intestinal failure
a nd t r a nspl a n tat ion
‘PENNY WISE - POUND FOOLISH?’
a m roskott
The studies in this thesis/the publication of this thesis have been carried out with financial
support from the Dutch Maag Lever Darm Stichting (MLDS), the Dutch Transplant Society
(Nederlandse Transplantatie Vereniging), the Dutch Society of Gastroenterology (Nederlandse
Vereniging voor Gastroenterologie en de Sectie Experimentele Gastroenterologie), the Stichting
Wetenschappelijk Onderzoek Arts-assistenten Heelkundige Specialismen, the Jan Kornelis De
Cock foundation, Astellas (the Astellas Transplantational Research Prize), the Transplant Society
(TTS), the University of Groningen, the University Medical Center Groningen, the SBOH and the
Innovatief Actie Programma Groningen (IAG-2).
All support is gratefully acknowledged
© A. M. Roskott, 2014
All rights are reserved. No parts of this publication may be reproduced, stored in a retrieval
system, or transmitted, in any form or by any means – electronic, mechanical, photocopy,
recording or otherwise – without prior permission of the author or the corresponding journal.
ISBN13: 978-90-367-7037-8 [druk]
ISBN13: 978-90-367-7036-1 [digital]
Cover design by Douwe Oppewal
Lay out by Douwe Oppewal
Printed by NetzoDruk, Groningen
Intestinal failure and transplantation
‘penny wise - pound foolish?’
Proefschrift
ter verkrijging van de graad van doctor aan de
Rijksuniversiteit Groningen
op gezag van de
rector magnificus prof. dr. E. Sterken
en volgens besluit van het College voor Promoties.
De openbare verdediging zal plaatsvinden op
woensdag 18 juni 2014 om 14.30 uur
door
Anne Margot Catharina Roskott
geboren op 18 april 1980
te Zwolle
Promotores
Prof. dr. G. Dijkstra
Prof. dr. R.J. Ploeg
Copromotores
Dr. V.B. Nieuwenhuijs
Dr. H.G.D. Leuvenink
Beoordelingscommissie
Prof. dr. J.H. Kleibeuker
Prof. dr. J. Pirenne
Prof. dr. H.P. Sauerwein
CONTENTS
Chapter 1 Introduction and rationale
Chapter 2 First Report of a National multidisciplinary Registry of
Intestinal Failure and Intestinal
Transplantation (DRIFT)
7
17
Submitted
Chapter 3 Screening for psychosocial distress in patients with
long-term home parenteral nutrition
37
Clinical Nutrition, 2013 Jun;32(3):396-403
Chapter 4 Cost-effectiveness of Intestinal Transplantation for
adult patients with Intestinal Failure
57
Submitted
Chapter 5 Histopathological and molecular evaluation of
the organ procurement transplant network (OPTN)
selection criteria for intestinal graft donation
75
Journal of Surgical Research, 2014 Jun;189:143-151
Chapter 6
Small bowel preservation for intestinal transplantation: a review
95
Transplant International, 2011 Feb;24(2):107-131
Chapter 7 Reduced ischemia-reoxygenation injury in rat intestine
after luminal preservation with a tailored solution
129
Transplantation, 2010 Sep 27;90(6):622-629
Chapter 8 Summary and future perspectives
149
Nederlandse samenvatting Nederlandse wetenschappelijke samenvatting
Dankwoord: Wie verdwaalt ziet meer…
Curriculum vitae
159
163
179
189
CHAPTER 1
INTRODUCTION TO INTESTINAL FAILURE (IF)
AND INTESTINAL TRANSPLANTATION (ITX)
AND RATIONALE FOR THIS THESIS
The small intestine is a prime organ in humans along with heart, lungs, liver and kidneys.
Failure of one of those organs is not compatible with life, either immediately or at least within
a relatively short period of time. To date, several therapies have become available replacing (in
part) prime organ function including solid organ transplantation for end-stage organ disease.
In many patients with organ failure, replacement of function is necessary whilst bridging time
from the start of failure until organ transplantation. A well-known and successful example is
hemodialysis in kidney failure. For some organs, even implants and other devices are available,
such as pacemakers or ventricular assist devices for the heart. Most forms of solid organ
transplantation will function as a permanent and more sustainable therapeutic solution with
outcomes often superior to a biotechnical function replacement. For patients suffering from
intestinal failure (IF), therapeutic considerations are not as ‘clear cut’.
The population of patients with IF is small and most patients have a complex medical history
having been treated in different hospitals. Intestinal failure (IF) has been defined as failure
to maintain protein-energy, fluid, electrolyte and/or micronutrient balance when on a
conventional diet 1,2. IF can be caused by a variety of underlying diseases. Table 1 describes
the most common conditions in children and adults respectively.
Children
Adults
- Gastroschisis (22%)
- Motility disorder (e.g. chronic intestinal pseudo-obstruction (CIPO)) (18%)
- Volvulus (16%)
- Necrotizing enterocolitis (NEC) (14%)
- Intestinal atresia (4%)
- Small bowel enteropathy (e.g. microvillus inclusion disease,
tufting enteropathy) or intractable diarrhea of infancy (8%)
- Other (e.g. autoimmune enteritis, omphalocèle, tumor) (18%)
- Ischemia (24%)
- Crohn’s Disease (11%)
- Volvulus (8%)
- Motility disorder (11%)
(e.g. chronic intestinal pseudo-obstruction (CIPO))
- Trauma (7%)
- Tumor (13%)
- Other (26%)
Table 1 Underlying diseases causing IF in children and adults, percentages between the brackets refer
to indications for intestinal transplantation according to the International Intestinal Transplant Registry
Report 2013
This broad collection of causes can be conveniently arranged into two pathophysiological
conditions: the most common condition is ‘anatomical failure’, when lack of sufficient
effective small bowel surface for nutrient absorption results in the short bowel syndrome
(SBS) or ‘functional conditions’, such as motility disorders or epithelial disease leading to
malabsorption. The clinical picture of IF is characterized by weight loss, dehydration with
intractable diarrhea or high stoma output, vitamin and mineral deficiencies, and malnutrition.
IF can further be classified according to its clinical duration and severity into three types. This
classification determines the medical treatment and prognosis. Type 1 intestinal failure is selflimiting, occurring relatively commonly following abdominal surgery, necessitating shortterm fluid or nutritional support. The rarer type 2 intestinal failure is associated with septic,
8
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
metabolic and complex nutritional complications, usually following surgical resection in
patients with Crohn’s or mesenteric vascular disease. In this condition parenteral nutritional
support is needed. Type 3 intestinal failure is irreversible/chronic and characterized by the
need for long-term parenteral nutrition (TPN) 3,4. This thesis focuses on type 3, the most
severe, chronic type of intestinal failure (CIF), which –fortunately- is exceptional. The number
of patients with CIF however does seem to increase as the reported Dutch prevalence in 1997
was 3.7 per million, while on January 2013 a point prevalence of 10.3 per million was described
(Neelis E. & Roskott A.M. et al., First Report of a Dutch multidisciplinary Registry of Intestinal
Failure and Intestinal Transplantation (DRIFT), abstract presented at the Dutch Society of
Gastroenterology, Oct, 2013). Whether a better registration, demographic changes (older
patients), or progress in the medical field is responsible for this growth is unclear. A good
overview of the total population as well as the medical situation of the individual patient is
lacking.
The small intestine has a central role in the physiology of the gut because of its main
functions of secretion, assimilation and nutrient absorption. A truly effective therapy to
replace the function of the intestine in the form of a particular artificial device/machine does
not exist. The only therapy to somehow replace the nutrition function of the intestine is by
intravenous, total parenteral nutrition (TPN). The mainstay of CIF treatment is the permanent
administration of TPN, which can be offered in the home situation (home parenteral nutrition
(HPN)) 3. In the Netherlands, HPN therapy is offered and coordinated by specialized centers.
For children and adults in Amsterdam (Amsterdam Medical Center (AMC)) and Nijmegen
(University Medical Center Nijmegen (UMCG)), and in Rotterdam (Erasmus Medical Center,
Sophia Children’s Hospital), for children only. TPN was introduced in 1967 as a life-saving
therapy for patients with IF. However, it cannot match the physiological complex function of
the small intestine and it has some disadvantages. It encompasses the delivery of all required
nutrients via intravenously administered solutions involving the permanent necessity of
central venous access with a centrally placed venous catheter line or a subcutaneous reservoir
(port) that can be easily punctured. The basic components of TPN solutions are protein
hydrolysates or free amino acid mixtures, monosaccharides, and electrolytes - to which fats
can be added. TPN is a relatively safe treatment with a good long-term survival rate. In a
mixed population of adults and children, the mean five year survival rate ranges between
75%-85% 5-15. Although these survival rates appear fairly acceptable, TPN is associated with
frequent potentially life-threatening complications - partly due to its unphysiological nature.
The main complications are central venous access problems (occlusion, infection), hepatic
dysfunction (cholestasis, steatosis, fibrosis, cirrhosis and liver failure), loss of bone mineral
density and metabolic derangement. Liver failure is the complication with the greatest risk of
death, especially in children 4,6. Due to these marginalia, one can imagine that TPN has a great
impact on psychosocial and practical daily life compromising the quality of life (QoL) of the
patient and his/her surroundings 16,17. Practicalities like the infusion pump, the access device,
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
9
1
infusion times and hospital visits might cause restrictions, but also the psychosocial aspect
of not being able to eat and diarrhea affect a patient’s well being. Insight into problems and
quality of life (QoL) is important for caregivers to be able to interfere or possibly refer in case
of serious problems. Different studies have attempted to increase insight in distress and QoL
of CIF patients. However, these studies are very heterogenic and the results are therefore hard
to compare. A validated and specific QoL measurement instrument for patients on TPN and
for patients after ITx has not been developed yet.
Moreover, -and most important-, TPN is not a permanent solution for CIF. Despite this,
intestinal transplantation (ITx) is still only offered to a small number of selected patients
as survival after ITx is still inferior to that of patients on TPN. This implies that ITx ought to
be regarded as a rescue therapy for those selected few patients with CIF and failure of TPN.
Table 2 describes the indications and contra-indications for ITx in more detail 18,19.
Indications
Contra-indications
Irreversible IF: >75% of nutrition in the form of TPN for more than 6 weeks
And
Failure of TPN due to:
-Loss of venous access (thrombosis of 2 or more central veins)
-Two or more episodes per year of catheter related systemic sepsis that
requires hospitalization
-A single episode of line-related fungemia, septic shock, or acute respiratory
distress syndrome
-Impending or overt liver failure due to TPN-induced liver injury
-Frequent episodes of severe dehydration despite iv fluid supplementation in
addition to TPN
-Severely compromised quality of life
-Non-curable malignancy with a poor prognosis
-Severe neurological disease
-Expected poor loyalty to therapy
-Uncontrollable local or systemic infections
-AIDS
-Irreversible multi organ failure
-Poor nutritional condition
-Alcohol or drug abuse
-Severe atherosclerosis
-Severe co-morbidity such as severe heart or lung disease
Table 2 Indications and contra-indications for ITx (20)
In order to determine whether an individual IF patient is a candidate for ITx, a complete medical
overview including the severity of complications from TPN is required, but this is often not
available. Also, international consensus on which patients may benefit from continuation of
TPN and which patients should receive ITx is still lacking. Indistinct indications can lead to lack
of clarity of referral criteria and delayed referral for ITx, which in part are factors considered
responsible for historically high death rates on waiting lists for ITx and poor outcome of ITx.
Therefore, an integrated, multidisciplinary approach of the management of patients with CIF is
highly important. This multidisciplinary approach will facilitate early referral, standardization
of protocols and promote (inter)national patient registries to optimize patient care and
survival 6,21-23, OPTN/SRTR Annual Data Report 2010.
Intestinal transplantation (ITx) is a relatively new type of transplantation and performed
in much lower numbers than other solid organs. In the Netherlands, this procedure is only
carried out at the University Medical Center Groningen and worldwide there are only 82
10 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
centers licensed for this transplant type. To date, -Worldwide-, approximately 2887 intestinal
transplant procedures have been performed (ITR 2013 Annual Report). Although results
have improved since its introduction in the ’90 due to better immunosuppressive protocols,
surgical technique and improved post-operative care, the outcome after ITx does not match
the outcome after other solid organ transplantations. The 2013 Intestinal Transplant Registry
(ITR) report reveals an overall 5-year survival rate approaching 70%. The vulnerability of the
intestinal graft to a number of critical donor factors and transplant-procedure related aspects,
with in addition its strong immunogenic character contribute to this lack of success. Brain
death in the donor, ischemia-reperfusion injury and impaired microbial repair mechanisms
result in a profound inflammatory response and tissue damage with an increased risk of
infection and rejection after ITx. The viability of the organ graft has been recognized as a key
factor of good outcome. However, consensus on selection criteria of qualitatively acceptable
intestinal grafts is lacking. Due to small numbers, most criteria when to accept intestines
for transplantation have not been validated yet. To date, clinicians worldwide apply a set
of subjective donor and transplant-related criteria that are expected to affect graft quality.
The donation criteria as defined by the American Organ Procurement Transplant Network
(OPTN) are an example of such an empirical ‘set of criteria’.
The intestinal mucosa is extremely vulnerable to injury resulting from hypoperfusion 24,25.
Unfortunately, ischemia is inevitable during the preservation process that bridges the gap
between retrieval and implantation of the graft in the recipient. In spite of the distinct sensitivity
of the intestine to ischemia, no specific preservation technique has been developed for this
particular organ. Intestines are preserved with University of Wisconsin (UW) preservation
solution, which was originally designed for pancreas, liver and kidney preservation. This lack
of an adequate strategy to preserve the intestinal graft allows only a short preservation of
six to ten hours and results in variable degrees of tissue injury (26) limiting clinical success of
ITx. A better understanding in the needs of the intestinal graft during preservation and the
development of a specific intestinal preservation solution tailored to its requirements would
benefit the results of ITx.
ITx is a typical example of an innovative technique that has been applied due to better
clinical understanding in transplantation. Nevertheless, health professionals must take the
responsibility to critically evaluate the effect of a new intervention. The outcome of medical
innovation nowadays needs to be examined in terms of increment of quality of life, life profit
(life years), and quality adjusted life years (QUALY’s). Socio-economic perspectives need to be
considered. Especially for the Dutch situation, with a small CIF patient population and an even
smaller group eligible for ITx, we have to regard what effort and costs are needed to maintain
a very specific specialist program. This discussion, however, is difficult: who determines
the value of life (years) in terms of cost, and how to objectively judge and compare one’s
quality of life? Today, awareness of cost has become inevitable especially as regards financial
negotiations between hospitals and health insurance companies. The health care burden of
CIF is enormous: estimated annual expenses on maintenance nutritional support vary widely
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
11
1
with reported amounts between $75.000 and $300.000 per patient (27,28). Home parenteral
nutrition (HPN) and intestinal transplantation (ITx) are expensive. Exact costs are unclear and
reimbursement for ITx is often insufficient.
Figure 1 illustrates the course of the patient with CIF within time. The arrows represent
different aspects that have been introduced in Chapter 1 and that are the focus of study in
the Chapters comprising this thesis.
Figure 1
CIF
2
Legend
3
HPN
4
Death
failure
HPN
5
failure
ITx
6 7
2
Chapter 2
Dutch multidisciplinary
Registry of Intestinal
Failure and Intestinal
Transplantation (DRIFT)
3
Chapter 3
Quality of life with HPN
4
Chapter 4
Cost of HPN and ITx
5
Chapter 5
ITx donor selection and
graft viability
6 7 Chapter 6/7 Graft preservation
ITx
donor
selection
ITx
ITx
graft
Abbreviations
CIF - Chronic Intestinal Failure
HPN - Home Parenteral Nutrition
ITx - Intestinal Transplantation
12 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
OUTLINE OF THIS THESIS
1
In Chapter 2 the results are presented from our multicenter cross-sectional study to register
and describe the Dutch population of CIF patients and identify ITx candidates using a novel
online web-based Dutch Registry of Intestinal Failure and Transplantation (DRIFT). Following
the concept that intestinal failure and intestinal transplantation are both part of a National
program the Dutch Intestinal Failure Foundation was founded. This working group initiated
DRIFT and concerns collaboration between the two dominant Dutch HPN Centers (University
Medical Center Nijmegen and Amsterdam Medical Center) and the Dutch Intestinal Transplant
Center (University Medical Center Groningen). This online registry was created to acknowledge
the need for multidisciplinary care and decision-making. The aim of DRIFT was multiple:
a) To monitor individual patients with CIF during HPN on a National scale
b) To facilitate adequate identification of transplant candidates, and optimal timing for
screening and ITx
c) To support protocol standardization and scientific research.
Chapter 3 focuses on the Quality of Life (QoL) experienced by patients with home parenteral
nutrition (HPN). The validation of the ‘HPN version’ of the Distress Thermometer (DT)
and Problem List (PL) measurement instrument is described. The DT and PL were originally
developed for the measurement of distress in the oncological population. This original version
of the instrument was adjusted to the specific situation of CIF patients. In addition to the
validation of the DT and PL, referral wish for additional care, assessment of opinions on the
instrument and risk factors for distress and referral wish are studied.
Chapter 4 considers a different, economic aspect of HPN and ITx. The disease course of CIF in
adults is simulated in a study model to calculate the costs of both treatment options and and
to determine the cost-effectiveness of ITx.
Chapter 5 addresses the need for a better insight in the viability of the intestinal graft and
donor factors prior to transplantation in order to define clear and uniform donor criteria. This
chapter discusses histopathological and molecular features of allograft injury in relation to
donor conditions (defined by the Organ Procurement Transplant Network criteria) in a group
of multi organ donors (MOD).
