B to list the names of the microsatellite
markers
o Beginning with row 2, every row represents an animal
o List animal name in the first column and
o Base pair lengths in the remaining columns below the microsatellite markers
The following table describes in detail the data elements in the template file.
Tab Label
Demographics
Demographics
Demographics
Demographics
Demographics
Demographics
Demographics
Demographics
Demographics
Demographics
Microsat-based
MHC Haplotype
Column/Row
Header
Animal name
Sire
Dam
Sex
YOB
Weight
Date Wt.
Recorded
Status
Description
Data Type
Required
Animal name
Animal sire
Animal dam
Gender
Year of birth
Weight
Date weight was
last recorded
Status
Text
Text
Text
Text
Date
Number
Date
Y
N
N
N
N
N
N
Number
N
Date Status
Updated
Available Flag
Microsatellite
Code (Row 1)
Date status was last
updated
Availability flag
Applies to the first
row of the
worksheet,
beginning with cell
C1, list the names of
microsatellite
markers included in
the data set
Applies to the
second row of the
worksheet
beginning with cell
C2, provide Yes/No
flags to identify the
core group of
microsatellite
markers used in
pattern analysis
Animal name
Date
N
Text
Text
N
Y
Y=Yes, N=No
Text
Y
Y=Yes, N=No
Text
Y
Microsat-based
MHC Haplotype
Core
Microsatellite
(Row 2)
Microsat-based
Animal name
Valid Values
0=Undetermined,
1=Boarder,
2=Breeder,
3=Deceased
25
Tab Label
MHC Haplotype
Microsat-based
MHC Haplotype
Column/Row
Header
Description
Data Type
Required
Valid Values
MHC
Haplotype
Number
Number identifying
the microsatellitebased MHC
haplotype the
pattern is found on.
Typically
microsatellite
haplotype 1
represents
inheritance from
the sire and
microsatellite
haplotype 2 for
inheritance from
the dam. If
unknown, these can
be assigned
arbitrarily.
Base pair lengths for
corresponding
microsatellite
markers listed in
row 1
Animal name
Text
Y
1, 2
Text
N
Text
Y
Number
Y
1=Sire,
2=Dam,
3=Both,
4=Unknown
Text
Y
I=Class I,
II=Class II
Text
Y
Animal Name
Coded origin
representing
inheritance from
the sire, dam, both
or unknown
Describes the class
of the MHC AllelePCR alleles, typically
class I or class II
Name of the PCR
allele, such as A*01,
B*01, etc.
Coded result for
MHC Allele-specific
PCR allele tested
Animal name
Text
Y
Expression
Describes the
Text
Y
Microsat-based
MHC Haplotype
Row 4,
beginning
with column C
MHC AlleleSpecific PCR
MHC AlleleSpecific PCR
Animal Name
MHC AlleleSpecific PCR
Class
MHC AlleleSpecific PCR
MHC AlleleSpecific PCR
allele
Result
MHC AlleleSpecific PCR
Expression
Haplotypes
Expression
Origin
Text
P=Positive,
N=Negative
26
Tab Label
Haplotypes
Column/Row
Header
Haplotype
Expression
Haplotypes
Origin
Expression
Haplotype Key
Expression
Haplotype Key
Expression
Haplotype
Allele Lineage
Groups
Represented
Lineage Groups
Lineage Groups
Animal Name
Lineage Group
Lineage Groups
Reads
Lineage Group
Key
Lineage Group
Key
Lineage Group
Pedigree
Haplotypes
Pedigree
Haplotypes
Animal Name
Pedigree
Haplotypes
Row 2,
columns 2..n
String of all
possible
alleles
Row 1,
columns 2..n
Description
Expression
Haplotype assigned
to the animal
Origin of inheritance
from the sire, dam,
or unknown
Expression
Haplotype
Comma-separated
list of allele lineage
groups represented
by Expression
Haplotype
Animal name
Lineage group
representing groups
of MHC alleles
tested
Number of reads
detected per animal
for each lineage
group; can be left
blank if lineage
group was tested,
but no reads were
detected
Lineage group
String of all possible
alleles represented
by lineage group;
alleles should be
comma-separated
Animal name
List names of
microsatellite
markers included in
parentage
haplotypes
List corresponding
base pairs inherited
from both parents
as ‘###/###’
Data Type
Required
Valid Values
Text
Y
Sire,
Dam,
Unknown
Text
Y
Text
Y
Text
Text
Y
Y
Number
N
Text
Y
Text
Y
Text
###/###
27
Upload Process
Located under the admin login is the Upload Data tab. To upload data:
1. Select the radio button next to the name of the colony represented by the data set.
2. If the upload file contains data corrections or modifications that need to be committed to the
database, select the checkbox next to Select to replace data…
3. Click the Browse button.
4. Using the File Upload dialog, browse to locate the upload file on your computer. Double-click
the file, or select the file and click Open.
