IDENTIFICATION OF HOST PROTEINS INTERACTING WITH DENGUE NS5 BY
TANDEM AFFINITY PURIFICATION
Teeranai Ittiudomrak1,*, Juthathip Mongkolsapaya2,#, Bunpote Siridechadilok3,#
1
Master of Science Programme in Immunology, Department of Immunology, Faculty of
Medicine Siriraj Hospital, Mahidol University, Thailand
2
Dengue Haemorrhagic Fever Research Unit, Office for Research and Development, Faculty
of Medicine Siriraj Hospital, Mahidol University, Thailand
3
Medical Biotechnology Research Unit, National Center for Genetic Engineering and
Biotechnology (BIOTEC), National Science and Technology Development Agency, Thailand
*e-mail: teeranai.itt@hotmail.com #e-mail: j.mongkolsapaya@imperial.ac.uk,
bunpote.sir@biotec.or.th
Abstract
Dengue is a major public-health threat in tropical and sub-tropical regions. Half of the
world population is at risk. Dengue viruses are transmittted to human by urban mosquitoes,
Aedes aegypti. Infection by the virus causes a broad spectrum of illnesses ranging from mild
dengue fever (DF) to severe dengue heamorrhagic fever (DHF) and dengue shock syndrome
(DSS). The genome of dengue virus is a positive-sense, single-stranded RNA which encodes
a single polyprotein that is cleaved into ten proteins. Dengue proteins are categorized into
two groups: structural proteins which consist of capsid (C), pre-membrane (prM) and
envelope (E) and nonstructural proteins which consist of NS1, NS2A, NS2B, NS3, NS4A,
NS4B and NS5. NS5 is a key protein in viral RNA replication process. It contains RNAdependent RNA polymerase activity and methyltransferase activity. Previous studies reported
that host-NS5 protein interactions were important in virus replication and involved in viral
evasion of host defense mechanism. In this study, tandem affinity purification was applied to
study host-NS5 protein interactions. At least five host proteins were observed to co-purify
with dengue NS5 by SDS-PAGE. These protein bands will be further identified by mass
spectrometry and verified for their roles in viral RNA replication.
Keywords: dengue nonstructural protein 5, tandem affinity purification, dengue-host protein
interaction
Introduction
Dengue virus (DENV) is a virus in Flaviviridae family with four serotypes (DENV14). It is an arthropod-borne virus which is transmitted to human by Aedes Aegypti, an urban
mosquito and caused disease with broad range of symptoms from mild dengue fever (DF) to
severe dengue hemorrhagic fever (DHF) and dengue shock syndrome (DSS). DENV is
endemic in tropical and sub-tropical areas and has been a major public health problem. (1)
The genome of dengue virus is a positive-sense, single-stranded RNA. Its genome length is
approximately 11 kilobases. The dengue genomic RNA is encoded into single polyprotein
that is cleaved into two groups of proteins: structural proteins and nonstructural (NS)
proteins. In dengue-infected cells, structural proteins are assembled into dengue virions while
nonstructural proteins, in the form of replication complex, are involved in dengue RNA
replication. Dengue nonstructural protein (NS) consists of NS1, NS2A, NS2B, NS3, NS4A,
NS4B, and NS5. (2) NS5 is the largest protein of dengue proteins. It contains two enzymatic
domains. N-terminal, methyltransferase domain involves in 5’-RNA capping process. Cterminal, RNA-dependent RNA polymerase domain catalyzes the synthesis of viral RNA
genome. (3-5)
Due to necessity of NS5 functions in dengue RNA replication, the interactions
between host-cell factors and NS5 could have great impact on the dengue RNA replication.