Chapter 6 reviews the issue of preservation by appraising results from previously applied and
recently developed preservation solutions and techniques. The review attempts to identify
the key areas for improvement in order to suggest new strategies.
Chapter 7 suggests an alternative preservation technique tailored to the postulated specific
demands of the intestine with the aim to improve the quality of the intestinal graft, and
ultimately the outcome after ITx.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
13
REFERENCES
1. O’Keefe SJ, Buchman AL, Fishbein TM, Jeejeebhoy KN, Jeppesen PB, Shaffer J. Short bowel syndrome and
intestinal failure: consensus definitions and overview. Clin Gastroenterol Hepatol 2006 Jan;4(1):6-10.
2. Scott NA, Leinhardt DJ, O’Hanrahan T, Finnegan S, Shaffer JL, Irving MH. Spectrum of intestinal failure in a
specialised unit. Lancet 1991 Feb 23;337(8739):471-473.
3. Lal S, Teubner A, Shaffer JL. Review article: intestinal failure. Aliment Pharmacol Ther 2006 Jul 1;24(1):19-31.
4. Wanten G, Calder PC, Forbes A. Managing adult patients who need home parenteral nutrition. BMJ 2011 Mar
18;342:d1447.
5. Pironi L, Joly F, Forbes A, Colomb V, Lyszkowska M, Baxter J, et al. Long-term follow-up of patients on home
parenteral nutrition in Europe: implications for intestinal transplantation. Gut 2011 Jan;60(1):17-25.
6. Pironi L, Goulet O, Buchman A, Messing B, Gabe S, Candusso M, et al. Outcome on home parenteral nutrition
for benign intestinal failure: A review of the literature and benchmarking with the European prospective
survey of ESPEN. Clin Nutr 2012 Jun 1.
7. Lloyd DA, Vega R, Bassett P, Forbes A, Gabe SM. Survival and dependence on home parenteral nutrition:
experience over a 25-year period in a UK referral centre. Aliment Pharmacol Ther 2006 Oct 15;24(8):12311240.
8. Scolapio JS, Fleming CR, Kelly DG, Wick DM, Zinsmeister AR. Survival of home parenteral nutrition-treated
patients: 20 years of experience at the Mayo Clinic. Mayo Clin Proc 1999 Mar;74(3):217-222.
9. Messing B, Lemann M, Landais P, Gouttebel MC, Gerard-Boncompain M, Saudin F, et al. Prognosis of
patients with nonmalignant chronic intestinal failure receiving long-term home parenteral nutrition.
Gastroenterology 1995 Apr;108(4):1005-1010.
10. Jeppesen PB, Staun M, Mortensen PB. Adult patients receiving home parenteral nutrition in Denmark from
1991 to 1996: who will benefit from intestinal transplantation? Scand J Gastroenterol 1998 Aug;33(8):839846.
11. Jones BJ. Recent developments in the delivery of home parenteral nutrition in the UK. Proc Nutr Soc 2003
Aug;62(3):719-725.
12. Pironi L, Paganelli F, Labate AM, Merli C, Guidetti C, Spinucci G, et al. Safety and efficacy of home
parenteral nutrition for chronic intestinal failure: a 16-year experience at a single centre. Dig Liver Dis 2003
May;35(5):314-324.
13. Vantini I, Benini L, Bonfante F, Talamini G, Sembenini C, Chiarioni G, et al. Survival rate and prognostic factors
in patients with intestinal failure. Dig Liver Dis 2004 Jan;36(1):46-55.
14. Bonifacio R, Alfonsi L, Santarpia L, Orban A, Celona A, Negro G, et al. Clinical outcome of long-term home
parenteral nutrition in non-oncological patients: a report from two specialised centres. Intern Emerg Med
2007 Oct;2(3):188-195.
15. Ugur A, Marashdeh BH, Gottschalck I, Brobech Mortensen P, Staun M, Bekker Jeppesen P. Home parenteral
nutrition in Denmark in the period from 1996 to 2001. Scand J Gastroenterol 2006 Apr;41(4):401-407.
16. Jeppesen PB, Langholz E, Mortensen PB. Quality of life in patients receiving home parenteral nutrition. Gut
1999 06;44(0017-5749; 6):844-852.
17. Huisman-de WG, Schoonhoven L, Jansen J, Wanten G, van AT. The impact of home parenteral nutrition on
daily life-a review. Clin Nutr 2007 06;26(0261-5614; 3):275-288.
18. Buchman AL, Scolapio J, Fryer J. AGA technical review on short bowel syndrome and intestinal
transplantation. Gastroenterology 2003 04;124(0016-5085; 4):1111-1134.
19. Dijkstra G, Rings EH, van Dullemen HM, Bijleveld CM, Meessen NE, Karrenbeld A, et al. [Small bowel
transplantation as a treatment option for intestinal failure in children and adults]. Ned Tijdschr Geneeskd
2005 02/19;149(0028-2162; 8):391-398.
20. Dijkstra G, Rings EH, van Dullemen HM, Bijleveld CM, Meessen NE, Karrenbeld A, et al. Small bowel
transplantation as a treatment option for intestinal failure in children and adults. Ned Tijdschr Geneeskd
2005 Feb 19;149(8):391-398.
21. Fishbein TM. Intestinal transplantation. N Engl J Med 2009 09/03;361(1533-4406; 0028-4793; 10):998-1008.
14 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
22. Pironi L, Staun M, Van Gossum A. Intestinal transplantation. N Engl J Med 2009 Dec 10;361(24):2388-9;
author reply 2389.
1
23. Beath S, Pironi L, Gabe S, Horslen S, Sudan D, Mazeriegos G, et al. Collaborative strategies to reduce
mortality and morbidity in patients with chronic intestinal failure including those who are referred for small
bowel transplantation. Transplantation 2008 05/27;85(0041-1337; 10):1378-1384.
24. Chiu CJ, McArdle AH, Brown R, Scott HJ, Gurd FN. Intestinal mucosal lesion in low-flow states. I. A
morphological, hemodynamic, and metabolic reappraisal. Arch Surg 1970 10;101(0004-0010; 4):478-483.
25. Park PO, Haglund U, Bulkley GB, Falt K. The sequence of development of intestinal tissue injury after
strangulation ischemia and reperfusion. Surgery 1990 05;107(5):574-580.
26. Bigam DL, Grant D. Small bowel transplantation. In: Morris PJ, Wood WC, editors. Oxford Textbook of
Surgery Oxford: Oxford University Press; 199.
27. Evans RW. Chapter 42 Financial, economic and Insurance Issues Pertaining to Intestinal Transplantation:
When Is Too Much Not Enough? In: Langnas, A., Goulet, O., Eamonn, M., editor. Intestinal Failure: Diagnosis,
Management and Transplantation. Oxford: Blackwell Publishing; 2008. p. 363-364-377.
28. Sudan D. Cost and quality of life after intestinal transplantation. Gastroenterology 2006 02;130(0016-5085;
2):S158-S162.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
15
Stichting
Darmfalen
Nederland
CHAPTER 2
FIRST REPORT OF A NATIONAL
MULTIDISCIPLINARY REGISTRY OF INTESTINAL
FAILURE AND INTESTINAL TRANSPLANTATION
Anne Margot Roskott2*, Esther Neelis1*, Gerard Dijkstra2, Geert Wanten3, Mireille Serlie4,
Merit Tabbers5, Geert Damen6, Evelyn Olthof3, Cora Jonkers7, Jurian Kloeze2, Rutger Ploeg8,
Floris Imhann9, Vincent Nieuwenhuijs10, Edmond Rings1**
Affiliations
1. Department of Pediatrics, University of Groningen, University Medical Center Groningen, The Netherlands
2. Department of Gastroenterology and Hepatology, University of Groningen, University Medical Center
Groningen, The Netherlands
3. Department of Gastroenterology and Hepatology, Radboud University Medical Center, Nijmegen, The
Netherlands
4. Department of Endocrinology and Metabolism, University of Amsterdam, Academic Medical Center, The
Netherlands
5. Department of Pediatrics, University of Amsterdam, Academic Medical Center, The Netherlands
6. Department of Pediatrics, Radboud University Medical Center, Nijmegen, The Netherlands
7. Nutrition Support Team, Academic Medical Center, Amsterdam, The Netherlands
8. Nuffield Department of Surgical Sciences, University of Oxford, Oxford, United Kingdom
9. Healthcare IT Developer, Aceso BV, The Netherlands
10.Department of Surgery, Isala Clinics, The Netherlands
* Both authors contributed equally
** Currently working at Department of Pediatrics, Erasmus Medical Center, Rotterdam, The Netherlands
ABSTRACT
Background & aims
Patients with chronic intestinal failure (CIF) are dependent on home parenteral nutrition
(HPN). When HPN fails, intestinal transplantation (ITx) is indicated. The Dutch Registry of
Intestinal Failure and Intestinal Transplantation (DRIFT) was developed to monitor individual
patients and facilitate multidisciplinary treatment between HPN centres and the ITx centre.
This study presents the first data.
Methods
CIF was defined as type 3 intestinal failure in which > 75% of nutritional requirements are
given as HPN for ≥ 4 weeks (children), and > 50% for ≥ 3 months (adults). All patients who
were registered on January 1, 2013 were included.
Results
In total, 173 patients were registered, resulting in a prevalence for HPN in CIF of 11.39/million
for adults and 6.72/million for children. Underlying diseases were short bowel syndrome
(n=85, 49%), motility disorder (n=73, 42%) or enteropathy (n=15, 9%). In 2012, 12.1% had
≥1 line occlusions and 26.6% ≥1 line sepsis. Bone density was decreased in 46.8% of the
patients. Forty-eight patients (27.7%) met the ITx criteria, 12 patients underwent ITx since
2001 (underlying diseases short bowel syndrome (n=7, 58%), enteropathy (n=3, 25%) or
motility disorder (n=2, 17%)). On January 1, 2013, 9 transplanted patients (75%) were alive,
6 (50%) with a functioning graft. Four patients (33.3%) had rejection with transplantectomy.
Conclusions
The nationwide registry DRIFT revealed an up-to-date prevalence of CIF and a contrast
between transplant numbers and numbers of indicated patients according to the current ITx
criteria. DRIFT supports multidisciplinary care and decision-making.
18 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
INTRODUCTION
Intestinal failure (IF) is characterized by the inability to maintain protein-energy, fluid,
electrolyte and/or micronutrient balance1, essential to maintain growth and development in
children, and the integrity and function of the body in children and adults. IF can result from
obstruction, dysmotility, surgical resection, congenital defects or disease-associated loss of
absorption.1 The underlying diseases are commonly divided into two categories: anatomic
reduction of the gut, also known as short bowel syndrome (SBS), and functional failure, in
case of motility disorders and enteropathies. 2 Patients depend on parenteral nutrition (PN) to
survive, which can be provided at home (HPN) in case of chronic and/or irreversible IF (CIF).
HPN is rare with a reported European prevalence ranging from 2-40 per million inhabitants3
and 13.7 per million amongst British children.4 The prevalence of long-term PN in the
Netherlands was at least 5.1 per million adults and 0.6 per million children in 2004.5 Although
HPN is a lifesaving therapy, it is associated with frequent metabolic and vascular access related
problems and potentially life-threatening complications such as line sepsis and liver disease6,
all of which are associated with morbidity and mortality. Furthermore, HPN has a great impact
on psychosocial and practical daily life, and compromises Quality of Life (QoL).
Intestinal transplantation (ITx) has become an alternative to HPN. However, ITx is
reserved as a rescue therapy for patients with life-threatening complications of PN, so called
‘failure of HPN’. This policy is based on the inferiority of survival rates after ITx compared
to the survival achieved on HPN. Single centre series reported 1- and 5-year patient- and
graft survival between 78-85% and 56-61%.7, 8 The latest worldwide reported 5-year
survival rate approaches 70% (Intestinal Transplant Registry, International Small Bowel
Transplant Symposium, Oxford, UK, June 2013). The 5-year survival of patients with HPN is
approximately 84%.9
It has been shown that early referral to the transplant centre is related to higher survival.10
However, the optimal timing for ITx screening is difficult to determine by caregivers in the
HPN centres. Furthermore, the exact medical status of CIF patients including detailed
documentation of complications that is necessary for appropriate treatment decisions
often remains unclear to the transplant professionals. Therefore, a good multidisciplinary
collaboration between the centres for HPN and the transplant centre(s), including an
actual overview of the individual patient, is essential. This overview was lacking in the
Netherlands until the specifically designed web-based Dutch Registry of Intestinal Failure and
Transplantation (DRIFT) was developed between 2008 and 2012. DRIFT was designed as a
tool for caregivers in the HPN centres and the ITx centre for multidisciplinary communication
and individual patient monitoring (including complications), as well as data collection for HPN
patients and transplanted patients. The first data of this nationwide registry are presented in
this study.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
19
2
MATERIAL AND METHODS
2.1. Study design
Demographic and clinical patient data for this cross-sectional study were obtained in
the two Dutch centres with national Specialty Services for HPN for adults and children
(Academic Medical Centre, Amsterdam (AMC) and Radboud University Nijmegen Medical
Centre, Nijmegen (Radboudumc)) and the single Dutch transplant centre with governmental
permission for ITx (University Medical Centre Groningen, Groningen (UMCG)). Medical
patient records were used for patient registration.
2.2. Dutch Registry of Intestinal Failure and Intestinal Transplantation (DRIFT)
The Dutch Intestinal Failure Foundation and the healthcare IT developer Aceso developed
DRIFT. This web-based registry, in the English language, is available online at https://drift.
darmfalen.nl (demo version available at http://driftdemo.aceso.nl/login/?next=/, mail to
floris@aceso.nl). Patient data safety was ensured according to ISO-27001 standards and
Dutch Data Protection Act standards.
2.3. Patient population
Inclusion
1) Adults and children with CIF treated in one of the above mentioned centres were included.
CIF was defined as type 3 IF (chronic IF requiring long-term nutritional support).11 We specified
this general definition by the addition of our criteria: > 75% of nutritional requirements are
to be given as HPN for at least 4 weeks according the definition of the European Society of
Gastroenterology, Hepatology and Nutrition (ESPGHAN) in children and > 50% for at least
3 months in adults.12 Dependence on HPN on January 1st 2013 was required. 2) All patients
who underwent ITx since its Dutch introduction in March 2001 were included and general
outcome of all patients with CIF receiving HPN in one of the Dutch HPN centres from March
2001 until January 1, 2013 was analysed.
Exclusion
1) HPN in the absence of CIF, i.e. HPN for a malignant disease.
2) Receiving HPN waiting for a gastrointestinal continuity procedure.
3) Receiving intravenous (IV) fluids or electrolytes only.
2.4. Data definitions
Underlying causes of CIF were classified as anatomical, functional or undefined and further
subdivided into SBS, motility disorder, enteropathy or a combined cause. Biometrics,
medication and nutritional information as documented at the last outpatient follow-up
appointment were registered.
20 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
Vascular access related complications
Catheter related bloodstream infection or line sepsis was defined as a positive culture of the
catheter (on removal) or paired blood cultures from a peripheral vein and the catheter13 in a
patient who met the clinical criteria of sepsis, while another focus of sepsis (than the catheter)
was considered highly unlikely. Critical loss of vascular access was defined as occlusion of
more than 2 veins from the 4 primary veins (jugular and subclavian) for the placement of a
CVC (diagnosed with ultrasound or phlebography).12 Line occlusion was defined as a (partial)
occlusion of the vascular access with the need of using sodium hydroxide.
Liver dysfunction
Total bilirubin documented at the last follow-up appointment was registered to assess signs
of liver dysfunction, along with information of last hepatic ultrasound and liver biopsy (if
performed). Clinical stability was required and patients with liver dysfunction unrelated to
PN were excluded for the analysis of liver dysfunction. The Model for End-stage Liver Disease
(MELD)14 and Child-Pugh15 scores were calculated, when possible. The MELD and Child-Pugh
scores are used to assess the severity of chronic liver disease.
Bone density
Dual energy X-ray absorptiometry results of the lumbar spine and the femoral neck were
collected. Osteoporosis and osteopenia were defined according the WHO criteria.16
Hospital admissions
Hospital admissions were considered ‘PN-related’ when the indications for admission were
training for HPN, placement or problems of vascular access, hepatobiliary or nutritional/
metabolic complications or other problems directly related to PN.
Intestinal transplantation
Indications and contra-indications defined by the USA Center for Medicare and Medicaid
Services17 and the American Society of Transplantation18 were applied for identification of
potential ITx candidates. We specified liver dysfunction and CIF with high morbidity since the
general description of these indications could still be interpreted in various ways (Table 1).
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
21
2
Table 1 Indications to identify potential ITx candidates in our population of patients with chronic intestinal
failure (CIF) on home parenteral nutrition (HPN)
Indications17, 18
Contra-indications19
Failure of HPN:
- Insufficient vascular access due to CVC-related thrombosis of ≥ 2
central veins (subclavian or jugular veins)
- Frequent (≥ 2/year) episodes of CVC-related sepsis
- Liver dysfunction
Pending:
-Total bilirubin > 50 µmol/l
Overt: - ≥ 1 of the following criteria;
- Signs of portal hypertension
- Liver fibrosis or cirrhosis
- Severe neurological disease
- Expected low compliance
- AIDS
- Irreversible multi-organ failure
- Kidney failure (unless combined ITx and kidney Tx)
- Severe malnutrition
- Alcohol- or drugs abuse
- Severe atherosclerosis
- Severe comorbidity (e.g. severe cardiopulmonary disease)
- Non curable malignancy with bad prognosis
- Not controllable local or systemic infections
High risk of death attributable to underlying disease:
Intra-abdominal invasive desmoid tumors
Congenital enteropathy
Ultra-short bowel syndrome (gastrostomy, duodenostomy,
remaining small bowel length < 10 cm in children and < 20 cm
in adults)
CIF with high morbidity:
Need for frequent hospitalization because of HPN related
complications (≥3 hospitalizations per year, with each a minimal
duration of 7 days)
Severe impairment of Quality of Life
CVC: central venous catheter; ITx: intestinal transplantation; Tx: transplantation;
2.5. Statistical analysis
Descriptive statistics were calculated in terms of absolute frequencies or percentages for
qualitative data and in terms of means, medians, standard deviations (SD) and range for
quantitative data. Patients were categorized in two groups, adults (≥ 18 years) and children
(< 18 years). The statistical software package used was SPSS statistics 20 (SPSS Inc, USA).
