Data S1: Supporting Experimental Procedures
Generation of Chara wheat population
The grain of a commercial hexaploid bread wheat cultivar Chara (AWB Seeds Ltd.,
Australia) was used for heavy ion irradiation conducted by the RIKEN RI-beam facility in
Japan (Ryuto et al., 2008). Grains in sealed petri dishes (~1000 grains per petri dish) were
sent to the RIKEN RI-beam facility through Australian Quarantine and Inspection Service.
Totally, ~9500 grains were treated with a carbon (C) ion beam at 50 Gy (23 KeV/m) and
~5500 grains were treated with a Neon (Ne) ion beam at 50 Gy (63 KeV/mm). Irradiated
wheat M1 grains were grown in grasshouses (24oC day and 18oC night) under natural light at
CSIRO Black Mountain, Canberra. About 76% C-treated and 67% Ne-treated M1 grains
produced M2 grains. Other M1 grains did not geminate, produced yellow plants or died
before producing seeds. For growing M2 plants, 1 seed from each 6900 C-treated M2 lines
and 1 to 3 seeds from each 4200 Ne-treated M2 lines were grown in the glasshouses above.
Leaf sections (~4 cm long) from all M2 plants (~6700 C-treated and ~9100 Ne-treated) at 5
leaf stage were collected, freeze-dried (freezer FTS systems, Stone Ridge, New York) and
used for the DNA preparation as described (Blundell et al., 2010). DNAs from M2 plants
were stored at -20oC freezers and used for the detection of allelic variations. M3 seeds,
harvested from each M2 plants (~6550 C-treated and 8800 Ne-treated), were stored at a 4oC
room and used for further confirmation of allelic variations and crossing.
1
Generation of SBEIIa and SBEIIb markers for screening for allelic variations
SBEIIa and SBEIIb genome specific markers
For SBEIIa gene, sequence polymorphism observed in the exon 13 to 14 region of wheat
SBEIIa gene was exploited to generate a PCR-based genome specific cleaved amplified
polymorphic (CAP) marker. The product amplified by the primers, (AR2aI13genomeF2: 5’GTACAATTTTACCTGATGAGATCATGG-3’
and
AR2aI13
R2:
5’-
CTTCAGGAATGGATACAGCATCAG-3’, following a double digestion with the restriction
enzymes Mse1 and Ssp1yielded four products, a 207 bp product from the A genome, a 147 bp
product from the B genome and a 99 bp and a 108 bp products from the D genome, which
was confirmed using chromosome engineered lines of Chinese Spring. For SBEIIb gene, the
genome specific marker, AR2b19cF/AR2b23cR described in Regina et al 2005 was used.
The PCR product using this primer pair when digested with the restriction enzyme Rsa1
yielded three products, an 85bp product from the A genome, a 152 bp product from the B
genome and a 252 bp from the D genome.
Generation of Co-dominant markers for the SNP mutant lines 6-60 and 7-25
Co-dominant PCR-based genetic markers were developed for the B genome null line 6-60 and the D
genome altered affinity line, 7-25 to enable PCR based tracking of these polymorphisms in
segregating populations. The G to A SNP at the exons 6/7 splice junction in the line 6-60 (Supporting
Table 1) resulted in the absence of a Fok1 restriction site. This difference was exploited to generate a
CAP
marker that involved PCR amplification of the exons 6-7 region using the primer pairs
AR2aBI6F2
(5’-CATTTTTTGGTAGAACCTTTG-3’)
and
AR2aBI7R
(5’-
ATCCATCCGTATCTAGAAAAT 3’), followed by digestion of the products with the restriction
enzyme Fok1. This yielded DNA fragments of about 245 bp from line 6-60 and about 138 bp from the
wild-type (Sunstate) as observed by gel electrophoresis (Supporting Figure 2a). A restriction enzyme
2
map generated from the nucleotide sequence of the exon 21/22 region of SBEIIa-D from the wild-type
and line 7-25 revealed changes in the restriction sites due to a C to T polymorphism in 7-25
(Supporting Table 1). This change was utilised to generate a CAPS marker for 7-25.
PCR
amplification of the exon 21/22 region was carried out using the primers AR2aDex21_22F (5’
CTGTTGTAGCCATAGGAAGG-3’) and AR2aex21_22R (5’GAGCGCTCACCAACAAGCTACC3’). The digestion of the PCR products with the restriction enzyme Mly1 resulted in a unique ~229 bp
fragment from the line 7-25 and a 141bp fragment from the wild-type (Supporting Figure 2b).