Previous studies reported that host proteins interacting with NS5 were crucial for dengue
RNA replication and virus evasion host defense mechanism. (6-13) Garcia-Montalvo et al
and Yocupicio-Monroy et al reported that La protein interacted with NS5 and inhibited
dengue RNA synthesis. (8, 13) La protein interacted with NS3, NS5, 5’ UTR and 3’ UTR of
viral genomic RNA. (8) From these interactions, they were suggested that La protein was
involved in dengue genome cyclization. Moreover, in vitro RNA transcription study showed
that La protein inhibited RNA synthesis in dose dependent manner. (13) Ashour et al and
Mezzon et al reported that NS5 acts as type I interferon antagonist by binding to signal
transducer and activator of transcription 2 (STAT2). (9, 10) Polymerase domain of NS5
interacted with STAT2 and prevented STAT2 from phosphorylation, inhibiting interferon
response. Furthermore, STAT2 was degraded by dengue proteolytic process when it
interacted with precursor NS5 in polyprotein. (9) However, Khunchai et al reported that
nuclear-localized NS5 interacted with death-domain-associate protein (Daxx) and allowed
NF-κB to activate RANTES production. (12)
To investigate novel host factors interacting with dengue NS5, high-throughput
protein-protein interactions assays had been used. Recently, there were analysis of interaction
networks between host proteins and dengue proteins. (14, 15) Khadka et al reported denguehost proteins interaction networks identified through yeast two-hybrid assay. (14) They could
verify ten novel host proteins interacting with dengue NS5 by split-luciferase assay but the
role of these interactions in dengue replication were not investigated. Later, Le Breton et al
reported interaction networks of host proteins and flavivirus NS3 and NS5 by using yeast
two-hybrid assay to screen flaviviral protein NS3 and NS5 against human liver, brain, spleen
and bronchial epithelia cDNA libraries. (15) They reported 108 host proteins interacted with
either NS3 or NS5 proteins but the interactions were not yet verified. Note that there were no
common host proteins interacting with NS5 in both studies.
The studies of protein-protein interactions by yeast two-hybrid assay have
disadvantages. First, only binary interactions can be observed. Second, protein expression in
yeast may not have same protein folding and post-translational modification as in host cell,
potentially generating false positive and false negative results. To resolve this issue, tandemaffinity purification (TAP) technique was applied to isolate dengue NS5-interacting host
proteins from NS5-expressed human embryonic kidney 293T cells. While human cells
provide native-like proteins and environment, NS5 could establish interactions with host
proteins similar to dengue-infected cells.
TAP technique was first introduced by Rigaut et al in 1999. (16) TAP method is a
protein purification method using two or more combinations of affinity purification. The
fundamental of tandem affinity purification is to reduce background observed in single-step
affinity purification. After pull down of protein complex, the host proteins interacting with
the target protein can be identified by mass spectrometry. Several advantages are offered by
tandem affinity purification. (17) First, the protein complexes were isolated from host cells
where the interactions occurred in native context. Second, this assay can detect either binary
interactions or groups of protein interactions in form of complex in single experiment.
However, there are disadvantages of this method. First, the requirement of large amount
starting material is needed for detection. Second, the affinity tags could interfere with the
protein localization, function and complex formation.
In our study, dengue NS5 was tagged with TAP-tag containing streptavidin-binding
peptide and calmodulin-binding peptide at C-terminus. The starting material for tandem
affinity purification was prepared by transient, large-scale transfection in HEK 293T cell line.
The purified products from TAP assay were analyzed by 10% SDS-PAGE followed NS5interacting host proteins by Coomassie-blue staining.
Methodology
Cell lines and cultivation
Human embryonic kidney (HEK) 293T cells were used for transient large-scale transfection.
The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented
with 10% FBS, 2mM glutamine (GIBCO BRL) and 100U/ml penicillin-100 µg/ml
streptomycin solution (GIBCO BRL) at 37 °C, 5% CO2 and humidified environment. Vero
cells were used for transfection and infection test. Vero cells were cultured in minimal
essential medium (MEM) supplemented with 10% FBS, 2mM glutamine (GIBCO BRL) and
100U/ml penicillin-100 µg/ml streptomycin solution (GIBCO BRL) at 37 °C, 5% CO2 and
humidified environment.
Construction of plasmid expressing NS5-TAP
NS5-TAP gene and TAP gene were re-amplified to add stop codon into gene sequence for
proper expression in cell with designed primer pairs. Primer sequences used in this study
were NS5-TAP forward primer, CACGGTACCCGCCACCATGGGAACTGGCAACATAG
GAGAGACGCTTGG, TAP forward primer, GAGGTACCCGCCACCATGGACGAGAAG
ACCACCG and both NS5-TAP and TAP reverse primer, GACTCGAGCTATTAAAGTGCC
CCGGAGGATGAGATTTTC. The PCR reactions were achieved by Phusion® High-Fidelity
DNA Polymerase (New England Biolabs, Inc.) and performed as described in kit instruction.
The genes were cloned into pcDNA3.1/hygro+ (Invitrogen, USA), via KpnI and XhoI
restriction sites. The ligation reactions were transformed into E. coli DH5α. The recombinant
plasmids in E. coli were collected as described in kit instructions by QIAprep spin miniprep
kit (QIAGEN) and Geneaid plasmid midiprep kit (Endotoxin free) (Geneaid Biotech Ltd.,
Taiwan).