22 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
RESULTS
3.1. Patient inclusion and exclusion
A total of 245 patients were treated in one of the two centres for HPN on January 1, 2013
Figure 1 illustrates the exclusion of 72 patients. Forty-one patients with IF used less PN than
specified. Four patients using more than 75% or 50% of nutrition through PN who had just
started with PN (< 3 months for adults and < 4 weeks for children) and 27 patients who only
received IV fluids or electrolytes were also excluded. Consequently, 173 patients with CIF
receiving HPN were included in DRIFT.
Figure 1 Patient inclusion flowchart
Total patients
treated in HPNcenters for adults
(N = 217) + children
(N = 28)
N = 245
HPN because of
intestinal failure
N = 214
Included
Chronic intestinal
failure
Excluded
HPN because of other
reasons N = 4
Only IV
fluids/electrolytes N=
27
Excluded
No chronic intestinal
failure
N = 41
N = 173
HPN: Home parenteral nutrition; IV: intravenous
Figure 1 Flowchart of the inclusion of patients. In total, 173 patients were included in our study according
the inclusion- and exclusion criteria.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
23
2
Table 2 Patient characteristics of adults and children with chronic and/or intestinal failure (CIF) and home
parenteral nutrition (HPN) on January 1, 2013
Adults (n = 147)
Children (n = 26)
Gender (n, (%))
Female
Male
102 (69.4)
45 (30.6)
8 (30.8)
18 (69.2)
Centre (n, (%))
Academic Medical Centre
Radboud University Medical Centre
53 (36.1)
94 (63.9)
19 (73.1)
7 (26.9)
Age at January 1, 2013 (years)
Median (range)
54.04 (18.04 – 78.67)
4.77 (0.57 – 16.95)
Age at start PN (years)
Median (range)
49.23 (7.11 – 75.77)
0.16 (0.00 – 11.93)
Duration on PN (years)
Median (range)
Short bowel syndrome
Motility disorder
Enteropathy
Combined
2.92 (0.28 – 36.42)
3.25 (0.36 – 36.42)
2.92 (0.28 – 19.50)
1.18 (0.44 – 4.92)
2.39 (0.96 – 11.09)
3.34 (0.21 – 11.97)
1.65 (0.45 – 4.34)
4.48 (0.66 – 11.97)
3.00 (1.56 – 8.88)
4.58 (3.13 – 6.03)
Cause of intestinal failure (n, (%))
Short bowel syndrome
Motility disorder
Enteropathy
Combined
75 (51.0)
58 (39.5)
8 (5.4)
6 (4.1)
7 (26.9)
12 (46.2)
5 (19.2)
2 (7.7)
Body Mass Index
Median (range)
21.0 (13.2 – 37.7)
16.0 (14.3 – 19.3)
Remaining small bowel (n, (%))
Whole small bowel in situ
≥ 1 small bowel resections
56 (38.1)
91 (61.9)
15 (57.7)
11 (42.3)
Small bowel length documented
Median (cm, (range))
≤ 50 cm
≤ 100 cm
≤ 200 cm
≤ 300 cm
64 (43.5)
70.00 (0 – 250)
26 (40.6)
18 (28.1)
19 (29.7)
1 (1.6)
8 (30.8)
26.00 (5 – 90)
5 (62.5)
3 (37.5)
Presence of ileocecal valve (n, (%))
Yes
No
Unknown
63 (42.9)
76 (51.7)
8 (5.4)
18 (69.2)
8 (30.8)
0 (0.0)
Stoma (n, (%))
High located stoma
Colostomy
59 (40.1)
10 (6.8)
6 (23.1)
1 (3.8)
Central vascular access (n, (%))
Central venous catheter
Port-a-cath
Shunt
Peripheral inserted central catheter
97 (66.0)*
33 (22.4)
18 (12.2)*
4 (2.7)
25 (96.2)
1 (3.8)
Location of vascular access (n, (%))
Right jugular vein
Left jugular vein
Left subclavian vein
Right subclavian vein
49 (33.3)
28 (19.0)
21 (14.3)
18 (12.2)
8 (30.8)
4 (15.4)
6 (23.1)
5 (19.2)
PN: parenteral nutrition;
* Five adults had a shunt and a central venous catheter at the same time
24 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
3.2. Patient characteristics
Table 2 and figure 2 describe patient characteristics. The age distribution of patients starting
PN was as follows: 10.4% (<1 year), 3.5% (1–7 years), 5.2% (7–17 years), 20.8% (18-40 years),
45.7% (41-60 years) and 14.5% (≥61 years). Sixty-nine percent of the children (18/26) started
PN before the age of 1 year, of whom 50% (9/18) started within one month after birth.
figure 2A Underlying
diseases
of adults with
CIF
Figure
2A Underlying
diseases
for adultsp
Underlying disease for adults (N = 147)
Motility disorder other than CIPO
6%
Inflammatory bowel disease
3% 1%1%
3% 3%
30%
Mesenteric vascular disease
Tumor
6%
CIPO
6%
Radiation enteritis
8%
17%
16%
Adhesions/fistulas
Bowel ischemia e.c.i.
Mechanical obstruction
Volvulus/malrotation
Trauma
Graft versus host disease
CIPO: chronic intestinal
pseudo-obstruction
CIPO: chronic
intestinal pseudo-obstruction
figure 2B Underlying
diseases
of children diseases
with CIF for children
Figure
2B Underlying
Underlying disease for children (N = 26)
Chronic intestinal pseudoobstruction
8%
8%
Necrotizing enterocolitis
4%
42%
12%
Microvillous inclusion disease
Motility disorder other than
CIPO
11%
15%
Volvulus/malrotation
Other absorption disorders
Gastroschisis
CIPO: chronic intestinal pseudo-obstruction
CIPO: chronic intestinal pseudo-obstruction
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
25
2
the outcome
of Dutchwith
CIF patients
betweenMarch
March 2001
andand
January
1, 20131, 2013
FFigure
igure33shows
Outcome
of patients
CIF between
2001
January
Total:
510 patients
(441 adults/69
children)
Weaned off:
189 patients
Deceased:
144 patients
Still on HPN:
170 patients
ITx:
12 patients
PN-related:
12 patients
Not PN-related:
114 patients
Unknown:
18 patients
Again on HPN:
3 patients
HPN: home parenteral nutrition; ITx: intestinal transplantation; PN: parenteral nutrition
HPN: home parenteral nutrition; ITx: intestinal transplantation; PN: parenteral nutrition
3.3. Complications
3.3.1. Vascular access related complications
Twenty-one patients (12.1%) had ≥ 1 episode of occlusion of their vascular access in 2012 with
a median of 1 (range 1 - 12). Forty-six patients (26.6%) had ≥ 1 episodes of line sepsis in 2012
with a median of 2 (range 1 - 28). In both centres, taurolidin (an antimicrobial agent) was used
to prevent line sepsis. Data regarding the critical loss of vascular access were known for 91
patients; 10 patients (11%) had critical loss of vascular access (Table 3).
3.3.2. Liver dysfunction
Data regarding hepatic duplex ultrasound were available for 84 patients (48.6%, 71 adults
and 13 children). Portal hypertension was diagnosed in 14 patients (16.7%). None of these
patients underwent a liver biopsy. The MELD-score was available for 11 patients (6.4%) with
a median score of 6.71 (range 1.45 - 31.85), and the Child-Pugh score was available for 7
patients (4.0%) with a median of 5 (range 5 - 9). Six patients had a Child-Pugh score of 5
or 6, indicating well-compensated liver disease. One patient had a Child-Pugh score of 9,
indicating significant functional compromise.
3.3.3. Bone mineral density
Data regarding bone density were available for 13 children (50%). Eight children (61.5%) were
diagnosed with a decreased bone density according age and gender. In adults, osteoporosis of
the hip and spine was recorded in 31% and 38.6% respectively.
26 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
Table 3 PN-related complications
Adults (n = 147)
Children (n = 26)
Line occlusion
≥ 1 episode in 2012 (n, (%))
Median (range)
15 (10.2)
1 (1 - 12)
6 (23.1)
2 (1 - 12)
Line sepsis
≥ 1 episode in 2012 (n, (%))
Median (range)
40 (27.2)
2 (1 - 28)
6 (23.1)
1 (1 - 2)
Critical loss of vascular access (n, (%))
8 (5.4)
2 (7.7)
Liver dysfunction (n, (%))
Total bilirubin known
Total bilirubin > 50 µmol/L
Portal hypertension
Splenomegaly
Splenomegaly with ascites
126 (85.7)
5 (4.0)
10 (14.1)
9 (90.0)
1 (10.0)
22 (84.6)
0 (0.0)
4 (30.8)
3 (75.0)
1 (25.0)
Bone mineral density (n, (%))
Hip
Known
Normal
Osteopenia
Osteoporosis
Spine
Known
Normal
Osteopenia
Osteoporosis
2
84 (57.1)
16 (19.0)
42 (50.0)
26 (31.0)
83 (56.5)
20 (24.1)
31 (37.3)
32 (38.6)
General hospital admissions
≥1 episode in 2012 (n, (%))
Median duration (days, (range))
84 (57.1)
24 (1 - 236)
16 (61.5)
9 (1 - 195)
PN-related hospital admissions
≥1 episode in 2012 (n, (%))
Median duration (days, (range))
64 (43.5)
11.5 (1 - 142)
10 (38.5)
6 (1 - 195)
PN: parenteral nutrition
3.4. Identification of potential ITx candidates
In total, 48 patients (27.7%, 39 adults and 9 children) met one or more indication criteria
for ITx. Table 4 describes the recorded indications of these ITx candidates. Frequent CVCrelated sepsis, ultra-short bowel syndrome and overt liver dysfunction are the most frequent
indications regarding adults. For children, overt liver dysfunction and congenital enteropathy
are the main indications.
3.5. Outcome
Figure 3 shows the outcome of all 510 patients (441 adults and 69 children) with CIF between
March 2001 and January 1, 2013. Weaning from PN was possible in 37.1% of the patients
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
27
(160/441 adults and 29/69 children). In total, 144 patients (28.2%) died, of which 133 adults
(30.2%) and 11 children (15.9%). Twelve patients (12/144, 8.3%, all adults) died due to PNrelated problems, for example sepsis or thrombosis. The cause of death was unknown for
eighteen patients (18/144, 12.5%).
Table 4 Identification of potential intestinal transplantation (ITx) candidates
Patients
(n = 173)
Adults
(n = 147)
Children
(n = 26)
10 (5.8)
8 (5.4)
2 (7.7)
5 (2.9)
14 (8.1)
26 (15.0)
5 (3.4)
10 (6.8)
24 (16.3)
4 (15.4)
2 (7.7)
High risk of death attributable to underlying disease (n, (%))
Desmoid tumor
Congenital enteropathy
Ultra-short bowel syndrome
1 (0.6)
4 (2.3)
14 (8.1)
1 (0.7)
CIF with high morbidity (n, (%))
≥3 hospitalizations per year
2 (1.2)
2 (1.4)
Total (n, (%))
48 (27.7)
39 (26.5)
Indication
Treatment failure of HPN (n, (%))
Insufficient vascular access
Liver dysfunction
Pending
Overt
Frequent vascular access-related sepsis
12 (8.2)
4 (15.4)
2 (7.7)
9 (34.6)
HPN: home parenteral nutrition;
3.6. Intestinal transplantation
Since 2001, 12 patients underwent ITx (Table 5). In 6 patients (50%), insufficient vascular
access due to CVC-related thrombosis of ≥ 2 central veins was the indication, followed by
frequent CVC-related sepsis in 4 patients (33.3%), liver failure in 2 patients (16.7%) and
severe impairment of QoL in 2 patients (16.7%). Some of the patients had a combination of
indications.
On January 1, 2013, 9 of the 12 transplanted patients (75%) were alive, of which 6 (50%)
with a functioning graft. Four patients (33.3%) had suffered from severe rejection requiring
transplantectomy of the intestinal graft after a median time of 8.56 months (range 2.33 –
23.00). One patient underwent re-transplantation. Three patients died because of sepsis,
euthanasia and massive psoas bleeding. There were no patients on the waiting list for ITx on
January 1, 2013.
28 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
Table 5 Characteristics of patients who underwent intestinal transplantation (ITx)
Gender (n, (%))
Male
Female
Type of intestinal failure (n, (%))
Short bowel syndrome
Motility disorder
Enteropathy
Underlying disease (n, (%))
Mesenteric artery thrombosis
Microvillous inclusion disease
Chronic intestinal pseudo-obstruction
Volvulus
Total aganglionosis
Complicated surgery
Absorption disorder
Adults (n = 7)
Children (n = 5)
1 (14.3)
6 (85.7)
4 (80)
1 (20)
6 (85.7)
1 (14.3)
1 (20)
1 (20)
3 (60)
5 (71.4)
1 (14.3)
1 (14.3)
2 (40)
1 (20)
1 (20)
1 (20)
Duration on PN (years)
Median (range)
6.21 (0.85 – 15.24)*
4.59 (2.50 – 5.46)
Age at ITx (years)
Median (range)
43.05 (35.50 - 54.64)
4.80 (2.50 - 5.46)
4 (50)
4a (50)
3 (60)
4 (57.1)
1 (14.3)
2 (28.6)
2 (40)
2 (40)
1 (20)
Type of ITx (n, (%))
Isolated
Small bowel + kidney
Combined liver-small bowel
Outcome (n, (%))
Alive with functioning graft
Alive without functioning graft
Deceased
2
2 (40)
a One patient underwent re-transplantation (after 0.85 year on parenteral nutrition)
PN: parenteral nutrition;
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
29
DISCUSSION
This study is the first nationwide report on demographics, indications and complications
of HPN and ITx in adults and children with CIF in the Netherlands. This report was
generated by using the specially designed web-based software tool DRIFT, which is unique
in its multidisciplinary nature of registration of both patients receiving HPN and intestinal
transplant patients. DRIFT provides an integrative follow up of patients with IF.
All Dutch CIF patients were included in DRIFT, except for the children treated by the
HPN team for children in the Sophia Children’s Hospital (who will be registered in 2013). The
multidisciplinary collaboration with this centre within DRIFT had not been established at the
moment of this evaluation.
On January 1, 2013, the point prevalence of HPN because of CIF was 10.3/million, which
is higher than previously reported Dutch prevalence.3, 5 Insufficient documentation in the
past and increased experience in specialized HPN centres with improvement of overall HPN
survival rates might explain this increase. Comparison of this prevalence with other countries
is difficult since different definitions of CIF and indications for HPN are being used. In the
Netherlands, patients with end-stage cancer rarely receive HPN, in contrast to the United
States and Mediterranean countries, where the prevalence of HPN in those cases is higher.5, 20
The Dutch HPN population seems similar to populations reported in Europe, Canada and
Dutch reports from earlier date.3, 21-24 Occlusion of vascular access was more common in
children than in adults. This finding could logically be related to the smaller diameter of the
device in children and the tailor-made PN they use, which tends to lead to occlusion more
easily. A decreased bone density was observed in the majority of the patients, which is the
same as reported earlier for adults. 22, 25 The prevalence of bone disease in children is not
well known. 23, 26 In the light of the high prevalence of decreased bone density (61.5%) in
children, this complication deserves further attention. In contrast to the high prevalence of
bone disease, hepatic dysfunction was relatively uncommon. Our results are comparable
with the study results from van Gossum et al. in a European HPN population22, but difficult
to compare with other studies because of the cross-sectional nature of our study without
follow-up. These data indicate that the quality of HPN care (including the prevention of liver
complications) in the Netherlands is of a high standard.
Almost 28% of the patients met the criteria for screening for ITx, which is higher than the
number of patients who actually underwent ITx in the Netherlands. This discrepancy is
explained by the conscious and cautious-restrictive policy in the Dutch transplant centre
UMCG. This policy is based on the superiority of HPN care over ITx in the Netherlands at the
moment. The reported discrepancy suggests that an update of indications for ITx is necessary,
as has been indicated by other professionals in the field.9, 27 For a correct assessment and
timely decision whether a patient should be listed for transplantation or not, however, HPN
and transplant experts should be aware in details of the individual patient condition and
30 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
formal indications to prevent late referral or an ‘underuse’ of ITx. The introduction and future
use of DRIFT will avoid these pitfalls in the Netherlands.
The 13 ITx procedures (12 patients) performed in the Netherlands from 2001 until 2013
form a minor part of the 2611 procedures performed worldwide until 2011.28 Nine of the
transplanted patients (75%) were alive, of which 6 with a functioning graft (50%). Despite
our small transplant numbers, this is comparable to results from the worldwide Intestinal
Transplant Registry.17, 28, 29
Data were incomplete for some patients, either because information was not available or
because specific measurements had not been performed (e.g. data on bone mineral density).