Protein expression analyses
Affinity gel electrophoresis and immunoblotting
Soluble proteins were extracted by homogenising the isolated endosperms (15 days post
anthesis) in 50 mM phosphate buffer, pH 7.5 containing 5 mM EDTA, 5 mM DTT, 0.4%
protease inhibitor cocktail and 20% glycerol. After centrifugation at 14,000 g for 10 min the
supernatant was used for the gel electrophoresis. Protein concentration in the extracts was
estimated, using Coomassie PlusTM Protein Assay Reagent. Protein extracts (20 µg) were
loaded onto a non-denaturing polyacrylamide gel. The resolving component of the gel was a
6 % non-denaturing gel containing 10% glycerol with 0.15% of β-limit dextrin immobilised
within the gel structure, while stacking gel was polysaccharide-free. Gels were run at 4 ºC at
constant current of 20 mA per gel and max. voltage of 200 volts. For immunochemical
detection of proteins, following electrophoresis the proteins were transferred to nitrocellulose
membrane using a TE 70 PWR semi-dry transfer unit (Amersham Biosciences). The transfer
buffer contained 39 mM glycine, 48 mM Tris, 0.0375% SDS and 20% methanol. Transfer
was carried out for 1-1.5 h with a constant current of 0.8 mA/ cm2. The membrane was
blocked with 5% skim milk prior to western blotting using primary rabbit polyclonal
antibody specific for wheat SBE IIa (Rahman et al., 2001) or SBEIIb (Regina et al., 2005).
3
Starch branching enzyme activity assay
SBE activity assay was carried out as described in Regina et al., 2006. Following separation
of proteins on a 5% non denaturing polyacrylamide gel, the gel was washed twice in 50 mM
HEPES, pH 7.0 containing 10% glycerol and incubated at room temperature in a reaction
mixture consisting of 50 mM HEPES, pH 7.4, 50 mM glucose-1-phosphate, 2.5 mM AMP,
10% glycerol, 50 U phosphorylase a, 1 mM DTT, and 0.08% maltotriose for 16 h. The bands
were visualized with a solution of 0.2% (W/V) I2 and 2% KI.
2D-affinity electrophoresis and calculation of dissociation constants
2D- affinity electrophoresis was carried out as described by Kosar-Hashemi et al., 2006. Non
denaturing gels were used in both dimensions, however for second dimension an affinity gel
containing varying levels of β-limit dextrin was used. The dissociation constant was
calculated essentially as described in (Kosar-Hashemi et al., 2006).
Generation of segregating populations of SBEIIa and SBEIIb variants
All plants are grown in pots under controlled environmental conditions in the glasshouse at a
minimum temperature of 15°C and a maximum temperature of 25°C.
a) Cross 08/b-18 (A1D1) X 6-60 (B2n), designated as CS1.
Screening of 288 seeds by PCR using the AR2aI13genomeF2/ AR2aI13genomeR2 marker
for detecting the variants in SBEIIa in the A and D genomes coming from the 08/b-18 parent
and using the 6-60 CAPS co dominant marker for detecting the SNP in the B genome coming
4
from the 6-60 parent), together with screening of 192 F2 seeds by microscopy for starch
granules with altered morphology did not identify any homozygous triple nulls from this
cross. However one confirmed heterozygous line, A1B2nhetD1-G12 which was homozygous
double null for the SBEIIa-A and –B genes and heterozygous for the SBEIIa-D allele was
grown and tested for segregation. Five out of 29 segregating seeds from this plant were
found to have the triple null genotype as shown by immunoblotting. Out of these 5 CS1
triple null lines , only 4 survived to seed set. Out of these four, only one line, CS1-G12/15
appeared to be better in seed setting compared to other CS1 lines and hence this line was
taken forward for further characterisation.
b) Cross 6-60 (B2n) X 08/i-G3 (A1D2), designated as CS2.
Four triple null seeds, designated CS2-F11, CS2-D8, CS2-E6 and CS2-E11 were identified
from this cross through screening a total of 288 F2 seeds using the AR2aI13genomeF2/
AR2aI13genomeR2 marker for detecting the deletion in SBEIIa in the A and D genomes
coming from the HIB parent, 08/i-G3. The SNP in the B genome from the sodium azide
parent, 6-60 was detected using the 6-60 CAPS co dominant marker. The plants produced
from the CS2-F11 and CS2-E6 seeds showed normal growth and development, while the
plant CS2-E11 died at the seedling stage, and plant CS2-D8 had a late flowering phenotype.
The lack of SBEIIa expression in each of 4 endosperms for plants CS2-F11 and CS2-E6
confirmed them to be homozygous triple null of SBEIIa. Analysis of 10 F3 seeds from a
heterozygous line from this cross, CS2-C6, also identified one triple null seed, CS2-C6.4,
which is also confirmed to be homozygous for lack of SBEIIa expression. The line CS2-F11,
CS2-E6 and CS2-C6.4 are selected for further characterisation.
5
c) Cross 7-25 (D2a) X 08/h-92 (A1B2), designated CS3.