Transfection
To test NS5-TAP expression, the recombinant plasmid was transfected into Vero cell line and
HEK 293T cell line in 35-mm dishes by Lipofectamine™ 2000 (Invitrogen,USA) according to
product manual. For large-scale transient transfection, 6×106 cells of HEK 293T cell line
were seeded in 100-mm dish for 40 dishes and cultured for 16-18 hours before transfection.
The DNA complexes for 1 dish were prepared by mixing 20 µg DNA with 200 µl OptiMEM® and 50 µl 1 mg/ml PEI solution. The mixture was incubated at room temperature for
20 minutes. Then, 8 ml of Opti-MEM® was added into the mixture. After DNA complexes
preparation, the culture medium in the dish was removed and replaced with 8 ml of
transfection medium. The transfected cells were cultured for 4-6 hours. Then, the transfection
medium was removed and replaced with 11 ml DMEM medium containing 10% FBS. The
transfected cell was incubated for 48 hours under cell culture condition.
Indirect immunofluorescence staining assay for dengue NS5 protein
After 24-hour transfection, the transfected cells on cover slip were collected and washed with
1X PBS for three times. Then, the cells were fixed with 3.7% formaldehyde in 1X PBS and
incubated ten minutes at room temperature. The fixed cells were then permeabilized with 2%
Triton-X 100™ in 1x PBS and incubated for ten minutes at room temperature. The NS5
protein was stained with polyclonal rabbit anti-NS5 in 2% FBS in 1x PBS and incubated at
37 °C for one hour. The cells were washed and counter-stained with goat anti-rabbit antibody
conjugated with Alexa flour® 488 in 2% FBS in 1x PBS (with 1:2500 Hoechst 33258),
incubated for half an hour at 37 °C. The cells were washed with 1x PBS for three times and
mounted on glass slide. The stained cells were observed under fluorescent microscope.
SDS-PAGE and Western blot analysis
The assay was performed to analyze protein expression in transfected cells and purified
proteins from tandem affinity purification assay. The transfected cells was treated with 2x
reducing buffer (10 mM Tris-HCI (pH 6.8), 4% Sodium dodecyl sulfate (SDS), 20% glycerol
and 1.43 M 2-mercaptoethanol) and heated to 95 °C for 5 minutes. The lysate and purified
samples were treated with same sample volume of 2x reducing buffer and heated to 95 °C for
5 minutes. The treated sample was separated by 10% SDS-PAGE. The protein bands were
detected by Coomassie-blue staining (Imperial™ protein stain, Thermo Scientific) or further
processed for Western-blot analysis. For Coomassie-blue staining, the gel was washed twice
with deionized-distilled water and soaked with Imperial™ protein staining overnight. The
stained gel was washed repeatedly with deionized-distilled water until background of gel was
cleared. For Western-blot analysis, the proteins in gel were transferred to nitrocellulose
membrane. The membrane was blocked with 5% skim milk in 1x PBS containing 0.1%
TWEEN® 20 (1x PBS-T) on rocker at room temperature for an hour. The blocked membrane
was washed and incubated with polyclonal rabbit anti-NS5 antibody in 2% FBS in 1x PBS at
4 °C overnight. The membrane was washed and incubated with swine anti-rabbit IgG
conjugated with HRP (diluted 1:1000) in 1% FBS in 1x PBS-T on rocker at room
temperature for an hour. Then, the membrane was washed again with 1x PBS-T. The
enhanced chemiluminescence substrate was overlayed on the membrane and incubated for 1
minute to generate signals. The signals from the membrane were recorded on film.