At times lack of documentation of information on hospitalization in referring non-HPN
hospitals has limited interpretation of hospitalization data in the HPN centres. With a closer
and better screening using the DRIFT application, this situation can be expected to improve.
The variety of definitions might have limited our study. We chose to apply the definition
of CIF as described by Lal et al.11, Beath et al.12 and ESPGHAN. The choice for this strict
definition of CIF might lead to an underestimation of the population of patients with CIF and
HPN in the Netherlands. Some of the excluded patients receive long-term HPN and could
therefore be regarded as part of our study population. The expectation of outcome based on
the underlying disease and gastro-intestinal anatomy of some of the patients, is that they
will never be able to wean from HPN and deserve to be included. Furthermore, the group of
patients (adults) that depend on partial HPN in the form of just IV fluids and electrolytes to
maintain metabolic balance was excluded. These patients require vascular access indicating
a vulnerability to vascular-access related complications and could have been actually part of
our study population as well.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
31
2
CONCLUSION
In the past decade, exact data on Dutch patients with CIF receiving HPN, of potential
candidates for ITx and of patients after ITx have been lacking. The novel, English language
based software application DRIFT that functions as a national patient-centered Electronic
Patient Register (EPR) facilitates both accurate registration and identification of this particular
population with a high comorbidity. On January 1, 2013, the point prevalence of CIF patients
with HPN was 10.3 per million. We found a discrepancy between the number of patients
who met the criteria for ITx and the number of patients who actually underwent ITx. This
finding suggests that an adjustment of the indications for ITx is necessary. DRIFT will be
used in the Netherlands as a quality instrument to monitor patients with CIF to support
the multidisciplinary care and decision-making in this clinically complex patient population.
We feel that the introduction of this tool will benefit the quality of care for patients with
CIF. In addition to more detailed documentation of comorbidity and events, the registry
will facilitate adequate assessment and evaluation of chronic treatment and allows a timely
decision to list for intestinal transplantation.
CONFLICT OF INTEREST STATEMENT
Floris Imhann is co-owner of Aceso B.V.
SOURCES OF FUNDING
The development of DRIFT was supported by the Innovative Action Program 2 Groningen
(IAG2) from the European Fund of Regional Development and the implementation was
supported by The Dutch Foundation of Intestinal Failure (unrestricted supported by Baxter
and Fresenius Kabi Netherlands).
32 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
REFERENCES
2
1. O’Keefe SJ, Buchman AL, Fishbein TM, Jeejeebhoy KN, Jeppesen PB, Shaffer J. Short bowel syndrome and
intestinal failure: consensus definitions and overview. Clin Gastroenterol Hepatol 2006;4: 6-10.
2. Gupte GL, Beath SV, Kelly DA, Millar AJ, Booth IW. Current issues in the management of intestinal failure.
Arch Dis Child 2006;91: 259-264.
3. Bakker H, Bozzetti F, Staun M, Leon-Sanz M, Hebuterne X, Pertkiewicz M, Shaffer J, Thul P. Home parenteral
nutrition in adults: a european multicentre survey in 1997. ESPEN-Home Artificial Nutrition Working Group.
Clin Nutr 1999;18: 135-140.
4. Beath SV, Gowen H, Puntis JW. Trends in paediatric home parenteral nutrition and implications for service
development. Clin Nutr 2011;30: 499-502.
5. Naber AH, Rings EH, George E, Tolboom JJ, Jonkers C, Sauerwein HP. Treatment of intestinal failure by total
parenteral nutrition at home in children and adults. Ned Tijdschr Geneeskd 2005;149: 385-390.
6. Howard L,Ashley C. Management of complications in patients receiving home parenteral nutrition.
Gastroenterology 2003;124: 1651-1661.
7. Fishbein TM, Intestinal transplantation. N Engl J Med 2009;361: 998-1008.
8. Sudan D, Long-term outcomes and quality of life after intestine transplantation. Curr Opin Organ Transplant
2010;15: 357-360.
9. Pironi L, Joly F, Forbes A, Colomb V, Lyszkowska M, Baxter J, Gabe S, Hebuterne X, Gambarara M, Gottrand
F, Cuerda C, Thul P, Messing B, Goulet O, Staun M, Van Gossum A, Home Artificial Nutrition & Chronic
Intestinal Failure Working Group of the European Society for Clinical Nutrition and Metabolism (ESPEN).
Long-term follow-up of patients on home parenteral nutrition in Europe: implications for intestinal
transplantation. Gut 2011;60: 17-25.
10. Grant D, Abu-Elmagd K, Reyes J, Tzakis A, Langnas A, Fishbein T, Goulet O, Farmer D, Intestine Transplant
Registry. 2003 Report of the Intestine Transplant Registry: a New Era has Dawned. Ann Surg 2005;241: 607613.
11. Lal S, Teubner A, Shaffer JL. Review article: intestinal failure. Aliment Pharmacol Ther 2006;24: 19-31.
12. Beath S, Pironi L, Gabe S, Horslen S, Sudan D, Mazeriegos G, Steiger E, Goulet O, Fryer J. Collaborative
strategies to reduce mortality and morbidity in patients with chronic intestinal failure including those who
are referred for small bowel transplantation. Transplantation 2008;85: 1378-1384.
13. Staun M, Pironi L, Bozzetti F, Baxter J, Forbes A, Joly F, Jeppesen P, Moreno J, Hebuterne X, Pertkiewicz M,
Muhlebach S, Shenkin A, Van Gossum A, ESPEN. ESPEN Guidelines on Parenteral Nutrition: home parenteral
nutrition (HPN) in adult patients. Clin Nutr 2009;28: 467-479.
14. Kamath PS, Wiesner RH, Malinchoc M, Kremers W, Therneau TM, Kosberg CL, D’Amico G, Dickson ER, Kim
WR. A model to predict survival in patients with end-stage liver disease. Hepatology 2001;33: 464-470.
15. Pugh RN, Murray-Lyon IM, Dawson JL, Pietroni MC, Williams R. Transection of the oesophagus for bleeding
oesophageal varices. Br J Surg 1973;60: 646-649.
16. Anonymous Assessment of fracture risk and its application to screening for postmenopausal osteoporosis.
Report of a WHO Study Group. World Health Organ Tech Rep Ser 1994;843: 1-129.
17. Buchman AL, Scolapio J, Fryer J. AGA technical review on short bowel syndrome and intestinal
transplantation. Gastroenterology 2003;124: 1111-1134.
18. Kaufman SS, Atkinson JB, Bianchi A, Goulet OJ, Grant D, Langnas AN, McDiarmid SV, Mittal N, Reyes J, Tzakis
AG, American Society of Transplantation. Indications for pediatric intestinal transplantation: a position paper
of the American Society of Transplantation. Pediatr Transplant 2001;5: 80-87.
19. Dijkstra G, Rings EH, van Dullemen HM, Bijleveld CM, Meessen NE, Karrenbeld A, Hofker HS, Porte RJ, Naber
AH, Ploeg RJ. Small bowel transplantation as a treatment option for intestinal failure in children and adults.
Ned Tijdschr Geneeskd 2005;149: 391-398.
20. Howard L, Ament M, Fleming CR, Shike M, Steiger E. Current use and clinical outcome of home parenteral
and enteral nutrition therapies in the United States. Gastroenterology 1995;109: 355-365.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
33
21. Raman M, Gramlich L, Whittaker S, Allard JP. Canadian home total parenteral nutrition registry: preliminary
data on the patient population. Can J Gastroenterol 2007;21: 643-648.
22. Van Gossum A, Vahedi K, Abdel-Malik, Staun M, Pertkiewicz M, Shaffer J, Hebuterne X, Beau P, Guedon C,
Schmit A, Tjellesen L, Messing B, Forbes A, ESPEN-HAN Working Group. Clinical, social and rehabilitation
status of long-term home parenteral nutrition patients: results of a European multicentre survey. Clin Nutr
2001;20: 205-210.
23. Gandullia P, Lugani F, Costabello L, Arrigo S, Calvi A, Castellano E, Vignola S, Pistorio A, Barabino AV. Longterm home parenteral nutrition in children with chronic intestinal failure: A 15-year experience at a single
Italian centre. Dig Liver Dis 2011;43: 28-33.
24. Ugur A, Marashdeh BH, Gottschalck I, Brobech Mortensen P, Staun M, Bekker Jeppesen P. Home parenteral
nutrition in Denmark in the period from 1996 to 2001. Scand J Gastroenterol 2006;41: 401-407.
25. Pironi L, Labate AM, Pertkiewicz M, Przedlacki J, Tjellesen L, Staun M, De Francesco A, Gallenca P, Guglielmi
FW, Van Gossum A, Orlandoni P, Contaldo F, Villares JM, Espen-Home Artificial Nutrition Working Group.
Prevalence of bone disease in patients on home parenteral nutrition. Clin Nutr 2002;21: 289-296.
26. Diamanti A, Bizzarri C, Basso MS, Gambarara M, Cappa M, Daniele A, Noto C, Castro M. How does long-term
parenteral nutrition impact the bone mineral status of children with intestinal failure? J Bone Miner Metab
2010;28: 351-358.
27. Burghardt K, Wales P, De Silva N, Grant D, Avitzur Y. Relevance of Intestinal Transplant Criteria in the New
Era of Specialized Care for Intestinal Failure. 2013;
28. Intestine Transplant Association, Intestine Transplant Registry Report. 2011;
29. Vianna RM, Mangus RS, Tector AJ. Current status of small bowel and multivisceral transplantation. Adv Surg
2008;42: 129-150.
34 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
35
CHAPTER 3
SCREENING FOR PSYCHOSOCIAL DISTRESS
IN PATIENTS WITH LONG-TERM
HOME PARENTERAL NUTRITION
Anne Margot .C. Roskott1, Getty Huisman-de Waal2, Geert. J. Wanten2, Cora JonkersSchuitema3, Mireille.J. Serlie4, Janet P. Baxter5, Josette E.H.M Hoekstra-Weebers6
Institutions
1 Department of Surgery, University of Groningen, University Medical Center Groningen, Groningen, the
Netherlands
2 Department of Gastroenterology and Hepatology, Radboud University Nijmegen Medical Center, Nijmegen,
the Netherlands
3 Nutrition Support Team, Amsterdam Medical Center, Amsterdam, the Netherlands
4 Department of Internal Medicine and Endocrinology, Amsterdam Medical Center, Amsterdam, the
Netherlands
5 Centre for Managed Clinical Networks, NHS Tayside, Dundee, Scotland, UK
6 Wenckebach Institute, University of Groningen, University Medical Center Groningen, Groningen, the
Netherlands
ABSTRACT
Background & Aims
Long-term Home Parenteral Nutrition (HPN) may cause distress and negatively affect quality
of life (QoL). The HPN version of the Distress Thermometer and Problem List (DT/PL) was
developed to evaluate distress during HPN. This study validates the DT/PL, examines referral
wish for additional care, assesses opinions on the DT/PL, and studies risk factors for distress
and referral wish.
Methods
Dutch and Scottish patients completed questions on socio-demographic and HPN-related
general characteristics, the DT/PL, referral wish, the Hospital Anxiety and Depression Scale,
and opinions on the DT.
Results
The HPN version of the DT/PL seemed valid and the PL sufficiently reliable. Cutoff score
appeared to be 6. Consequently, 45% of patients was diagnosed as clinically distressed. 53%
had a referral wish. Emotional and physical problems were most strongly associated with
distress. Not being able to work related to elevated distress. Female gender and co-morbidity
related to referral wish. Opinions on the DT were generally positive.
Conclusion
The DT/PL appears to be a good instrument to regularly gain insight into distress and referral
wish in HPN patients. Use of the DT/PL facilitates support to patients who most need and
want it, thus improving quality of care and QoL.
38 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
BACKGROUND
Total parenteral nutrition (TPN) is a lifesaving therapy for patients with intestinal failure
(IF) since its introduction in 1967. IF has been defined as: inadequate intestinal function for the
absorption of sufficient nutrients, electrolytes and water 1. TPN administration in the home
setting (HPN) has become the primary treatment for patients with long-term IF in the last
three decades. HPN is a complex treatment involving the intravenous infusion (by the patient
or a caregiver) of a sterile aqueous nutrition formula into the venous circulation through
a venous access device (VAD). Unfortunately, VAD-related infections and/or occlusions
are frequent and threaten the patient as well as the device. Other chief complications are
metabolic derangement, and liver disease as a consequence of the non-physiological nature
of direct intravenous feeding 2. HPN is time consuming and requires strict planning. Practical
daily life restrictions and physical TPN associated complications may negatively affect
quality of life (QoL); not only that experienced by the patient but also that of his or her family
members 3.
QoL has been reported to be poorer in individuals receiving HPN compared with the
normal population and compared with patients with intestinal diseases who do not require
nutritional support 4. Despite the fact that HPN patients report different somatic symptoms,
psychosocial problems have the greatest impact on daily life. To improve QoL it is important
to offer (psychosocial) professional care in addition to the standard care by the nutritional
team and medical doctors, e.g. for fatigue, sleeping disorders, anxiety, depression and social
impairment 5 6 7.
Clinicians have serious concerns about the QoL of their HPN patients and are in the
need of guidance with regard to the assessment of the nature and severity of individually
experienced problems 8. It has been suggested not only to study QoL in this population for
scientific purposes, but to additionally gain periodic insight into a patient’s QoL to timely
notice patient-specific problems in different QoL domains and the need for psychosocial
or allied health professional care. In addition to the standard care by the nutrition support
team at the start of HPN, patient-specific additional care can be offered by social workers,
psychologists, psychiatrists, pastoral counselors, physical therapists, physicians or nutrition
experts depending on the area that is most disrupted.
Many different generic tools have been used to evaluate QoL during HPN. Use of a variety
of scales and domains, however, limits comparison between studies 9. Reported problems are
heterogeneous and depend strongly on the test applied. A practical, standardized, scientifically
validated, specific instrument to screen for distress in different QoL domains in HPN patients
is therefore urgently needed. Longitudinal, periodic assessment of somatic, psychological
and social functioning using such an instrument should be performed to provide insight into
individually experienced problems of HPN patients and the necessity to offer care.
For this purpose, in oncology, the Distress Thermometer (DT) and problem list (PL)
were introduced in the American National Comprehensive Cancer Network (NCCN) practice
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
39
3
guideline of distress management 10. Here, patients rate their overall distress on a visual
analogue scale (thermometer) from 0 (no distress) to 10 (extreme distress). A PL, including
items addressing 5 life domains; practical, family/social, emotional, spiritual, and physical
problems, accompanies the DT. Different studies, including one from the Netherlands,
indicate that the DT and PL are highly valid and usable for oncological patients11
Our current study had several objectives:
Primary
- To validate the HPN version of the DT and PL in HPN patients
- To examine patients’ referral wish for additional care
Secondary
- To gain insight into HPN patients’ opinions on the HPN version of the DT and PL
- To investigate relationships between socio-demographic variables, HPN/IF situation and comorbidity on the one hand and distress and the wish for referral on the other hand
40 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
MATERIALS AND METHODS
Patients
In the Netherlands, HPN coordination is carried out at two University Medical Centers
(University Medical Center Nijmegen (UMCN) and Amsterdam Medical Center (AMC)), which
both have a multidisciplinary nutrition support team. In case of HPN failure, patients are
screened and, if eligible, undergo Intestinal Transplantation (ITx) in the University Medical
Center Groningen (UMCG). All adult HPN patients from the UMCN and AMC were requested
by letter or during their regular visit to participate. In addition, all adult HPN patients who
were managed within the Scottish Home Parenteral Nutrition Managed Clinical Networkthese patients receive comparable care by nutrition support teams as the Dutch patientswere requested in the same way as the Dutch patients. Inclusion criteria were: HPN for longterm (≥6 months) IF, ≥ 18years of age, and fluent in the Dutch or English language.
Procedure
This study was performed in line with the ethical guidelines of the participating hospitals.
Patients received a package that included an information letter explaining the goal of the
study, the questionnaire and a prepaid return envelope. Questionnaires were sent back to
the nutrition support team or dropped off during regular visit. The completed questionnaires
from the three different centers were collected and analyzed in Groningen, the Netherlands.
Measures
Patients completed questions on socio-demographic characteristics (sex, age, education
level, marital status, presence of children, employment status), HPN/IF situation and comorbidity (response categories are specified in Table 1). Also, information on care received
(yes/no) from the nutrition support team, psychosocial disciplines (psychologist, psychiatrist,
pastoral counselors, social worker) or physical therapists was obtained through the use of a
self-report questionnaire.
The DT HPN is a single-item self-report measure of distress with an 11-point range
from 0 (no distress) to 10 (extreme distress). Patients were instructed to circle the number
that best described the overall distress experienced during the past week. The PL was
developed using the Dutch oncology version 11 as example by the Dutch multidisciplinary
working group for intestinal failure representing medical specialists, nutrition support
nurses, dieticians, psychologists and social workers. This resulted in a PL of 49 items in 5
domains. Patients could indicate whether they had experienced practical problems (7 items:
child care, housing, housekeeping, finances, insurance, transportation, work/school/study),
family/social problems (3 items: dealing with children, partner, family/friends), emotional
problems (11 items: emotional control, memory, self-esteem, anxiety, depression, tension,
loneliness, concentration, guilt, loss of control, dependency), religious/spiritual problems (2
items: meaning of life and trust in God/faith), or physical problems (26 items: VAD, stoma,
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
41
3
appearance, urination, constipation, diarrhea, incontinence, nausea, vomiting, feeling bloated,
fever, stomach ache, sexuality, sleep, dyspnea, dizziness, eating, taste, weight changes,
feeling cold, feeling warm, bathing/dressing, daily activities, fatigue, physical fitness, muscle
strength). A patient could give a score between 1-10 to a problem that he/she indicated to
be present. Higher scores indicate more problem burden. Lastly, patients were asked if they
wanted to discuss their problems with a professional caregiver (yes, maybe, no, presently
receiving care), and if (maybe) so with whom: dietician/nutrition team, nurse, physician,
physiotherapist, psychologist, psychiatrist, social worker, pastoral worker or member from
the patient association.