5. Click the Upload File button.
6. After the file uploads, a message is posted on the screen indicating that the file as been
uploaded for processing.
7. After the upload process completes, an email message is generated by the application and sent
to the site admin indicating that the upload was successful. Attached to the message is a copy
of the upload file, and if the Select to replace data… checkbox was left unchecked, a file
reporting differences found between existing data and the uploaded data is also attached.
Data Validation
The upload process provides data validation. When an upload results in potential updates to existing
records the database, if entries in the upload file differ from the existing records, instead of overwriting
records in the database, the process generates a spreadsheet reporting the differences and sends it back
to the site administrator. This gives the site administrator and researchers an opportunity to validate
the data before committing it to the database.
To commit the changes, the next time the input file is uploaded, check the box next to Select to replace
data.
Upload Failure
If the upload process fails, an email message that describes the cause of the failure is generated and
sent to the site administrator.
28
User Password Management
The admin console includes functionality to reset user passwords. To reset a password:
1. Under the admin console, on the User Password Management tab, from the Select a User
dropdown, select the user requesting a password reset.
2. Enter a new password in the Password field.
3. Retype the password in the Repeat Password field.
Delete Colony Data
The admin console provides functionality to delete data for an entire colony. To delete colony data,
under the admin console, on the Delete Colony Data tab, select the colony associated with the data to
be deleted and click the Delete Colony Data button.
Edit Application Properties
The admin console provides functionality to update application properties, such as messages that are
displayed on the screen in response to user actions, subject lines and text of email messages that get
generated by the application, and the SMTP host address used by the application. To edit application
properties:
1. Under the admin console, on the Edit Application Properties tab, refer to the property names,
descriptions and text boxes to identify and update the properties to the updated.
2. After updating the desired properties, click the Submit button at the bottom of the screen to
commit the changes.
29
Appendix A. Navigating Immunogenetic Management Software (IMS)
Follow the instructions provided below to access the IMS demo data and learn how to navigate through
the user interface:
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
Go to https://nhpcsg.emory.edu/typing_demo.
Click on the hyperlink associated with If you have an account, please click here.
Log in with the following:
 username: imsdemo7@gmail.com
 password: imsdemo
Select the YERKES-RHESUS colony and click Submit.
Click on the Multiple Name Selection tab.
In the text box under Animal ID, enter S01, and click Add to List. Then, click Submit.
The record for S01 is retrieved. At the end of the row, click the Select hyperlink. This leads to the
Pedigree tab. To draw the pedigree for S01, click the S01 sire hyperlink. The pedigree chart will
open in a new tab or browser window.
In the pedigree chart, notice the color coding. The colored circles within the nodes represent
distinct microsatellite-based MHC haplotype patterns found within the pedigree.
Next, mouse over the node for S01. Notice the data that pops up and the patterns assigned to
microsatellite-based MHC haplotype 1 and microsatellite-based MHC haplotype 2 (000001 and
000005).
Next, mouse over the node for D12 and note its microsatellite-based MHC haplotype patterns
(000015 and 000022).
Notice the offspring, C21, C22 and C20. You can tell by the color coding and their microsatellitebased MHC haplotype pattern numbers that C21 and C20 are two-haplotype matched full siblings.
C22 is also a full sibling, but neither of her microsatellite-based MHC haplotype patterns match the
other full siblings.
Close the pedigree chart, return to the application, and click on the New Search hyperlink.
Next, click on the Microsatellite-based MHC Haplotype Matching tab. From the Degree of
Microsatellite-based MHC Haplotype Match dropdown, select 1-Microsatellite-based MHC
Haplotype Match and click Submit. This returns all one-haplotype matched animals within the
colony grouped by their matching pattern.
Navigate through the data by clicking on the following hyperlinks:
 Demographics Summary
 Detailed Microsatellite-based MHC Haplotype View
 Detailed Pedigree Data
 MHC Allele-specific PCRMHC Expressed Alleles
On the same tab, Microsatellite-based MHC Haplotype Matching, from the Degree of Microsatellitebased MHC Haplotype Match dropdown, select 2-Microsatellite-based MHC Haplotype Match and
click Submit. This returns all two-haplotype matched animals within the colony grouped by their
matching patterns.
From the last grouping, click the Select hyperlink for C09.
30
17 The first tab that appears is the Pedigree tab. Draw the pedigree for C09 by clicking the C09 offspring
hyperlink. This is an example of an offspring-centric pedigree chart that shows all full siblings and
half siblings for the selected animal.