Tandem affinity purification
To pull down NS5-TAP along with its host protein partners, tandem affinity purification was
carried out as follow. The steps were performed in cold temperature (0 - 4°C). At 48 hours
post-transfection, the transfected cells were washed with cold 1x PBS and collected with cell
scarper. The cells were lysed with 1x RIPA buffer (50 mM Tris-HCl (pH 8.0), 150 mM NaCl,
1% Triton™ X-100, 0.5% sodium deoxycholate, 0.1% SDS and 2 mM MgCl2) containing
protease inhibitors cocktail by pulse-vortexing. The lysed cell was centrifuged at 16,000 ×g
for ten minutes to precipitate and remove cell debris. The tandem affinity purification method
was modified from InterPlay® Mammalian TAP system procedure (Stratagene, USA). The
prepared lysate was added into equilibrated streptavidin resin and incubated overnight on
rotator. Then, the resin was collected by centrifugation at 1,500 ×g for 5 minutes and washed
with streptavidin washing buffer (10 mM Tris-HCl (pH 7.6), 100 mM NaCl, 0.1% Triton™ X100, and 2 mM MgCl2) for 5 minutes, repeated for 5 times. After washing, the streptavidinbounded protein was eluted with streptavidin elution buffer (10 mM Tris-HCl (pH 7.6), 100
mM NaCl, 0.1% Triton™ X-100, 2 mM MgCl2, and 2 mM Biotin) and rotated for 3 hours.
The tube was centrifuged 1500 ×g for 5 minutes. The supernatant part was collected. The
elution step was repeated. The streptavidin-elution sample was added with same elution
volume of steptavidin elution supplement buffer (10 mM Tris-HCl (pH 7.6), 100 mM NaCl,
0.1% Triton™ X-100, 2 mM imidazole, 2 mM MgOAc2, and 4 mM CaCl2). The mixture of
streptavidin elution and supplement solution was added into equilibrated calmodulin resin.
The tube was rotated overnight. Then, the resin was collected by centrifugation at 1,500 ×g
for 5 minutes and washed with calmodulin binding buffer (10 mM Tris-HCl (pH 7.6), 100
mM NaCl, 0.1% Triton™ X-100, 1 mM imidazole, 1 mM MgOAc2, and 2 mM CaCl2) 5
minutes, repeated for 5 times. After washing, the resin was added with calmodulin elution
buffer (10 mM Tris-HCl (pH 7.6), 100 mM NaCl, 0.1% Triton™ X-100, 1 mM imidazole, 1
mM MgOAc2, and 50 mM CaCl2) and rotated for 3 hours. The tube was centrifuged 1500 ×g
for 5 minutes. The supernatant was collected. The elution step was repeated once.
Results
Expression of NS5-TAP in mammalian cell
The Vero cell line and HEK 293T cell line were transfected with pcDNA-NS5-TAP
to test the expression of NS5-TAP. The NS5-TAP protein was detected by indirect
immunofluorescence assay. The NS5-TAP protein was expressed in both cells and the
localization of NS5-TAP protein was observed in nucleus of the cells similar to NS5 detected
in dengue-virus infected cells (Figure 1). This result suggests that NS5-TAP behaves similar
to dengue NS5 during infection and can be used for affinity purification to identify relevant
interacting host proteins.
Figure 1 Immunofluorescent staining of dengue NS5 protein in mammalian cells
The Vero cell line and HEK 293T cell line were transfected with pcDNA-NS5-TAP to express NS5-TAP. The
Vero cells were infected with dengue virus 2 strain 16681 at MOI 1.0 as positive control and mock-infected as
negative control. After 24 hours, the cells were stained with polyclonal rabbit anti-NS5 antibody, followed by
goat anti-rabbit IgG conjugated with Alexa 488 and observed by fluorescent microscopy at 20x magnification.
NS5-TAP and its host protein partners pull down by tandem affinity purification
The NS5-TAP and TAP cell lysate were applied to streptavidin resin. Then, eluted
samples from streptavidin resin were applied to calmodulin resin. The samples from each
purification step were collected and prepared for Western-blot analysis. In figure 2, the
purified NS5-TAP protein was observed in streptavidin elution sample, streptavidin elution
with supplement buffer sample and first calmodulin elution sample. The NS5-TAP protein
was observed in only NS5-TAP-transfected HEK 293T cell samples but not in TAPtransfected HEK 239T cell samples (data not shown). The result showed that the NS5-TAP
protein was bound to streptavidin resin and can be eluted by 2 mM Biotin. Later, the biotineluted NS5-TAP protein was applied into calmodulin resin. The calmodulin eluted sample
band was hardly observed by Western-blot analysis. This showed that calmodulin elution
buffer contained 50 mM EGTA could poorly elute the NS5-TAP protein from calmodulin
resin.
To obtain the NS5-TAP protein and its host protein partners from calmodulin resin,
the resin was treated with one volume of 2x reducing buffer. In figure 3A, The NS5-TAP
protein was observed in NS5-TAP-transfected HEK 293T cell lysate, the starting sample, and
boiled calmodulin resin sample, final product from TAP assay. The result from Western-blot
analysis showed that NS5-TAP protein could be purified by tandem affinity purification.