Also, patients were asked for their opinion on the DT HPN (pleasant, easy to complete,
burdensome, useful for the patient him/herself, useful for health care providers, timeconsuming, suitable for its purpose) and if they would suggest other HPN patients to
periodically complete the DT and PL. Response options were: yes/no/no opinion.
The Hospital Anxiety and Distress Scale (HADS) was used as the gold standard. The HADS
is a widely used and accepted measure of anxiety and depression in the medical setting. It is
a self-report, 14-item questionnaire with two 7-item subscales, one for anxiety and one for
depression, with maximum scores of 21 on each subscale. The 2 subscales can be combined
into one scale, with scores ≥ 15 indicating clinically significant emotional distress 12 13 14
Analyses
Receiver operating characteristics (ROC) analysis (using STATA) was used to study the ability
of the DT to detect clinically distressed patients 15. A HADS cut-off score ≥15 was used as the
gold standard. The sensitivity and specificity were calculated for every DT score. Descriptives
were calculated for the DT and the PL domains and for the HADS subscales and total score.
Pearson correlations were used to study correlations between the DT and items in the PL. A
Pearson correlation coefficient (r) <0.3 indicated a weak relationship, 0.3-0.5 a moderately
strong relationship, and >0.5 a strong relationship 16. All PL items with a correlation of >0.3
with the DT were entered into a regression analysis to examine which problems contributed
most strongly and uniquely to the DT score. Independent-sample t-tests, ANOVA’s, Chisquare tests and Pearson correlations were calculated to examine relationships between
socio-demographic variables and co-morbidity on the one hand and the DT and the wish
for referral on the other hand. To detect possible factors contributing to the wish for referral,
we dichotomized responses into: patients who wished or maybe wished to be referred and
patients who did not wish to be referred. Additionally, marital status was dichotomized into
having a relationship versus having no relationship, and HPN/IF situation into HPN for chronic
IF versus other categories.
42 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
RESULTS
Descriptives of the study population and comparison between centers are depicted in Table 1.
Of the 211 patients approached to participate in the study, 113 agreed (response
rate=54%). Response rates differed between centers: the highest response rate (71%) was
found in Nijmegen. The majority of respondents was female (70%) and had a relationship
(72%). Mean patient age was 54.5 years (range 19-77). Median educational level was 4, range
found varied between 1-7. Almost half of the population (44%) responded they were unable
to work.
Co-morbidity was frequent, 76% of patients reported having co-morbidity (≥ 1 other
disease) besides the cause of HPN. Most patients (76%) were at home with HPN for IF.
Significant differences were found between centers in age and daily activities.
Consequent analyses revealed that patients from Nijmegen were significantly younger
than those from Amsterdam (p=. 01). More Scottish patients reported to be retired, while
more Dutch patients reported to be unable to work. Retired Scottish patients were aged
between 50-77 years, whereas retired Dutch patients were aged between 64-76 years. The
majority (86%) of patients answered they had received a type of care after they started
HPN treatment. In 85% of patients, this care was the standard care after starting HPN from
the nutrition support team. Between 6-13% of patients indicated they received care from
a physiotherapist, psychologist, psychiatrist, social or pastoral worker. No differences were
found in care received between centers.
DT and HADS scores, establishing cut-off points, predictive values, and internal
consistency
Patients’ DT scores were within the entire range from 0-10. Mean DT score (SD) for the whole
group of patients was 5.1 (2.8), with a median of 5. Mean HADS score (SD) was 12.9 (7.2).
Thirty-seven percent of patients (n=35) scored above the HADS cut-off point. Patients from
Nijmegen, the Netherlands, had a significantly higher mean DT score than Scottish patients.
HADS scores did not differ between centers (Table 2).
DT score strongly correlated to HADS total score (r=.53, p<.001), as well as (moderately
strong) to HADS subscores for anxiety (r=.49, p<.001) and depression (r=.45, p<.001).
The ROC curve predicting clinically elevated distress according to the HADS showed an
area under the curve of 0.74 (standard error 0.05, 95% confidence interval 0.63-0.85, p<.
001) (Fig. 1). A cut-off score of 6 correctly identified 76% of HADS cases (sensitivity) and 69%
of HADS non-cases (specificity). Lowering the cut-off score to 5 would increase false-positive
rates (decrease specificity). Increasing the cut-off score to 7 would increase false-negative rates
(decrease sensitivity). By using the cut-off score of 6, 51 respondents (45%) reported clinically
elevated distress. A DT score of 6 provided a PPV of 59% and an NPV of 83% (Table 3).
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
43
3
Table 1 Descriptives of study population and comparison between centers
Variable
Total
Dundee,
Scotland
Amsterdam,
Netherlands
Nijmegen,
Netherlands
Respondents
113 (100)
33 (29)
27 (24)
53 (47)
Response rate
Comparison
between centers:
test value
113/211=54% 33/76=43% 27/60=45%
53/75=71%
Chi2= 13.7, p<. 01
Men
33 (30)
8 (26)
9 (33)
16 (30)
Chi2 = 0.40, ns
Women
78 (70)
23 (74)
18 (67)
37 (70)
Age
Mean+sd (range)
54.5+12.3
(19-77)
56.7+10.3
(35-77)
59.1+10.0
(36-77)
50.6+13.5
(19-76)
F=5.23, p<. 01
Marital status
(N (%))
Married /living together
77 (70)
22 (71)
17 (63)
38 (73)
Chi2relationship
versus no
relationship
=1.57, ns
No relationship,
living with parents
4 (4)
1 (3)
No relationship,
living alone
12 (11)
3 (10)
Relationship,
not living together
2 (2)
2 (7)
Divorced
8 (7)
Widowed
7 (6)
Educational level
(mean+sd)
1 = primary school - 7=
academic education
Daily activities
(N (%))
Gender (N (%))
IF situation/ status
(N (%))
44 3 (6)
3 (11)
6 (12)
1 (3)
4 (15)
3 (6)
2 (6)
3 (11)
2 (4)
3.9+1.7
4.3+1.4
3.3+1.7
3.9+1.7
F=2.89, ns
Unable to work
48 (43%)
9 (27%)
11 (41%)
29 (55%)
Chi2=15.91, p< .05
Full-time or part-time
(paid) job
16 (14%)
4 (12%)
6 (22%)
6 (11%)
Household/unemployed/
school
19 (17%)
3 (9%)
4 (15%)
12 (23%)
Retired
28 (25%)
15 (46%)
6 (22%)
6 (11%)
Missing
2 (2%)
2 (6%)
At home with HPN: chronic IF 84 (76)
22 (71)
24 (89)
38 (73)
At home with HPN: screening 2 (2)
for ITx
1 (3)
At home with HPN: waiting
for ITx
3 (3)
Post ITx: TPN
1 (1)
1 (3)
Other
20 (18)
7 (23)
Chi2 home
HPN chronic
IF versus other
categories=3.16, ns
1 (2)
2 (7)
1 (2)
1 (4)
12 (23)
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
Table 1 continued
Variable
Comparison
between centers:
test value
Total
Dundee,
Scotland
Amsterdam,
Netherlands
Nijmegen,
Netherlands
26 (79)
16 (64)
42 (79)
Chi2 yes versus no
=2.39, ns
Co-morbidity
(N (%))
Yes
84 (76)
Specifically
(N (%))#)
Pulmonary
15 (14)
Neurological
13 (12)
Diabetics
6 (6)
Venous disease/
atherosclerosis
11 (10)
Cancer
5 (5)
Joint/bone
25 (23)
Muscular
6 (6)
3
Gastro-intestinal (other than 18 (16)
cause of HPN)
Cardiac
11 (10)
Psychological/ psychiatric
6 (6)
Other
35 (32)
Care after start HPN
(N (%))
Received care (yes)
96 (86%)
28 (88%)
23 (85%)
45 (85%)
Chi2=0.12, ns
Kruskal Wallis=ns
From:
Dietician/nutritional team
(yes)
93 (85%)
26 (87%)
23 (85%)
43 (81%)
Chi2=0.21, ns
Kruskal Wallis=ns
From:
Physiotherapist (yes)
13 (12%)
1 (3%)
3 (11%)
9 (17%)
Chi2=3.44, ns
Kruskal Wallis=ns
From:
Psychologist (yes)
14 (13%)
3 (10%)
4 (15%)
7 (13%)
Chi2=0.32, ns
Kruskal Wallis=ns
From:
Social worker (yes)
11 (10%)
1 (3%)
5 (19%)
5 (9%)
Chi2=3.81, ns
Kruskal Wallis=ns
From:
Psychiatrist (yes)
7 (6%)
4 (13%)
0
3 (6%)
Chi2=4.33, ns
Kruskal Wallis=ns
From:
Pastoral worker (yes)
7 (6%)
1 (3%)
2 (7%)
4 (8%)
Chi2=0.64, ns
Kruskal Wallis=ns
# Some of the patients reported having multiple comorbidities
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
45
Table 2 Mean scores for study measures (DT and HADS scores) and wish for referral
Total
Dundee,
Scotland
Amsterdam,
Netherlands
Nijmegen,
Netherlands
DT score
Mean ± SD (range)
5.1 ± 2.8
(0-10)
4.1 ± 2.9
(0-9)
5.2 ± 2.7
(0-10)
5.7 ± 2.8
(0-10)
F=3.01, p=.054
Bonferroni:
D vs N: p< .05
HADS anxiety
Mean ± SD (range)
5.7 ± 4.2
(0-19)
6.1 ± 4
(0-13)
5.5 ± 4.7
(0-17)
5.5 ± 4.2
(0-19)
F=0.20, ns
HADS depression
Mean ± SD (range)
7.1 ± 4.1 (0-20)
6.8 ± 4
(0-15)
7.3 ± 3.8
(1-16)
7.2 ± 4.4
(0-20)
F=0.13, ns
HADS total
Mean ± SD (range)
12.9 ± 7.2 (0-34)
12.9 ± 7
(0-27)
13 ± 7.3
(1-33)
12.9 ± 7.4
(0-34)
F=0.001, ns
HADS above cut-off
N (%)
35 (37%)
14 (42%)
7 (29%)
14 (38%)
Chi2=1.06, ns
Wish for referral
Yes
23 (22%)
7 (24%)
4 (15%)
12 (24%)
Chi2no versus
rest=3.76, ns
Maybe
33 (31%)
4 (14%)
11 (41%)
18 (35%)
No
50 (47%)
18 (62%)
11 (41%)
21 (41%)
Presently receiving
1 (1%)
Figure 1
1 (4%)
0.6
0.4
0.0
0.2
Sensitivity
0.8
1.0
ROC Curve
0.0
0.2
0.4
0.6
1 - Specificity
0.8
1.0
Area under ROC curve = 0.7416
Figure 1 Receiver Operator Curve (ROC)
46 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
Table 3
Results from Receiver Operating Characteristic curve analysis
DT
Correctly
Cut point
Sensitivity Specificity Classified
PPV
NPV
( >= 0 )
100.00%
0.00%
37.93%
1.0000
0.37
0.0
( >= 1 )
96.97%
12.96%
44.83%
1.1141
0.2338
0.40
0.88
( >= 2 )
96.97%
24.07%
51.72%
1.2772
0.1259
0.43
0.93
( >= 3 )
93.94%
29.63%
54.02%
1.3349
0.2045
0.44
0.89
( >= 4 )
81.82%
40.74%
56.32%
1.3807
0.4463
0.45
0.79
( >= 5 )
81.82%
44.44%
58.62%
1.4727
0.4091
0.46
0.81
( >= 6 )
75.76%
68.52%
0.59
0.83
( >= 7 )
60.61%
75.93%
70.11%
2.5175
0.5188
0.60
0.77
( >= 8 )
36.36%
90.74%
70.11%
3.9273
0.7013
0.70
0.71
( >= 9 )
15.15%
94.44%
64.37%
2.7273
0.8984
0.62
0.63
( >= 10 )
3.03%
98.15%
62.07%
1.6364
0.9880
0.49
0.63
71.26%
LR+
2.4064
LR-
0.3538
3
DT=distress thermometer, LR=Likelihood Ratio, PPV=positive predictive value, NPV=negative predictive
value
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
47
The PL’s domains for family/social, emotional and physical problems appeared to have good
internal consistency and reliability (α’s were .83, .90 and .89 respectively). The domain for
practical problems was less reliable (α =.66) and the alpha for the spiritual domain was low
(α=.48). Internal consistency and reliability of all 49 problem items was high (α=.94).
Relationships between Distress Thermometer and PL item scores
Five PL items showed no significant relationship with the DT. All other items demonstrated
significant relationships (Table 4).
A multiple regression analysis entering all variables with a correlation >.30 revealed
an R2 of .90, F=5.94, p<. 001. Significant unique effects were found of self-esteem (β=. 51,
p=. 004), anxiety (β=. 41, p=.018), depression (β=.82, p=.003), tension (β=.47, p=.008),
guilt (β=.56, p=.001), stoma (β=.40, p=.01), nausea (β=1.15, p=.004), dizziness (β=.52,
p=.032), and feeling warm (β=.51, p=.002).
Associations between psychosocial care uptake and DT and PL
Of the 39 patients who consulted a psychosocial caregiver (a psychologist, psychiatrist,
social or pastoral worker, see Table 1), 28 received care from more than one of these health
care providers. These 28 patients had a significantly higher DT score (mean=6.1, sd=2.0)
and significantly more emotional problems (mean number of problems=5.8, sd=3.4) than
patients who did not consult one or more of these professionals (DT mean=4.8, ds=3.0; mean
number of problems=4.1, sd=3.0) (t=2.51, p=.015 and t=2.28, p=.025 respectively). Groups
were comparable in the mean number of practical, social, spiritual, and physical problems.
Wish for referral (Table 2)
Of the respondents, 50 (47%) did not wish a referral, 33 (31%) indicated they maybe wanted
a referral, 23 (22%) wanted to be referred, and 1 patient (1%) was receiving care already (6
missing). Of the patients scoring ≥6 on the DT, 65% (maybe) wanted to be referred or received
care already. Of the patients who did not have clinically elevated distress, 40% (maybe)
wanted a referral (X2=6.28, p=. 012). Respondents with a (possible) wish for referral reported
a significantly higher DT score than respondents who indicated they did not want a referral
(t=-3.2, p<. 001). Patients who had a (maybe) referral wish indicated having significantly more
practical (mean number=1.9, sd=1.7), emotional (mean number=5.6, sd=3.1) and physical
problems (mean number=11.8, sd=5.1) than patients who did not want to be referred (mean
number of practical problems=1.0, sd=1.2; mean number of emotional problems=3.4, sd=2.9;
mean number of physical problems=7.9, sd=4.9). T-test values were t=3.04, p=.003; t=3.42,
p=.001; and t=3.64, p<.001 respectively.
Opinions on completing the DT and PL (Table 5)
Of the respondents, 59% indicated that completing the DT was pleasant; 71% reported that
the DT was easy to complete; 51% indicated the DT was useful for him/herself; 62% judged the
48 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
Table 4 Relationships between distress thermometer and PL item scores
*
PL item
Domain
r
PL item
Domain
r
No relationship
Finances
Practical
.09
Fever
Physical
.15
Insurance
Practical
.06
Bathing/ dressing
Physical
.13
Trust in God/ faith
Spiritual
.18
Child care
Practical
.29
Memory
Emotional
.28
Housing
Practical
.28
Appearance
Physical
.27
Transportation
Practical
.29
Constipation
Physical
.24
Dealing with partner
Social
.25
Incontinence
Physical
.27
Dealing with children
Social
.27
Taste
Physical
.27
Dealing with family/
friends
Social
.29
Housekeeping
Practical
.36
Diarrhea
Physical
.39
Work/ school/ study
Practical
.34
Nausea
Physical
.42
Emotional control
Emotional
.45
Vomiting
Physical
.33
Self-esteem
Emotional
.35
Feeling bloated
Physical
.42
Anxiety
Emotional
.37
Sexuality
Physical
.36
Loneliness
Emotional
.41
Sleep
Physical
.41
Concentration
Emotional
.48
Dyspnea
Physical
.40
Guilt
Emotional
.40
Dizziness
Physical
.40
Loss of control
Emotional
.35
Eating
Physical
.34
Dependency
Emotional
.42
Weight changes
Physical
.39
Meaning of life
Spiritual
.33
Feeling cold
Physical
.41
CAD
Physical
.34
Feeling warm
Physical
.37
Stoma
Physical
.42
Daily activities
Physical
.44
Urination
Physical
.34
Muscle strength
Physical
.35
Weak relationship
Moderately strong
relationship
Strong relationship Depression
Emotional
.50
Fatigue
Physical
.75
Tension
Emotional
.54
Physical fitness
Physical
.58
Stomach ache
Physical
.57
3
*A Pearson correlation coefficient <0.3 indicated a weak relationship, 0.3-0.5 a moderately strong
relationship, and >0.5 a strong relationship
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
49
DT to be useful for the health care providers; 84% did not find completion time-consuming;
70% indicated the DT suitable for its purpose; 75% did not find it burdensome, and 78%
would recommend others to complete the DT. These opinions did not differ between patients
from the three centers.
