DNA Test – Study Guide KEY
1. Explain the research of the following scientists:
a. Griffith: worked with pneumonia bacteria and mice to track how
infection occurs. Results: Harmless bacteria that were exposed to heatkilled harmful bacteria were transformed to harmful bacteria.
b. Avery: Used enzymes to break down pneumonia bacteria. Results: DNA
is the transforming factor that causes infection.
c. Hershey and Chase: Worked with bacteriophages (viruses that infect
bacteria only). Results: DNA from virus is what causes viral infections.
d. Franklin and Wilkins: Used X-Ray diffraction to take photos of DNA.
e. Watson and Crick: Credited with discovering DNA double helix structure
since they could analyze X-ray diffraction photos.
f. Chargaff: Discovered rules of base pairing. A=T, G=C
2. What is the role of DNA?
The role of DNA is to store and transfer genetic information like a library.
3. What is a nucleotide and what are the three parts to it?
A nucleotide is a monomer of a nucleic acid (DNA and RNA). The three parts of
a nucleotide are the 5-carbon sugar, phosphate group, and nitrogenous base.
4. What two nitrogenous bases are purines? Pyrimidines?
Purines = Adenine and Guanine
Pyrimidines = Thymine and Cytosine
5. List the steps to DNA replication.
1. Helicase breaks the hydrogen bonds between base pairs and “unzips” DNA.
2. DNA polymerase adds new DNA nucleotides to DNA template strands.
3. DNA polymerase releases once it reaches the end of the DNA strands. Create
two semi-conservative DNA strands.
6. What do the following enzymes do during DNA replication?
a. Helicase: Breaks hydrogen bonds between nitrogenous base pairs,
“unzips” DNA strands.
b. DNA polymerase: Adds new DNA nucleotides to template strands of DNA.
7. What are the three differences between DNA and RNA?
DNA has a deoxyribose sugar. RNA has a ribose sugar.
DNA is double stranded. RNA is single stranded.
DNA uses thymine. RNA used uracil.
8. What are the three types of RNA used during protein synthesis and explain their
function?
mRNA – messenger RNA, recipe to make proteins
rRNA – ribosomal RNA, found in ribosomes
tRNA – transfer RNA, transfers amino acids to ribosomes
9. What is a codon and where is it found?
A codon is a 3 letter sequence found in mRNA.
10. What is an anti-codon and where is it found?
An anti-codon is a 3 letter sequence found in tRNA.
11. What is transcription and where does it take place?

Takes place in the nucleus

Process by which DNA codes for mRNA
12. What needs to be added to the mRNA strand before it can leave the nucleus and go
to a ribosome in the nucleus?
A cap and tail needs to be added to the mRNA strand before it leaves the
nucleus.
13. What is transcription and where does it take place?

Takes place on a ribosome in the nucleus

Process by which mRNA codes for a protein
14. Write the mRNA strand for this DNA strand: TACGGCATGAACGTAGCTAGCACT
AUG-CCG-UAC-UUG-CAU-CGA-UCG-UGA
15. What are the amino acids that correspond to the mRNA strand you just made?
Met-Pro-Tyr-Leu-His-Arg-Ser-STOP
1.