There was no protein band detected from TAP sample which were negative control. In figure
3B, the result from Coomassie-blue staining suggested that NS5-TAP protein, 111.6kilodalton band, was pulled down along with other host proteins which could be observed 5
major bands with estimated sizes of 45, 50, 60, 68, and 90 kilodaltons. These host proteins
will be further studied and analyzed by mass spectrometry. The TAP sample was observed
only light band at around 110 kilodaltons and it was not recognized by rabbit anti-NS5
antibody in Western-blot analysis (Figure 3A). This result suggested that the observed
purified TAP sample band is background protein from our experiment.
Figure
2 Western-blot analysis of tandem affinity purification of NS5-TAP lysate
Discussion and
conclusions
The samples from each purification step were prepared for Western-blot analysis by mixing 10 µl samples with
In our study, tandem affinity purification was performed. From HEK 293T expressing
10 µl 2x reducing buffer and heated at 95 ⁰C for 5 minutes. The membrane was probed with polyclonal rabbit
NS5-TAP,
were followed
able to detect
five
NS5-interacting
protein
bandsThe
at signal
approximately
45,by
50,
anti-NS5we
antibody,
by swine
anti-rabbit
IgG conjugated
with HRP.
was developed
60, 68
and 90chemiluminescence
kilodaltons. While
the identities
of these
proteins
not
yet identified,
their
enhanced
substrate.
The NS5-TAP
band (111.6
kDa)were
was as
indicated
on the right.
approximate molecular weights match with the host proteins identified from previous reports.
These proteins could be COP9 protein (52.4 kilodaltons), DDX5 protein (69.1 kilodaltons)
and APOB protein (92.3 kilodaltons). (14) Interestingly, there are two observed proteins (at
about 45 and 60 kilodaltons) that have never been reported and these proteins might be novel
dengue NS5- interacting proteins that might be involved in dengue replication.
The host proteins from the observed bands will be identified by mass spectrometry.
The identified host proteins should be verified. First, the NS5-host interactions can be
confirmed by colocalization and immunoprecipitation assay in dengue-virus infected cell.
After the interactions were verified, RNA interference techniques would be used to determine
the roles of the host proteins in dengue replication in infected cells. In addition, tandem
affinity purification could be applied to other target cells for dengue virus, for example
hepatocytes, monocytes, and macrophage. The results from NS5-host interactions studies in
other dengue-target cells will lead to identification of cell-specific host factors.
In conclusion, NS5-interacting host proteins could be pulled down by tandem affinity
purification. The observed protein bands from Coomassie-blue stained gel will be further
identified by mass spectrometry. The result from this study would provide novel dengue
NS5-interacting host proteins that might have important roles in dengue replication. The
knowledge from this study will give in-depth details of the roles of host proteins in dengue
replication process. This information could lead to novel targets for anti-dengue drug
development.
(A)
(B)
Figure 3 Western-blot analysis and Coomassie-blue staining of TAP-purified NS5-TAP and TAP sample
(A) Western blot analysis. The membrane was probed with polyclonal rabbit anti-NS5 antibody, followed by
swine anti-rabbit IgG conjugated with HRP. The signal was developed by enhanced chemiluminescence
substrate. (B) The NS5-TAP protein complex was purified by tandem affinity purification and resolved by
SDS-PAGE stained with Coomassie-blue. Lane M represented protein ladder, which contained various protein
sizes as indicated in kDa on the left. The NS5-TAP band (111.6 kDa) was as indicated on the right. The NS5References
interacting host protein bands were indicated by open arrow on the right
1. Halstead SB. Dengue. Lancet. 2007 Nov 10;370(9599):1644-52.
2. Kapoor M, Zhang L, Mohan PM, Padmanabhan R. Synthesis and characterization of an infectious dengue
virus type-2 RNA genome (New Guinea C strain). Gene. 1995 Sep 11;162(2):175-80.
3. Tan BH, Fu J, Sugrue RJ, Yap EH, Chan YC, Tan YH. Recombinant dengue type 1 virus NS5 protein
expressed in Escherichia coli exhibits RNA-dependent RNA polymerase activity. Virology. 1996 Feb
15;216(2):317-25.
4. Egloff MP, Benarroch D, Selisko B, Romette JL, Canard B. An RNA cap (nucleoside-2'-O-)methyltransferase in the flavivirus RNA polymerase NS5: crystal structure and functional characterization.