Predictors of distress and wish for referral
No significant effect was observed of gender (t=1.12), age (r=-.16), relationship status (t=1.04),
education (r=-.10), HPN/IF situation (t=-0.15), or having co-morbidity (t=0.44) on DT score.
A significant effect was found of daily activities (F=3.19, p=. 032) on mean DT score, with
patients working having the lowest mean score (3.7, sd=3.0) and patients unable to work
having the highest mean score (6.0, sd=2.4, Bonferroni test: significant difference between
patients working and those unable to work).
No significant effect was observed of age, relationship status, education, daily activities,
or HPN/ IF situation on referral wish. Significantly more women than men (Chi2 =7.6,
p=. 006), and more patients with co-morbidity than those without co-morbidity (Chi2 =7.5,
p=.006) had a wish for referral.
Table 5 Opinions on DT and PL
Experience DT
Total
Dundee
Amsterdam
Nijmegen
Pleasant (yes)
52 (52%)
17 (55%)
10 (44%)
25 (54%)
Chi2yes versus no and no
opinion=0.87, n.s
Easy to complete (yes)
73 (71%)
27 (87%)
14 (61%)
32 (68%)
Chi2yes versus no and no
opinion=5.12, n.s.
Useful for me personally (yes)
43 (49%)
11 (44%)
11 (52%)
21 (50%)
Chi2yes versus no and no
opinion=0.36, n.s.
Useful for caregiver(s)(yes)
55 (63%)
11 (48%)
12 (57%)
32 (73%)
Chi2yes versus no and no
opinion=4.33, n.s.
Not time consuming (yes)
76 (88%)
20 (91%)
19 (91%)
37 (86%)
Chi2yes versus no and no
opinion=0.46, n.s.
Suitable for purpose (yes)
60 (68%)
18 (78%)
15 (71%)
27 (61%)
Chi2yes versus no and no
opinion=2.12, n.s.
Not stressful (yes)
48 (76%)
Not asked
13 (62%)
35 (83%)
Chi2yes versus no and no
opinion=3.54, n.s.
Recommendable to others (yes)
70 (77%)
23 (85%)
13 (65%)
34 (77%)
Chi2yes versus no and no
opinion=2.64, n.s.
N varies slightly due to missing data
50 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
DISCUSSION
Chronic IF, HPN treatment and related co-morbidity can be highly stressful. A practical
tool to provide insight into the exact level of distress, the nature of the problems and the wish
for professional treatment is lacking. The first aim of the present study was to examine the
validity of the 1-item DT in detecting the severity of distress experienced by HPN patients
and of the PL in providing insight into the nature of problems experienced. Additionally,
patients’ referral wish was examined. The current study revealed that a cut-off score of 6
resulted in optimal sensitivity and specificity relative to the HADS. 76% of patients was
identified correctly as distressed, and 69 % was identified correctly as not distressed. These
percentages are comparable with demonstrated values in a recent meta-analysis in oncology
(sensitivity/ specificity, 78.3%/ 66.5%) 17. Also, the NPV found in the present study (83%) was
comparable to that found in the meta-analysis (84%). This indicates that the DT is excellent in
ruling out clinically elevated distress but can be less well used as a diagnostic tool.
A useful screening tool should provide information not only on the level of experienced
distress but also on the type of associated problems. Therefore, the PL accompanies the DT.
The total PL and the domains for family/social, emotional and physical problems showed
good consistency and reliability. However, the practical and spiritual problem domains were
somewhat less reliable.
The importance of emotional and physical problems in explaining the DT score also
appeared when the correlations between all separate problems and the DT score were
examined. Of the 11 items in the emotional domain, 10 were (moderately) strongly related
to the DT and of the 25 items in the physical domain 20. Of these problems, self-esteem,
anxiety, depression, tension, guilt, stoma, nausea, dizziness and feeling warm (all from the
emotional or physical domain) contributed uniquely to overall distress. These findings apply
on a group level. However, clinicians should pay attention to individual response patterns to
decide what type of care is most needed by a particular patient.
A major advantage of the DT and PL (developed as a psychosocial screening tool) is
that the instrument also encompasses physical problems. Distressful physical problems were
experienced frequently. Patients who experience these physical problems may benefit from
additional care by a medical specialist, the nutrition support team or a physical therapist.
Specialized stoma-nurses could contribute to the frequently experienced distressful stomarelated problems. The extent of physical problems reported was somehow surprising since
the majority (86%) of patients indicated they already received care after they started HPN.
This concerned mainly (by 85% of the respondents) the standard nutrition support care after
starting HPN. In addition, patients who expressed a (maybe) wish for referral had significantly
more physical problems than those who did not need a referral. It seems that the current
form of care may be insufficient to fully prevent and cover the distressful physical problems
associated with HPN. The second most frequent distress-related problem domain was the
emotional domain. 6-13% of the respondents answered that they had already received care
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
51
3
from a psychosocial health care provider. These patients indicated having higher distress and
more emotional problems suggesting that the care they received may not have solved their
problems sufficiently. Additionally, there may be still a substantial number of patients that
could benefit from this type of additional care since the percentage of respondents receiving
such care is low and respondents who (maybe) wanted to be referred had significantly more
emotional problems.
53% of all patients responded that they (maybe) wanted to be referred. This was higher
than the rates reported in screening studies in cancer using the DT/PL (10% in cancer 11, 22%
lung cancer 18). Patients who had a (maybe) referral wish indicated having more practical,
emotional and physical problems than patients who did not want to be referred. The high
incidence of a referral wish and the increased number of practical, emotional and physical
problems experienced by those having a referral wish emphases the severity of clinical distress/
burden and a high need for additional care in HPN patients. However, clinically elevated
distress - based on DT score - does not necessarily mean a referral wish for care. The present
study shows that sixty-five percent of patients with a DT score ≥6 (maybe) wanted a referral
or already received additional care. The referral wish among patients with clinically elevated
distress was higher than among patients scoring below the cutoff (40%). Importantly, still
40% of patients without clinically elevated distress expressed a referral wish. Clearly, the DT
score should not be the only indicator for referral, but patients should also be asked whether
they want to receive additional care. According to our results, 31% of patients reported they
maybe wanted a referral. For these patients it might not be the right time to seek further
support for various reasons. These patients may be focused on getting used to HPN or may
receive enough social support to deal with their situation at that specific moment. Patients’
needs may change over time; this emphasizes the importance of repeated screening from
the start of HPN treatment. Also, patients might be embarrassed to be in need of additional
(psychosocial) care; illustrating the importance of discussing patients’ answers on the DT and
the PL and possible barriers to referral or intervention.
Our secondary aims were first to examine patients’ opinion on the screening instrument
and second to examine risk factors for distress and referral wish. Overall, experience with and
opinions on the DT and PL were positive. Between 50-75% of patients felt that completion
of the DT and PL was pleasant, easy, useful and suitable, and not time-consuming or
stressful. Also, 75% would recommend completion to fellow HPN patients. Still, we expected
appreciations to be even more positive. An explanation may be that respondents were given
brief information on the purpose of psychosocial screening in their invitation to participate
in the study.
We found limited impact of the demographic and illness-related risk factors examined
in this study on distress. Not being able to work seemed to be the only risk factor for elevated
distress; female gender and the presence of co-morbidity were associated with referral
wish. We found no effect of education in contrast to an earlier study 19. Previous research
has demonstrated that the beginning of HPN treatment and a previous good health-status
52 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
(an acute life changing event such as mesenteric thrombosis) were possible risk factors for
elevated HPN-related distress. Peer support, strong self-esteem, good family support and the
use of HPN for longer time (4-5 years) were associated with better QoL ratings 19, 20. These
variables were not examined in the present study.
41% percent of our respondents, in the working age range, answered they were unable to
work. This underlines the impact of HPN on daily life. Surprisingly in Nijmegen, the number of
respondents replying they were unable to work was twice as high as in Scotland. In contrast,
the number of patients from Scotland replying to be retired was more than three times as
high as in Nijmegen. An explanation for this difference between centers is that some of the
Scottish patients reported to be retired at the age between 50 and 64 years. This suggests
that some respondents from Scotland describe their daily activities as retired while there
might be inability to work. In addition, co-morbidity was frequent. Three out of four patients
reported having co-morbidity (≥1 other disease) besides the cause of HPN.
The current study has some limitations that should be noted. Firstly, the response rate
was 54%, which may affect the representativeness of the study population and thus the
generalizability of the results. Secondly, no information was available of the non-respondents
due to the anonymous nature of the study. Thirdly, a cross-sectional sample was analyzed,
which prevents insight into the course of distress over time. Previous longitudinal studies on
the effect of screening indicated that structural screening could increase correct referrals
or even prevent distress 21. Fourthly, the HADS, assessing emotional problems was used for
validation of the multidimensional concept of distress (also including practical, physical,
social, and spiritual aspects). Future studies regarding the DT and PL should examine the
relationship with a multidimensional QoL instrument.
Besides its shortcomings, the current study had some clear advantages. We included a
large sample of patients considering HPN as relatively rare treatment. Patients were recruited
from several centers. Additionally, we examined the relationships between the DT and the PL
in detail and explored referral wish. Furthermore, the overall appreciation of the DT and PL
was positive. Finally, the DT and PL cover patients’ experiences in different QoL domains while
the HADS focuses on the emotional domain only.
The implementation of the DT and PL as a screening instrument in clinical HPN practice
will be a future goal. Implementation should ideally be accompanied by further research
to determine if screening with the DT and PL results in effective communication about the
experienced problems and in the referral of HPN patients who wish so or need additional
professional care. Finally, it has to be verified whether the process of screening improves QoL
and patients’ satisfaction with care.
In final conclusion, results from this study demonstrate the validity of the DT and
PL for HPN patients. The adapted PL was useful for detecting various problems relevant
to this patient group and showed sufficient reliability. According to the cutoff score of 6,
45% of patients could be diagnosed as clinically distressed. These patients could benefit
from additional professional (psychosocial) care. Fifty-three percent of the patients wished
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
53
3
additional referral. A higher percentage of the patients with a DT above the cutoff of 6 had a
referral wish than of the patients scoring below 6 on the DT. Emotional and physical problems
were most strongly associated with distress. Patients not being able to work were at risk for
elevated distress, while female patients and patients with co-morbidity more frequently have
a referral wish for additional care. Systematically gaining insight into distress and referral wish
in HPN patients with the DT and PL can facilitate providing support to patients who need and
wish additional care, thus improving quality of care and QoL.
54 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
REFERENCES
1. Fleming C R, Beart R W,Jr, Berkner S, McGill D B, Gaffron R. Home parenteral nutrition for management of
the severely malnourished adult patient. Gastroenterology 1980; 79: 11-18
3
2. O’Keefe S J. Bacterial overgrowth and liver complications in short bowel intestinal failure patients.
Gastroenterology 2006; 130: S67-9
3. Richards D M, Deeks J J, Sheldon T A, Shaffer J L. Home parenteral nutrition: a systematic review. Health
Technol Assess 1997; 1: i-iii, 1-59
4. Winkler M F. Quality of life in adult home parenteral nutrition patients. JPEN J Parenter Enteral Nutr 2005; 29:
162-170
5. Huisman-de Waal G, Schoonhoven L, Jansen J, Wanten G, van Achterberg T. The impact of home parenteral
nutrition on daily life-a review. Clin Nutr 2007; 26: 275-288
6. Persoon A, Huisman-de Waal G, Naber T A, Schoonhoven L, Tas T, Sauerwein H, van Achterberg T. Impact of
long-term HPN on daily life in adults. Clin Nutr 2005; 24: 304-313
7. Huisman-de Waal G, Naber T, Schoonhoven L, Persoon A, Sauerwein H, van Achterberg T. Problems
experienced by patients receiving parenteral nutrition at home: results of an open interview study. JPEN J
Parenter Enteral Nutr 2006; 30: 215-221
8. Baxter J P, Fayers P M, McKinlay A W. A review of the instruments used to assess the quality of life of adult
patients with chronic intestinal failure receiving parenteral nutrition at home. Br J Nutr 2005; 94: 633-638
9. Jeppesen P B, Langholz E, Mortensen P B. Quality of life in patients receiving home parenteral nutrition. Gut
1999; 44: 844-852
10. Holland J C, Bultz B D, National comprehensive Cancer Network (NCCN). The NCCN guideline for distress
management: a case for making distress the sixth vital sign. J Natl Compr Canc Netw 2007; 5: 3-7
11. Tuinman M A, Gazendam-Donofrio S M, Hoekstra-Weebers J E. Screening and referral for psychosocial
distress in oncologic practice: use of the Distress Thermometer. Cancer 2008; 113: 870-878
12. Bjelland I, Dahl A A, Haug T T, Neckelmann D. The validity of the Hospital Anxiety and Depression Scale. An
updated literature review. J Psychosom Res 2002; 52: 69-77
13. Zigmond A S, Snaith R P. The hospital anxiety and depression scale. Acta Psychiatr Scand 1983; 67: 361-370
14. Spinhoven P, Ormel J, Sloekers P P, Kempen G I, Speckens A E, Van Hemert A M. A validation study of the
Hospital Anxiety and Depression Scale (HADS) in different groups of Dutch subjects. Psychol Med 1997; 27:
363-370
15. Zweig M H, Campbell G. Receiver-operating characteristic (ROC) plots: a fundamental evaluation tool in
clinical medicine. Clin Chem 1993; 39: 561-577
16. Cohen J. Statistical power analysis for the behavioral sciences, 2nd edn. Hillsdale, NJ: Lawrence Erlbaum
Associates, 1988; 1988
17. Mitchell A J. Pooled results from 38 analyses of the accuracy of distress thermometer and other ultra-short
methods of detecting cancer-related mood disorders. J Clin Oncol 2007; 25: 4670-4681
18. Graves K D, Arnold S M, Love C L, Kirsh K L, Moore P G, Passik S D. Distress screening in a multidisciplinary
lung cancer clinic: prevalence and predictors of clinically significant distress. Lung Cancer 2007; 55: 215-224
19. Smith C E, Curtas S, Werkowitch M, Kleinbeck S V, Howard L. Home parenteral nutrition: does affiliation with
a national support and educational organization improve patient outcomes?. JPEN J Parenter Enteral Nutr
2002; 26: 159-163
20. Howard L. Home parenteral nutrition: survival, cost, and quality of life. Gastroenterology 2006; 130: S52-9
21. Kruijver I P, Garssen B, Visser A P, Kuiper A J. Signalizing psychosocial problems in cancer care :the structural
use of a short psychosocial checklist during medical or nursing visits. Patient Educ Couns 2006; 62: 163-177
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
55
CHAPTER 4
COST-EFFECTIVENESS OF INTESTINAL
TRANSPLANTATION FOR ADULT PATIENTS WITH
INTESTINAL FAILURE – A SIMULATION STUDY
A.M. Roskott1,2 *, H. Groen3 *, E.H.H.M. Rings4, J.W. Haveman2, R.J. Ploeg2, M.J Serlie5,
G. Wanten6, P.F.M. Krabbe3, G. Dijkstra1
* both authors contributed equally to this work
Affiliations
University of Groningen, University Medical Center Groningen, Groningen, The Netherlands
1 Department of Gastroenterology and Hepatology
2 Department of Surgery
3 Department of Epidemiology
4 Department of Pediatrics
University of Amsterdam, Academic Medical Center, Amsterdam, The Netherlands
5 Department of Endocrinology and Metabolism
University of Nijmegen, Radboud University Nijmegen Medical Center, Nijmegen, The Netherlands
6 Department of Gastroenterology and Hepatology
ABSTRACT
Background
Home parenteral nutrition (HPN) and intestinal transplantation (ITx) are the two treatment
options for irreversible intestinal failure (IF).
Objective
This study models the disease course of irreversible IF and both treatments - HPN and ITx - to
estimate the cost-effectiveness of ITx.
Design
We simulated IF treatment in adults as a discrete event model with parameters derived from
the Dutch registry of IF patients (DRIFT), the Intestinal Transplant Registry, hospital records,
the literature, and expert opinions. Simulated patients were enrolled at a rate of 40 per month
for 10 years. The maximum follow-up was 40 years. Survival was simulated as a probabilistic
function. ITx was offered to 10% of patients with < 12 months remaining life expectancy on
HPN if they were not transplanted. Costs were calculated according to Dutch guidelines with
discounting. We evaluated the cost-effectiveness of ITx by comparing model runs with and
without ITx and by calculating the cost difference per life-year gained (ICER).
Results
The average survival was 14.6 years without ITx and 14.9 years with ITx. HPN costs were
€9,000 for treatment introduction, followed by €63,000 annually. The costs of ITx were
€73,000 during the first year and then €13,000 annually. The ICER was €20,650 per life-year
gained.
Conclusion
ITx slightly improves the survival of IF patients in comparison to HPN, at additional costs of
€20,654 per life year gained.
58 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
INTRODUCTION
Intestinal failure (IF) is defined as the reduction in functioning gut mass below the minimal
amount necessary to maintain an acceptable nutritional status on enteral diet. This condition
can result from surgery, functional bowel disease, or a congenital defect.
Short bowel syndrome is the most common cause of IF and occurs when 70-75% of
small bowel length has been lost due to previous surgery 1 2 3 4. IF becomes irreversible when
the gastrointestinal tract is unable to compensate for loss of length and/or function. Until
the advent of total parenteral (intravenous) nutrition (TPN) in the 1960s, irreversible IF was
considered incompatible with life. TPN administered at home - Home Parenteral Nutrition
(HPN) - is the main treatment for irreversible IF.
