Java Project 2: DNA Analysis
Students will write a program that uses arrays and files to analyze
DNA sequences and determine if they represent proteins.
Special thanks to Stuart Reges and Marty Stepp of UW for use of this assignment.
Also thanks to Brett Wortzman of Issaquah High School for sharing the project online.
I.
Background
Deoxyribonucleic acid (DNA) is a complex biochemical macromolecule that carries genetic information
for cellular life forms and some viruses. DNA is also the mechanism through which genetic information
from parents is passed on during reproduction. DNA consists of long chains of chemical compounds
called nucleotides. Four nucleotides are present in DNA: Adenine (A), Cytosine (C), Guanine (G), and
Thymine (T). Certain regions of the DNA are called genes. Most genes encode instructions for building
proteins (they're called "protein-coding" genes). These proteins are responsible for carrying out most of
the life processes of the organism. Nucleotides in a gene are organized into codons. Codons are groups
of three nucleotides and are written as the first letters of their nucleotides (e.g., TAC or GGA). Each codon
uniquely encodes a single amino acid, a building block of proteins.
The sequences of DNA that encode proteins occur between a start codon (which we will assume to be
ATG) and a stop codon (which is any of TAA, TAG, or TGA). Not all regions of DNA are genes; large
portions that do not lie between a valid start and stop codon are called intergenic DNA and have other
(possibly unknown) function. Computational biologists examine large DNA data files to find patterns and
important information, such as which regions are genes. Sometimes they are interested in the
percentages of mass accounted for by each of the four nucleotide types. Often high percentages of
Cytosine (C) and Guanine (G) are indicators of important genetic data.
In this assignment, you will write a program the reads named nucleotide sequences from an input file and
performs analysis on the sequences. You will perform several calculations and analyses with the end goal
of determining whether or not the given nucleotide sequence represents a protein. The results will be
output to a file, not to the console.
II.
Details
A. Behavior
i. Program Operation
Your program should being by welcoming the user and providing a brief description of the
computations and analysis the program will perform. You will then prompt the user for an input file
and an output file (see below for required file formats). For each nucleotide sequence in the input
file, your program will compute and output the following:

the number of each nucleotide (A, C, G, T) in the sequence

the percentage of the sequence’s total mass accounted for by each nucleotide
Page 1 of 4

the list of codons present in the sequence

whether or not this sequence represents a protein (according to our rules)
For our purposes, a nucleotide sequence is a protein gene if:

it begins with a valid start codon (ATG),

it ends with a valid stop codon (TAA, TAG, or TGA),

it contains at least 5 codons total (including the start and stop codons), and

Cytosine (C) and Guanine (G), combined, account for at least 30% of the sequence’s mass
Note that these are not the actual constraints used by computational biologists to identify proteins;
they are approximations for our assignment.
The masses for each nucleotide, used for calculating the mass percentages, are as follows:

Adenine (A) – 135.128 g/mol

Thymine (T) – 125.107 g/mol

Cytosine (C) – 111.103 g/mol

Junk (-)

Guanine (G) – 151.128 g/mol
– 100.000 g/mol
ii. Input File Format
Input files for your DNA program will consist of a series pairs of lines. The first line in each pair will
be a name, and the second will be a nucleotide sequence. You can assume that all input files will
contain an even number of lines and will follow this format. Nucleotide sequences will consist of a
series of A’s, C’s, G’s, and/or T’s (either upper- or lower-case). Nucleotide sequences can also
contain dashes (‘-‘) which represent “junk” sections of the sequence. These are not nucleotides, and
should be ignored when listing codons, but they do contribute mass to the sequence.
iii. Output File Format
For each nucleotide sequence in the input file, you should print out the name of the sequence and
the nucleotides it contains. Although the input file can include either upper- or lower-case letters,
your output should be entirely in upper-case. You should then output the information outlined
above (nucleotide counts, mass percentages, codons, and whether or not it is a protein). For the
nucleotide counts and mass percentages, you should output the values in A, C, G, T order. You
must match the output format shown in the sample exactly.
B. Implementation Details
You must use arrays to track the various types of data you compute for each sequence. In particular, you
should use arrays to keep track of the nucleotide counts, the mass percentages, and the codon list. You
will use array traversals to compute each piece of data from some the others. These transformations will
include:

from the original nucleotide sequence to nucleotide counts

from nucleotide counts to mass percentages

from the original nucleotide sequence to a codon list
Page 2 of 4
Your output should round the mass percentages and the total mass of the sequence to one decimal
place. You can do this using either the printf method on PrintStream or the Math.round method.
Look up either of these in the Java API to learn more about them.
As always, your program should exhibit good functional decomposition, show good style, and be welldocumented. Make sure that your main method is a concise summary of your program’s behavior, and
that you use methods (with parameters and return values) to reduce redundancy and make your
program clear and readable. In addition, you should make good use of class constants in your program.
Remember that class constants should be used to eliminate “magic numbers” as well as increase program
readability. Take care to use class constants anywhere you are using a number that has a specific
meaning.
III.
Input/Output File Samples
A. Sample Input File
cure for cancer protein
ATGCCACTATGGTAG
captain picard hair growth protein
ATgCCAACATGgATGCCcGATAtGGATTgA
bogus protein
CCATt-AATgATCa-CAGTt
B. Sample Output File
Region Name:
Nucleotides:
Nuc. Counts:
Total Mass%:
Codons List:
Is Protein?:
cure for cancer protein
ATGCCACTATGGTAG
[4, 3, 4, 4]
[27.3, 16.8, 30.6, 25.3] of 1978.8
[ATG, CCA, CTA, TGG, TAG]
YES
Region Name:
Nucleotides:
Nuc. Counts:
Total Mass%:
Codons List:
Is Protein?:
captain picard hair growth protein
ATGCCAACATGGATGCCCGATATGGATTGA
[9, 6, 8, 7]
[30.7, 16.8, 30.5, 22.1] of 3967.5
[ATG, CCA, ACA, TGG, ATG, CCC, GAT, ATG, GAT, TGA]
YES
Region Name:
Nucleotides:
Nuc. Counts:
Total Mass%:
Codons List:
Is Protein?:
bogus protein
CCATT-AATGATCA-CAGTT
[6, 4, 2, 6]
[32.3, 17.7, 12.1, 29.9] of 2508.1
[CCA, TTA, ATG, ATC, ACA, GTT]
NO
Page 3 of 4
IV.
Grading Scheme/Rubric
Functional Correctness (Behavior)
Program greets the user and displays a description on
startup
Program prompts the user for input and output files
Input is read from input file, not from console
Output is produced in output file, not on console
Output format matches specification
Program prints name of sequence and list of
nucleotides
Program produces nucleotide counts
Program produces mass percentages
Program produces codon list
Program determines if sequence is a protein
Total
1 point
1 point
1 point
1 point
2 points
2 points
4 points
4 points
4 points
4 points
24 points
Technical Correctness (Implementation)
main is a concise summary of program behavior
Program uses good procedural decomposition,
including parameters and return values
Arrays are used to track data throughout program
Arrays are traversed properly to perform
transformations
Class constants are used where appropriate
Program continues to function when constant values
are changed
Program uses good style and is well-documented
Total
1 point
3 points
Total
40 points
2 points
2 points
2 points
2 points
4 points
16 points
Page 4 of 4