Nineteen seeds with varying degrees of altered starch granule morphology were identified
from a screening of 192 F2 seeds through microscopy. These seeds were germinated and the
plants screened by PCR using the AR2aI13genomeF2/ AR2aI13genomeR2 marker for
detecting deletions in SBEIIa in the A and B genomes coming from the 08/h-92 HIB parent
and the 7-25 CAPS co dominant marker to detect the SNP in the D genome coming from the
Na azide parent 7-25. Out of the 19 lines tested, four plants, designated CS3-C3, CS3-C10,
CS3-A2 and CS3-F9, were identified to be homozygous triple null genotype of these plants.
d) Cross 08/mm-M7-E11 (A2D2) x 6-60 (B2n), designated C10
Screening of 288 F2 seeds from this cross using the SBEIIa genome specific marker,
AR2aI13genomeF2/ AR2aI13genomeR2 identified one triple homozygous null seed of the
A2B2D2 genotype, designated CS10-C12.
Starch characterisation
Starch extraction
Extraction of starch from the wheat grains was carried by the wet gluten ball method as
described in Regina et al., (2006).
Amylose content estimation
Amylose content was estimated from purified starch by two different methods of 1)
iodometric method and ii) gel permeation chromatography (GPC) using sepharose CL-2B
6
column, both methods as described by (Regina et al., 2006). ANOVA of amylose content
estimated by iodometric method was carried out using GentStat 16th Edition.
Protein content estimation
Total nitrogen was analysed by the Dumas combustion method using an automated analyser.
A factor of 6.25 was used to convert nitrogen content to protein.
Microscopic analyses of starch granules
Purified starch suspension in water was visualised under both polarised and normal light
using a Leica-DMR compound microscope to determine the starch granule morphology and
the extent of birefringence. Scanning electron microscopy was carried out using ZEISS EVO
LS15 scanning electron microscope. Purified starch was sputter-coated with gold particles
and scanned at room temperature.
Chain length distribution of starch
Fluorophore assisted carbohydrate electrophoresis (FACE) was carried out to analyse the
chain distribution pattern of isoamylase debranched starches using a P/ACE 5510 capillary
electrophoresis system (Beckman iwth argon-LIF detection as previously described (O'Shea
et al., 1998).
7
Molecular size distribution analysis by size exclusion-high performance liquid
chromatography (SE-HPLC)
SE-HPLC of isoamylase debranched starches was carried out essentially as described in
Regina et al., 2012. To 1 mL of isoamylase-treated starch solution, approximately 0.2 g of
ion-exchange resin (BioRad AG™ 501-X8, Hercules, USA) was added and incubated for 30
min at room temperature while mixing using a rotor. Following incubation, the mixture was
spun at 14000 g for 5 min. The supernatant was filtered through 0.45 µm PVDF filters into
HPLC vials. A Waters System configured with a 600 Series Controller, a 717plus
autosampler and a 2414 Refractive Index Detector was used for the analysis. A 20 µL aliquot
was used for injection. Ammonium acetate buffer (0.05 M; pH 4.7) was used as mobile phase
at a flow rate of 0.7 mL min-1. Separation was performed through an Ultrahydrogel™ 250
column (7.8 mm x 300 mm, Waters, Japan) maintained at 60°C during operation.
Resistant starch content
The resistant starch content of the barley starch granule preparations was determined using an
in vitro method quantitatively validated using in vivo data from human ileostomates studies
(Bird 2011).
References in the supporting experimental procedures
Bird, AR., Usher, S., May, B., Topping, DL and Morell, MK (2012). Resistant Starch –
Measurement, Intakes and Dietary Targets. In: Dietary Fiber and Health. Eds Susan
Cho and Nelson Almeida. Pages 41-56.
Kosar-Hashemi, B., Irwin, J.A., Higgins, J., Rahman, S.U. and Morell, M.K. (2006) Isolation,
identification and characterisation of starch-interacting proteins by 2-D affinity
electrophoresis. Electrophoresis 27, 1832-1839.
8
O'Shea, M.G., Samuel, M.S., Konik, C.M. and Morell, M.K. (1998) Fluorophore-assisted
carbohydrate electrophoresis (FACE) of oligosaccharides: efficiency of labelling and
high-resolution separation. Carbohydr. Res. 307, 1-12.
Regina, A., Kosar-Hashemi, B., Li, Z.Y., Pedler, A., Mukai, Y., Yamamoto, M., Gale, K.,
Sharp, P., Morell, M.K. and Rahman, S. (2005) Starch branching enzyme IIb in wheat
is expressed at low levels in the endosperm compared to other cereals and encoded at
a non-syntenic locus. Planta 222, 899-909.
Regina, A., Bird, A., Topping, D., Bowden, S., Freeman, J., Barsby, T., Kosar-Hashemi, B.,
Li, Z.Y., Rahman, S. and Morell, M. (2006) High-amylose wheat generated by RNA
interference improves indices of large-bowel health in rats. Proc. Natl. Acad. Sci. U.
S. A. 103, 3546-3551.
Regina, A., Blazek, J., Gilbert, E., Flanagan, B.M., Gidley, M.J., Cavanagh, C., Ral, J.-P.,
Larroque, O., Bird, A.R., Li, Z. and Morell, M.K. (2012) Differential effects of
genetically distinct mechanisms of elevating amylose on barley starch characteristics.
Carbohydr. Polym. 89, 979-991.
9