Irreversible IF is rare with a reported prevalence in Europe ranging from 1.1-12.7 per million
adults. The Dutch prevalence was reported to be 3.7 per million in 1997 5. Recent results from
the Dutch Registration of Intestinal Failure and Intestinal Transplantation (DRIFT) point to a
prevalence of 10.3 per million on January 2013, which indicates a considerable increase over
the last sixteen years.
HPN allows IF patients to live outside the hospital meeting their nutritional requirements,
although serious complications often occur, such as parenteral nutrition associated liver
disease, vascular access problems, sepsis, and metabolic derangement. Patient survival mainly
depends on the underlying disease. IF as such, HPN-related complications, and associated social
restrictions often lead to substantial psychosocial distress and impaired quality of life (QoL) 6 7.
From a socio-economic perspective, the health care burden of irreversible IF is enormous.
The estimated annual cost for maintenance nutritional support differ widely: reported
amounts vary between $75,000 and $300,000 per patient 8 9.
Intestinal transplantation (ITx) is a relatively new therapeutic alternative to HPN 10. For
IF patients, the prognosis on HPN - a 5 year survival rate of 75%-85% 11 12 - is superior to
the prognosis after ITx, which yields a 3 and 5 year survival of 69% and 56%, respectively
13. Most recently, however, worldwide 5-year survival rates from the Intestinal Transplant
Registry (ITR) approached 70%. ITx should be reserved for IF patients with life threatening
complications from HPN, the so-called ‘failure of HPN’ 14. For these ‘high-risk’ patients,
survival clearly improves after ITx compared to continued HPN, and these patients have high
mortality rates whilst on the waiting list for ITx 14.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
59
4
Although a few studies discuss the costs of HPN and ITx 9 15, no study has definitively
established the cost-effectiveness of ITx 8. Extensive and exact data on costs are lacking, but
according to the literature, ITx may become cost-effective after approximately 1-2 years in
patients who retain their functional grafts 9.
In the Netherlands, the University Medical Center Groningen (UMCG) is the National
center for ITx, where this procedure has been performed since 2001 in adults and children.
HPN is provided by two specialized centers for children and adults (Amsterdam Medical
Center and University Medical Center Nijmegen, St. Radboud) throughout the country. The
aim of this study was to model the disease course of irreversible IF, the treatment effects of
HPN and ITx, and to estimate cost-effectiveness of ITx based on National and International
data.
60 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
METHODS
Model structure
We simulated the treatment options for irreversible IF in adults in a cohort-based discrete
event model. Discrete event modeling requires the clinical course of patients to be represented
as a series of consecutive steps or states. The time spent in the various states is programmed
in the model as fixed durations or as time-dependent probabilities, depending on what is the
best approximation of the actual process being modeled. In addition, treatment choices can
be modeled by fixed probabilities or by comparing multiple time-dependent probabilities.
We modeled the treatments HPN and intestinal transplantation (ITx), with subsequent
graft failure or sustained graft function, and death as the final state (Figure 1). The amount
of time that the simulated patients remained in each treatment state (transition time) was
determined by probabilistic Weibull functions. These functions resemble survival curves and
their shape was based on the available data. For each patient, duration of a certain state was
randomly drawn from the distribution of the respective Weibull function. In case of multiple
possible outcomes, transition times were determined independently for each outcome and
the shortest time determined the outcome.
Selection for ITx was determined by a fixed percentage of patients with a remaining life
expectancy on HPN of less than 12 months. Maximum simulated follow-up was 40 years, in
view of the average age of adult patients with irreversible IF (median age of adults in the DRIFT
registry of 54 years). During execution of the model, detailed information was collected about
the time spent in the various states in the model. To produce stable estimates, the model was
replicated 500 times. In each replication of the model, all outcomes were calculated for the
entire cohort of included patients. The model was constructed with the use of advanced and
generic modeling software (AnyLogic Company, St Petersburg, Russian Federation).
Figure 1: States and transitions in the model for treatment of adults with intestinal failure (Adult_IF_HPN)
consisting of home parenteral nutrition (_HPN) and intestinal transplantation
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
61
4
Model parameters
We derived parameters for our model from the International Intestinal Transplant Registry
(ITR), the Dutch Registry of Intestinal Failure and Transplantation (DRIFT), hospital records, the
literature, and expert opinions from Dutch HPN centers and the ITx center 3 8 9 16 17 (Table 1).
Although the number of new IF patients in the Netherlands was estimated at four per month,
the simulations were performed with an enrollment rate of 40 per month, which means we
simulated a larger recruitment area of perhaps several European countries. This increase of
number of patients does not affect absolute results, because the results are represented as
the difference between the situations of HPN treatment without ITx and HPN with ITx. The
larger number of patients does, however, improve accuracy. Over a simulation period of 10
years, 4,800 patients were enrolled. After an initial period of HPN, ITx was offered to 10% of
patients with a remaining life expectancy on HPN of less than 12 months. We also evaluated
outcomes when higher percentages of patients (15 and 20%) were offered ITx and in the case
of longer remaining survival expectancy (18, 24 and 36 months).
Survival on HPN was based on data from the literature 11 12 18, while the Weibull curves for
graft and patient survival after ITx were based on ITR data and extrapolated to 40 years
(Figure 2). Survival after graft failure was estimated based on the difference between graft
survival and patient survival of ITx. In view of the very short waiting list for an adult donor
organ 19, the probability of dying while waiting was considered negligible.
Costs
We calculated costs according to Dutch national guidelines at the price level of 2012 20
and indexed pricing using the Dutch consumer price index (www.cbs.nl). The costs of
transplantation were based on a recent publication by Van der Hilst et al., reporting the costs
of adult liver transplantation until one year after surgery 17. The procedure and the costs
associated with liver transplantation are comparable to ITX. However, according to the expert
opinion from surgeons of the Dutch ITx Center, ITX requires a longer operation time and the
use of more blood products than liver transplantation. We modeled these extra costs. Then,
we calculated the costs of follow-up after the first year assuming 2 outpatient visits per year,
6 days of hospital admissions per year 9 21, in addition to evaluations of intestinal function
including endoscopies, as well as evaluations of kidney function and bone densitometry,
all according to the local UMCG protocol. Costs of immunosuppressive medication were
considered to remain the same after the first year. Costs of HPN onset were calculated
separately from the annual costs of continuous HPN seven days a week. Costs for onset
included a hospital admission for HPN training, nursing staff time for training and initial HPN
consumables, as well as central venous catheter (CVC) placement. We derived these costs
from a comprehensive evaluation of TPN by Olieman et al. 22 with adaptations for the adult
situation, being mainly the quantity of HPN products used.
62 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
Table 1 Model parameters for irreversible IF in adults
Parameter
Value(s)
Source
Annual inflow of IF patients
480
DRIFT, HPN centers, expert opinion
Proportion indication for ITx
10%
DRIFT, expert opinion
Remaining life expectancy on HPN for eligibility for ITx
12 months
Expert opinion
4
Costs (€)
HPN onset: total
Hospital admission
Training by nurse
CVC placement
HPN administration
€ 9,005
€ 6,083
€ 825
€ 1,047
€ 1,050
HPN, yearly maintenance: total
Hospital admission for complications (7 days)
HPN administration
CVC replacement
Laboratory tests
Outpatient visits
DXA scan
€ 63,211
€ 4,258
ITx, first year, total
Transplant surgery
Hospital admission
Medication
Interventions
€ 72,332
€ 14,658
€ 28,360
€ 9,120
€ 20,194
ITx, subsequent annual costs, total
Hospital admission
Medication
Interventions/diagnostics
Outpatient visits
€ 15,183
€ 3,650
€ 9,120
€ 2,140
€ 273
€ 54,750
€ 3,664
€ 100
€ 390
€ 49
HPN centers
HPN centers
22
HPN centers
DRIFT, HPN centers
HPN centers
22
HPN centers
HPN centers
HPN centers
17
17
ITx protocol UMCG
17
17
9
ITx protocol Groningen
ITx protocol Groningen
ITx protocol Groningen
Figure 2: Survival curves applied in the simulation model for patient survival on HPN (solid line), survival
after ITx (green dashed line), graft survival after ITx (dashed red line) and survival on HPN after graft failure
(dashed blue line).
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
63
Cost-effectiveness
To estimate life-years on HPN and after ITx, we added up the numbers of patients in the
HPN and ITx states per year. We calculated costs per month and per year by using the data
on numbers of patients starting on HPN, numbers of patients receiving ITx, and numbers
of patients in follow-up after start of HPN or ITx. To account for the depreciation of future
costs and effects, we applied discounts to the annual data for life-years and costs, based on
the economic principle that benefits are worth more today than in the future because of
the preference to spend now rather than later and because there may be improvements on
interventions in the near future. This principle can be applied to costs as well as to health
outcomes 23. We discounted future costs and effects by 4% and 1.5%, respectively. For
comparison with other countries, we applied uniform (uniform for costs and effects) discount
rates of 3, 4, and 5%.
We evaluated the cost-effectiveness of ITx by comparing life-years and costs of 500
replications of the model with and without ITx as a treatment option. We combined model
outputs regarding life-years and numbers of patients with costs in order to calculate the
incremental cost-effectiveness ratio (ICER) - defined as the difference in costs divided by the
difference in life-years comparing the alternative intervention (ITx) to the standard (HPN).
The ICER expresses the costs for the gain of a life-year.
Figure 3: N
umbers of patients over time in various states in the simulation model. Black lines represent
cumulative numbers of patients starting on HPN (continuous black line) and after transplantation
(dashed black line). Red dashed line represents cumulative number of deceased patients. Blue
lines represent numbers of patients on HPN (dashed) and on ITx (dashed-dotted line), the latter
plotted on the right y-axis.
64 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
RESULTS
Survival
All patients entered our simulation model over a period of 10 years. The number of patients
on HPN was only slightly smaller than in simulations without ITx (Figure 3). HPN patient
numbers decreased steadily, due to ITx or death. The number of patients alive after ITx peaked
after about 13 years at a level of 71 patients (16,7% of the average number of 425 patients
undergoing ITx) and then also declined (Figure 3, right y-axis). The cumulative number of ITx
patients rose over the entire simulation period. At the end of the simulation period of 40 years,
there were still patients left in both treatment groups: 595 patients remained on HPN (12.4%
of the 4,800 enrolled), and 18 patients remained in the ITx state (4.2%). The average number
of deceased patients at the end of the simulations was 4,187 (87% of the total enrolled).
The number of transplants ranged from 362 to 480 between the model replications. In this
model, the average survival was 14.6 years without ITx and 14.9 years with ITx.
Costs
The initial costs of HPN were € 9,005, including a clinical training and the placement of a
central venous catheter. The average annual costs for HPN maintenance were € 63,211 (Table
1). These annual costs include HPN products, HPN nurse support, outpatient follow-up, and
hospital admission in case of HPN related complications. The cost of ITx were € 72,332 during
the first year, including screening, the transplant procedure, and clinical and outpatient
follow-up. The subsequent average annual costs were € 15,183 - these mainly arose from
immunosuppression, re-hospitalization, and outpatient follow-up (Table 1).
Cost-effectiveness
Both total costs (€ 46.6 million) and life-years (1,525 years) increased with ITx (10%) versus
HPN (Table 2, undiscounted). Total costs of HPN decreased by less than 9 million Euros (0.2%
of total costs) when ITx was introduced. However, in this situation, total costs of ITx amounted
to 55 million. The combination of these outcomes resulted in an estimated € 30,570 for each
additional life-year gained by ITx. When we applied discounts, this estimate decreased to
€ 20,654 per life-year.
HPN cost calculations were based on an assumed full need for HPN seven days a week.
However, because some patients with irreversible IF only need HPN a few days a week, we
may have overestimated HPN costs. Calculations with HPN of four days a week instead of
seven resulted in an increase of the discounted costs per life-year by € 1,836.
When we selected higher percentages of patients for ITx, the numbers of transplantations,
mean survival, life-years, and total costs proportionally increased, while costs of TPN
proportionally decreased (Table 2). The net result was that undiscounted costs per life-year
remained virtually unchanged. After discounting, the cost-effectiveness with increased ITx
percentages slightly improved, probably due to the fact that the life-years were less affected
by the discounting procedure than the costs.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
65
4
Table 2 Effects and costs (€) of treatment of irreversible IF in adults with and without ITx*
Outcome
Without ITx
With 10% ITx
With 15% ITx
With 20% ITx
HPN
4,800
4,800
4,800
4,800
ITx
0
425
637
845
Deaths
4,202
4,187
4,177
4,168
HPN
70,205
70,082
69,996
69,929
ITx
0
1,648
2,474
3,291
Total
70,205
71,730
72,470
73,220
Mean survival
14.6
14.9
15.1
15.3
HPN
4,497,951,100
4,488,955,944
4,483,739,132
4,479,425,755
ITx
0
55,619,183
83,435,940
110,806,446
Total
4,497,951,100
4,544,575,127
4,567,175,072
4,590,232,201
Life-years
--
1,525
2,265
3,015
Costs (€)
--
46,624,027
69,223,972
92,281,101
ICER
--
30,570
30,558
30,608
HPN
55,204
55,099
55,024
54,963
ITx
0
1,251
1,876
2,496
Total
55,204
56,350
56,900
57,459
HPN
2,494,788,271
2,489,129,596
2,485,330,863
2,482,013,237
ITx
0
29,329,570
43,976,585
58,379,144
Total
2,494,788,271
2,518,459,166
2,529,307,448
2,540,392,382
Life-years
--
1,146
1,696
2,255
Costs (€)
--
23,670,894
34,519,177
45,604,111
ICER
--
20,654
20,350
20,224
Patients
Life-years (undiscounted)
Costs (€, undiscounted)
Difference vs no ITx (undiscounted)
Life-years (discounted at 1,5%)
Costs (€, discounted at 4%)
Difference vs no ITx (discounted)
*: Average patient numbers and total costs and life-years of all patients over
66 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
As the expected survival on HPN for ITx candidates might in fact be longer than 12 months,
analyses using expected survival of 18 months, 24 months and 36 months were also
conducted (Table 3). Without discounting, the increment of prognosis on HPN resulted in
lower costs per life-year, also with higher ITx percentages. The decrement in costs in this
situation outweighed the decrement in survival. With discounting, increment of prognosis on
HPN slightly increased the ICER. The decrement of survival relatively outweighs decrement
in costs in this situation.
When we applied uniform discount rates for costs and effects of 3, 4, and 5%, this
resulted in slightly less favorable ICERs. Applying a higher discount rate to effects clearly
diminished the value of long-term gain in life-years with ITx.
Variations of costs of ITx and HPN had modest effects on the overall cost-effectiveness
(Table 4). Increasing costs of ITx by 50% increased the costs per life-year by approximately
60%, while a similar increase in costs of HPN decreased the cost-effectiveness of ITx by about
10%. Simultaneous increases of costs of ITx and HPN by 50% and 20% yielded outcomes for
costs per life-year reflecting the counteracting effect of these change.
Table 3 Sensitivity analysis of prognosis of ITx candidates on HPN if not transplanted
Outcome
With 10% ITx
12 months
18 months
With 15% ITx
18 months
With 20% ITx
24 months
24 months
36 months
72,261
72,774
72,729
Undiscounted
Life-years
71,730
71,694
72,317
Costs (€)
4,544,575,127
4,542,158,931
4,556,770,647 4,552,915,847
4,560,549,442
4,557,004,549
Life-years
1,525
1,490
2,112
2,057
2,569
2,524
Costs (€)
46,624,027
44,207,830
58,819,546
54,964,747
62,598,342
59,053,448
ICER
30,570
29,680
27,852
26,726
24,366
23,398
56,804
57,178
57,225
Difference vs no ITX
Discounted
Life-years
(discount rate 1,5%)
56,350
56,340
56,807
Costs (€,
discount rate 4%)
2,518,459,166
2,518,855,982
2,526,230,794 2,528,373,060 2,530,901,113
2,537,283,474
Life-years
1,146
1,136
1,603
1,600
1,974
2,021
Costs (€)
23,670,894
24,067,711
31,442,523
33,584,788
36,112,842
42,495,202
ICER
20,654
21,181
19,613
20,984
18,292
21,026
Difference vs no ITX
ICER: incremental cost-effectiveness ratio (costs per life-year gained)
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
67
4
Table 4 Sensitivity analysis of changes in costs of ITx and HPN (undiscounted).
ITx 150%
HPN 150%
ITx + HPN 150%
ITx + HPN 120%
Costs
HPN
4.488.955.943
6.733.433.916
6.733.433.916
5.386.747.133
ITx
83.428.774
55.619.183
83.428.775
66.743.020
Total
4.572.384.718
6.789.053.099
6.816.862.691
5.453.490.152
Difference versus HPN
Life-years
1.525
1.525
1.525
1.525
Costs (€)
74.433.618
42.126.448
69.936.040
55.948.832
ICER
48.804
27.621
45.855
36.684
ICER: incremental cost-effectiveness ratio (costs per life-year gained)
68 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
DISCUSSION
Introduction of new modalities and treatment regimen in health care require not only
a demonstration of clinical superiority but also insight in costs for society. Especially in
times of austerity, balancing medical innovation and patient needs with prioritization of
reimbursement has become standard practice for national health care budgets. The best
example in transplantation demonstrating superiority of treatment, enhanced quality of life
(QoL) and significant reduction in cost is the comparison between hemodialysis and kidney
transplantation favoring the latter. The medical situation concerning patients receiving
either permanent HPN or ITx is comparable but more complex due to the fact that clinical
superiority and the effect on QoL is actually less clear. To date, no comprehensive comparison
of the two existing treatment modalities for irreversible IF in adults has been published.