EMBO J. 2002 Jun 3;21(11):2757-68.
5. Zhou Y, Ray D, Zhao Y, Dong H, Ren S, Li Z, et al. Structure and function of flavivirus NS5
methyltransferase. J Virol. 2007 Apr;81(8):3891-903.
6. Johansson M, Brooks AJ, Jans DA, Vasudevan SG. A small region of the dengue virus-encoded RNAdependent RNA polymerase, NS5, confers interaction with both the nuclear transport receptor importinbeta and the viral helicase, NS3. J Gen Virol. 2001 Apr;82(Pt 4):735-45.
7. Brooks AJ, Johansson M, John AV, Xu Y, Jans DA, Vasudevan SG. The interdomain region of dengue
NS5 protein that binds to the viral helicase NS3 contains independently functional importin beta 1 and
importin alpha/beta-recognized nuclear localization signals. J Biol Chem. 2002 Sep 27;277(39):36399-407.
8. Garcia-Montalvo BM, Medina F, del Angel RM. La protein binds to NS5 and NS3 and to the 5' and 3' ends
of Dengue 4 virus RNA. Virus Res. 2004 Jun 15;102(2):141-50.
9. Ashour J, Laurent-Rolle M, Shi PY, Garcia-Sastre A. NS5 of dengue virus mediates STAT2 binding and
degradation. J Virol. 2009 Jun;83(11):5408-18.
10. Mazzon M, Jones M, Davidson A, Chain B, Jacobs M. Dengue virus NS5 inhibits interferon-alpha
signaling by blocking signal transducer and activator of transcription 2 phosphorylation. J Infect Dis. 2009
Oct 15;200(8):1261-70.
11. Rawlinson SM, Pryor MJ, Wright PJ, Jans DA. CRM1-mediated nuclear export of dengue virus RNA
polymerase NS5 modulates interleukin-8 induction and virus production. J Biol Chem. 2009 Jun
5;284(23):15589-97.
12. Khunchai S, Junking M, Suttitheptumrong A, Yasamut U, Sawasdee N, Netsawang J, et al. Interaction of
dengue virus nonstructural protein 5 with Daxx modulates RANTES production. Biochem Biophys Res
Commun. 2012 Jun 29;423(2):398-403.
13. Yocupicio-Monroy M, Padmanabhan R, Medina F, del Angel RM. Mosquito La protein binds to the 3'
untranslated region of the positive and negative polarity dengue virus RNAs and relocates to the cytoplasm
of infected cells. Virology. 2007 Jan 5;357(1):29-40.
14. Khadka S, Vangeloff AD, Zhang C, Siddavatam P, Heaton NS, Wang L, et al. A physical interaction
network of dengue virus and human proteins. Mol Cell Proteomics. 2011 Sep 12.
12. Khunchai S, Junking M, Suttitheptumrong A, Yasamut U, Sawasdee N, Netsawang J, et al. Interaction of
dengue virus nonstructural protein 5 with Daxx modulates RANTES production. Biochem Biophys Res
Commun. 2012 Jun 29;423(2):398-403.
13. Yocupicio-Monroy M, Padmanabhan R, Medina F, del Angel RM. Mosquito La protein binds to the 3'
untranslated region of the positive and negative polarity dengue virus RNAs and relocates to the cytoplasm
of infected cells. Virology. 2007 Jan 5;357(1):29-40.
14. Khadka S, Vangeloff AD, Zhang C, Siddavatam P, Heaton NS, Wang L, et al. A physical interaction
network of dengue virus and human proteins. Mol Cell Proteomics. 2011 Sep 12.
15. Le Breton M, Meyniel-Schicklin L, Deloire A, Coutard B, Canard B, de Lamballerie X, et al. Flavivirus
NS3 and NS5 proteins interaction network: a high-throughput yeast two-hybrid screen. BMC Microbiol.
2011;11:234.
16. Rigaut G, Shevchenko A, Rutz B, Wilm M, Mann M, Seraphin B. A generic protein purification method
for protein complex characterization and proteome exploration. Nat Biotechnol. 1999 Oct;17(10):1030-2.
17. Xu X, Song Y, Li Y, Chang J, Zhang H, An L. The tandem affinity purification method: an efficient
system for protein complex purification and protein interaction identification. Protein Expr Purif. 2010
Aug;72(2):149-56.