18 Close the pedigree chart and click on the Full/Half Siblings tab. The first table shows data for the
selected animal, C09. Tables below it show data for the selected animal’s sire, dam, and full and half
siblings. In addition, the microsatellite-based MHC haplotype patterns are color coded to indicate
which patterns match the selected animal and originated from the sire and dam.
19 Click through all of the views on the Full/Half Siblings tab by selecting the following hyperlinks:
 Detailed Microsatellite-based MHC Haplotype View
 Detailed Pedigree Data
 MHC Allele-Specific PCR
 MHC Expressed Alleles
 Shared MHC Allele-Specific PCR
 Shared MHC Expressed Alleles
20 Click on the Degree of Microsatellite-based MHC Haplotype Matching tab. From the Match Type
dropdown, select 1-Microsatellite-based MHC Haplotype match and click Submit. This returns all
animals that are one- microsatellite-based MHC haplotype matched with C09.
21 Click on the Analysis tab and enter the following animal names to search: C03, S01 and D03. C03 is
an offspring of S01 and D03 and has an internal recombination (within the MHC) on its first
chromosome (pattern 000010.) Use the Detailed Microsatellite-based MHC Haplotype View to view
the MHC microsatellite data for these animals and compare the differences.
22 Click on the New Search hyperlink and select the MHC Search tab. This tab contains three distinct
search options. Under the MHC Microsatellite Haplotype Pattern heading, select MHC-RHESUSYERKES-000001 and click Haplotype Pattern Search. This returns all animals that have this
microsatellite-based MHC haplotype pattern.
23 Notice that MHC haplotype 1 for C08 is flagged with an ‘*’. This indicates a possible recombination
event or genotyping discrepancy on one of the flanking microsatellite markers.
24 Select the Detailed Microsatellite Haplotype View hyperlink to view the microsatellite markers, and
compare pattern 000001 of C08 with pattern 000001 of other monkeys in the view to find the
discrepancy (on marker D6S291.)
25 Scroll back up to the top of the page, and click the New Search hyperlink.
26 Click on the Show Items hyperlink under the Expression Sequence Derived MHC Alleles heading.
27 From the available search options, select the radio button under the ‘+’ heading next to MAMUA1*001g. Scroll to the bottom of the list and click MHC Allele Search. This returns all animals that
have a positive reading on MHC Expressed allele lineage group MAMU-A1*001g.
28 Click on the MHC Expressed Alleles hyperlink to view the lineage group and expression haplotype
data for these animals.
31
Appendix B. Primer Sequences of Microsatellites Used In Sample Data
Locus
Alias
Forward Primer
Reverse Primer
D6s1691
AGGACAGAATTTTGCCTC
GCTGCTCCTGTATAAGTAATAAAC
D6s276
TTCCAGTGTATACATCAATCAAATCA
GGGTGCAACTTGTTCCTCCT
222I18
GGAGGGAGGGAGAGAAAGTCA
GCCTCGGCACTCACACATTA
268P23
TCAGAAATGTGAGAATAAAGGAGACA
TGAAGCATTGGAAGGCAAAA
MOGCA (D6S2972)
GAATGTGAGAATAAAGGAGA
GATAAAGGGGAACTACTACA
151L13
AGGGCATCTCAGGCATTCAT
GGGGGAGGGATAGCATTAGG
162B17A
ACAGCCTCACCAACACCTGA
CCCCTTCTCTCCCCAAAGAT
162B17B
GAAGATGTGCCCATTTCCAGA
TTTCCACCACTGCCTTCTCA
246KO6
GCCCAATAGCAAGCCAAGAA
TGGTGAGGGGATTTCTCTGAA
MICA
(STRMICA)
CCTTTTTTTCAGGGAAAGTGA
CCTTACCATCTCCAGAAACTGC
DRA
(D6S2883 )
TGGAATGTCATCAAGGTCAG
TTGAAATTGATACTTTCCCAGTTCTC
9P06
CACTAACGATAGCTGATGAGCTTAAA
TGCACATCCCTGTATATCAAGC
G51152 (D6S2876)
GGTAAAATTCCTGACTGGCC
GACAGCTCTTCTTAACCTGC
D6s291
AGGACAGAATTTTGCCTC
GCTGCTCCTGTATAAGTAATAAAC
Additional information concerning these microsatellites can be found in -An MHC-defined primate
model reveals significant rejection of bone marrow after mixed chimerism induction despite full MHC
matching. Larsen CP, Page A, Linzie KH, Russell M, Deane T, Stempora L, Strobert E, Penedo MC, Ward T,
Wiseman R, O'Connor D, Miller W, Sen S, Singh K, Kean LS. Am J Transplant. 2010 Nov;10(11):2396-409.
32