This simulated study enhances better insight into the impact of ITx and its costeffectiveness over HPN. According to our simulation, ITx improves patient survival by
3 months over a 40-year follow-up when restricted to patients with a life expectancy of
12 months if not transplanted, which is the actual situation to date. The absolute survival
gain of 3 months in this model may seem marginal. However, we have to consider that in
this model the survival benefit of the 10 % transplanted patients is distributed over a large
simulated population of which 90 % was not transplanted. Therefore, the appreciated survival
benefit of an individual patient undergoing ITx will, - in fact - be longer than 3 months.
In our model, the costs per life-year gained were approximately € 30.000. This amount
is similar to liver transplantation and lower than those for heart and lung transplantation 24,25.
Studies reporting on the costs of HPN/TPN and ITx are scarce, although these therapies
account for a great impact on the economic health-care burden in The Netherlands,
as well as in other developed countries worldwide. Our study confirms the high costs
estimated for HPN therapy. Costs for HPN are comprised of the continual need for highpriced nutritional infusion products and (to a lesser extent) by the costs for the onset of this
therapy and for hospitalization in case of complications of HPN therapy. Total costs for ITx
are comprised mainly of hospitalization during the first year after the procedure, of the costs
the procedure itself and re-interventions, as well as life-long continuous costs of expensive
immunosuppressive medication.
For this study, we assumed that 10% of patients met the indications for ITx and would
not survive beyond one year without ITx. Therefore, in our model, this percentage of patients
progressed from the HPN-state into the ITx-state. This relatively small percentage reflects
a strict handling of indications for ITx, which is the case in The Netherlands. But because
indication rates have been rising during the last decade, especially in high volume centers,
we also evaluated outcomes with higher percentages since 14 16 19 26. When 15% and 20%
of patients were selected for ITx, it improved survival and incurred higher costs with no
substantial change in cost-effectiveness. This finding economically supports the further
widening of the indication for ITx.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
69
4
It is difficult to estimate the prognosis of an ITx candidate on HPN: with higher percentages
of selected ITx candidates. This prognosis could be longer than 12 months. The sensitivity
analysis of the estimated prognosis of the ITx candidate shows a decrease of ICER with
extension of the prognosis without discounting and a marginal increase of the ICER with
discounting. Therefore, the percentage of candidates selected for ITx (and their prognosis on
HPN) seems not to have a major impact on cost effectiveness of ITx.
Although average costs of HPN exceed those of ITx within two years after the start of
treatment, we cannot simply compare the two treatment options for the individual patient.
There are three main reasons for this. First of all, ITx is now only offered to patients who would
otherwise die within 12 months, which would obviously be far most beneficial financially.
Secondly, for each patient, the costs made for HPN before the ITx procedure is performed
have to be taken into account. In this model, a percentage of patients went into the ITx status
right from the start of a 40-year follow up period. However, most patients however will be in
the more expensive TPN state before ITx is offered. Thirdly, we cannot limit our comparison
to the pure economic aspect of IF; the value of quality of life (QoL) with a certain treatment
has to be taken into account. However, it is very difficult - if not impossible - to compare the
personal objective valuation of one patient with the opinion of another. The opinion on QoL
of a patient with failure of HPN treatment (aware of dying soon without transplantation)
is incomparable with the valuation of QoL by a patient having successful HPN treatment.
Including the aspect of QoL (index type of measure) in our modulation was impossible due to
lack of available data in the HPN/ITx population.
In this study, we made calculations based on direct costs only. From our own studies
reporting on QoL, we know that 43% of HPN patients is unable to work and only 14% is
economically active in society 6. Most survivors after ITx reintegrate into society, with a
self-sustained socio-economic status 16. We did not include the costs for home care in the
calculation of costs on HPN. However, patients often receive home care 27, which is known
to be expensive. Including these home care costs and indirect costs could have increased the
real total costs for HPN. Perhaps the results of our study would be somehow more beneficial
for ITx if indirect costs and costs for home care had been included: the sensitivity analysis
supports this speculation (Table 4). Finally, our results remain an assumption since they are
based on a model that can only approximate reality.
At the most recent International Small Bowel Transplant Symposium in Oxford, UK, June
2013, it became clear that QoL, patient valuation, and an active patient role in the discussion
about ITx are being considered and studied. In the near future, we can imagine the broadening
of indications if the expected improved quality of QoL after ITx compared to HPN 16 28 can be
confirmed and if patient valuation and opinion is allowed to play a role in indicating ITx. Taking
this into account and a possible further improvement of outcome after ITx, one could envisage
offering ITx as a rehabilitative long-term treatment option to all patients with irreversible IF.
In conclusion, our model shows that ITx slightly improves life years of patients with
irreversible IF at relatively low cost.
70 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
ACKNOWLEDGMENTS
We are indebted to Cora Jonkers (Nutritional Support Team, Amsterdam Medical Center,
Amsterdam The Netherlands) for sharing her expert opinion on nutritional support and HPN
specifically; to Max Marquez (Secretary of the ITR) for providing the ITR data; and to Robert
Borgers (Manager, Department of Gastroenterology, UMC Groningen, The Netherlands) for
his help and data on clinical costs.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
71
4
REFERENCES
1.
Goulet O. Recent studies on small intestinal transplantation. Current opinion in gastroenterology
1997;13(6):500-509.
2. Bines JE. Intestinal failure: A new era in clinical management. Journal of gastroenterology and hepatology
2009;24 Suppl 3:S86-92.
3. Wanten G, Calder PC, Forbes A. Managing adult patients who need home parenteral nutrition. BMJ (Clinical
research ed.) 2011;342:d1447.
4. Schurink M, Nieuwenhuijs V, Hulscher JB, et al. Outcome of an intestinal rehabilitation program for children
with short bowel syndrome. Nederlands tijdschrift voor geneeskunde 2012;156(36):A4690.
5. Bakker H, Bozzetti F, Staun M, et al. Home parenteral nutrition in adults: a european multicentre survey
in 1997. ESPEN-Home Artificial Nutrition Working Group. Clinical nutrition (Edinburgh, Scotland)
1999;18(3):135-140.
6. Roskott AM, Waal GH, Wanten GJ, et al. Screening for psychosocial distress in patients with long-term home
parenteral nutrition. Clinical nutrition (Edinburgh, Scotland) 2013;32(3):396-403.
7. Huisman-de WG, Schoonhoven L, Jansen J, et al. The impact of home parenteral nutrition on daily life-a
review. Clinical nutrition (Edinburgh, Lothian) 2007;26(0261-5614; 3):275-288.
8. Evans RW. Chapter 42 Financial, economic and Insurance Issues Pertaining to Intestinal Transplantation:
When Is Too Much Not Enough? In: Langnas, A., Goulet, O., Eamonn, M., editor. Intestinal Failure: Diagnosis,
Management and Transplantation.Oxford: Blackwell Publishing;2008;363-364-377.
9. Sudan D. Cost and quality of life after intestinal transplantation. Gastroenterology 2006;130(0016-5085;
2):S158-S162.
10. Fishbein TM. Intestinal transplantation. The New England journal of medicine 2009 09;361(1533-4406;
0028-4793; 10):998-1008.
11. Pironi L, Joly F, Forbes A, et al. Long-term follow-up of patients on home parenteral nutrition in Europe:
implications for intestinal transplantation. Gut 2011;60(1):17-25.
12. Messing B, Crenn P, Beau P, et al. Long-term survival and parenteral nutrition dependence in adult patients
with the short bowel syndrome. Gastroenterology 1999;117(0016-5085; 5):1043-1050.
13. Garg M, Jones RM, Vaughan RB, et al. Intestinal transplantation: current status and future directions. Journal
of gastroenterology and hepatology 2011;26(8):1221-1228.
14. Abu-Elmagd K, Bond G, Reyes J, et al. Intestinal transplantation: a coming of age. Advances in Surgery
2002;36:65-101.
15. Longworth L, Young T, Beath SV, et al. An economic evaluation of pediatric small bowel transplantation in the
United Kingdom. Transplantation 2006;82(4):508-515.
16. Abu-Elmagd KM, Kosmach-Park B, Costa G, et al. Long-term survival, nutritional autonomy, and quality of
life after intestinal and multivisceral transplantation. Annals of Surgery 2012 ; 256(3):494-508.
17. van der Hilst CS, Ijtsma AJ, Bottema JT, et al. The price of donation after cardiac death in liver
transplantation: a prospective cost-effectiveness study. Transplant international : official journal of the
European Society for Organ Transplantation 2013;26(4):411-418.
18. Messing B, Lemann M, Landais P, et al. Prognosis of patients with nonmalignant chronic intestinal failure
receiving long-term home parenteral nutrition. Gastroenterology 1995;108(4):1005-1010.
19. Smith JM, Skeans MA, Thompson B, et al. OPTN/SRTR 2011 Annual Data Report: intestine. American journal
of transplantation : official journal of the American Society of Transplantation and the American Society of
Transplant Surgeons 2013;13 Suppl 1:103-118.
20. Oostenbrink J, Koopmanschap M, Rutten F. Manual for cost studies, methods and standard prices for economic
evaluation in health care. Amstelveen, The Netherlands: Dutch Health Care Council; 2004.
21. Andersen DA, Horslen S. An analysis of the long-term complications of intestine transplant recipients.
Progress in transplantation (Aliso Viejo, Calif.) 2004;14(4):277-282.
72 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
22. Olieman JF, Poley MJ, Gischler SJ, et al. Interdisciplinary management of infantile short bowel syndrome:
resource consumption, growth, and nutrition. Journal of pediatric surgery 2010 ;45(3):490-498.
23. Drummond MF, Sculpher MJ, Torrance GW, et al. Methods for the Economic Evaluation of Health Care
Programmes. 3rd ed. : Oxford University Press; 2005.
24. Ouwens JP, van Enckevort PJ, TenVergert EM, et al. The cost effectiveness of lung transplantation compared
with that of heart and liver transplantation in the Netherlands. Transplant international : official journal of the
European Society for Organ Transplantation 2003;16(2):123-127.
25. Groen H, van der Bij W, Koeter GH, et al. Cost-effectiveness of lung transplantation in relation to type of
end-stage pulmonary disease. American journal of transplantation : official journal of the American Society of
Transplantation and the American Society of Transplant Surgeons 2004; 4(7): 1155-1162.
26. Abu-Elmagd KM, Costa G, Bond GJ, et al. Five hundred intestinal and multivisceral transplantations at a
single center: major advances with new challenges. Annals of Surgery 2009; 250(4):567-581.
27. Pironi L, Goulet O, Buchman A, et al. Outcome on home parenteral nutrition for benign intestinal failure: A
review of the literature and benchmarking with the European prospective survey of ESPEN. Clinical nutrition
(Edinburgh, Scotland) 2012;31(6)831-45.
28. Pironi L, Baxter JP, Lauro A, et al. Assessment of quality of life on home parenteral nutrition and after
intestinal transplantation using treatment-specific questionnaires. American journal of transplantation :
official journal of the American Society of Transplantation and the American Society of Transplant Surgeons
2012;12 Suppl 4:S60-6.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
73
4
CHAPTER 5
HISTOPATHOLOGICAL AND MOLECULAR
EVALUATION OF THE ORGAN PROCUREMENT
TRANSPLANTATION NETWORK SELECTION CRITERIA
FOR INTESTINAL GRAFT DONATION
Anne Margot C. Roskott, MDa,1, Wouter T. van Haaften, BSca,1, Henri G.D. Leuvenink, PhDa,
Rutger J. Ploeg, MD/PhDa , Harry van Goor, PhDb, Tjasso Blokzijl, BScc, Petra J. Ottens, BSca,
Gerard Dijkstra, MD/PhD c,1, Vincent B. Nieuwenhuijs, MD/PhD a,1
Affiliations
a Department of Surgery, University Medical Center Groningen, University of Groningen, Netherlands
b Department of Pathology and Medical Biology, University Medical Center Groningen, University of Groningen,
Netherlands
c Department of Gastroenterology and Hepatology, University Medical Center Groningen, University of
Groningen, Netherlands
1 These authors equally contributed
ABSTRACT
Background
The OPTN has formulated criteria for the selection of donors for intestinal transplantation.
To date however, no study has correlated histological findings of intestinal injury with the
OPTN criteria. We aimed to describe histopathological and molecular features of allograft
injury in relation to donor conditions defined by the OPTN criteria.
Materials and methods
Graft histology (Park Score), Claudin-3 staining, systemic inflammatory markers (CRP/
lipopolysaccharide binding protein (LBP)) and expression of heat shock protein (HSP-70),
heme-oxygenase-1 (HO-1) and IL-6 were evaluated in multi-organ deceased donors (donation
after brain death (DBD) and donation after cardiac death (DCD)).
Results
97 samples (52 jejunum/45 ileum) were recovered from 59 donors (46 DBD/13 DCD).
The OPTN criterion cold ischemia time correlated with histological injury (Park score) to
which the jejunum appeared more susceptible than the ileum. Claudin-3 staining was higher,
and HSP-70 expression lower in donors meeting the OPTN criteria compared to donors not
meeting the criteria and in DBD versus DCD. In DBD donors, IL-6 expression was higher
compared to DCD donors and inversely related to CRP.
Conclusions
Our multi-parameter analysis suggests that the OPTN criteria can be discriminative
concerning intestinal graft quality. Our data suggests that DCD intestinal allografts are
qualitatively inferior and that the jejunum is more sensitive to ischemia than the ileum.
76 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
INTRODUCTION
Despite continued improvements in the field of intestinal transplantation (ITx) 1, the long-term
survival of intestinal allograft recipients remains inferior compared to other forms of solid
organ transplantation. This may be due to the susceptibility of the intestinal graft to warm and
cold ischemia and immunological injury as part of the so-called transplant injury cascade. This
cascade starts during the process of brain death (BD) in the donor resulting in a systemic proinflammatory and pro-coagulatory environment that results in inflammatory, morphological
and apoptotic alterations in transplanted organs 2-9. Inflammation of the intestine causes
profound structural deterioration and increased permeability 10-12. This injury is exacerbated
by warm ischemia and cold ischemia during the preservation phase 13. Following engraftment
into the recipient, reperfusion of the allograft completes the cascade. This process, termed
ischemia reperfusion injury (IRI) is closely related to early postoperative complications such
as sepsis and acute rejection 14-16. Donor- and transplant related components of this injury
cascade are therefore likely to contribute to the outcome after ITx 17-20.
The number of deceased organ donors has plateaued or slightly decreased in the past
three years 21. Although the pool of ITx candidates is relatively small, donor allocation is
challenging largely due to the inability to place matching donor organs from DBD donors
for the appropriate recipient. The vulnerability of the intestine to injury and the strong
relation between graft quality and outcome has lead transplant centers to be highly selective
on accepting intestinal allografts for transplantation. A clear description of donor criteria
to discriminate between acceptable and unacceptable intestinal grafts is unavailable. At
present, recovery practices and intestinal graft acceptation vary between transplant centers
worldwide. This could lead to the underutilization of intestinal grafts. A recent review by
Fischer-Fröhlich et al. detailed the absence of adequate studies to explore intestinal graft
selection criteria; with the majority of studies being single-center and personal experiences
22. Donor age is the most studied donor variable with other donor variables being described
inconsistently. Except for donor age (<50) and donor-recipient size match (donor smaller
than recipient), valid criteria are unidentified. Fischer-Fröhlich et al. suggested the following
criteria based on a retrospective analysis of their clinical results (N=39, 2006-2011); age <50,
ICU stay <1 wk., no blunt abdominal trauma, most recent sodium <155 mmol/L, no severe
ongoing transfusion requirements, standard donor therapy and compatible size matching 22.
Organ donation after cardiac death (DCD) has increased in kidney and liver transplantation
over the past decade 23. Intestinal grafts from DCD donors are regarded as unacceptable due
to the susceptibility of the intestine to ischemic injury 24, 25. However, the histopathological
quality of the human intestinal DCD graft and specific differences between grafts from
different deceased donor types (DBD vs. DCD) have not been described.
The USA Organ Procurement Transplantation Network (OPTN) 21 has defined a set of
empirical donor based criteria (Table 1). Justification of these OPTN criteria and identification
of crucial donor- and transplant procedure based characteristics is needed to aid health
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
77
5
professionals to select allografts for ITx, ensure optimal utilization of grafts and ultimately
improve the outcomes of ITx.
Ideally, longitudinal assessment of intestinal grafts from human donors during the
donor-, procurement-, preservation- and reperfusion phases is required to assess intestinal
graft quality. However, this study design faces a number of ethical and logistical challenges.
In addition, the modest size of intestinal clinical programs in most centers does not allow
for an adequately powered study to employ such a design. In this study we have evaluated
histopathological and molecular features of allograft injury in relation to donor conditions
(defined by the OPTN criteria) in a group of multi organ donors (MOD). In particular, the
validity of empirical OPTN selection criteria, differences between donor types (DBD/DCD)
and regional intestinal vulnerability have been studied.
Table 1 OPTN donor criteria for acceptation of the intestinal graft
Criteria
Number of donors not meeting criteria (%)
DBD
13 (22%)
Cold ischemia time (CIT) <9 hrs
6 (10%)
Donor age <50 yrs
33 (56%)
Other organs (except for intestine) retrieved
0
AST and ALT <500
1 (2%)
Last serum sodium <170 meq/L
0
Serum creatinine <2 (if donor >1 yr) / <1 mg/dL (if donor <1 yr)
1 (2%)
Negative virology (HIV, HBsAg/cAB, HCV AB)
0
Maximal 2 inotropes at recovery
1 (2%)
Resuscitation <15 min if cardiac arrest after BD declaration
0
AST= Aspartate Aminotransferase, ALT= Alanine Aminotransferase, HIV= Human Immunodeficiency Virus,
HBsAg/cAB= Hepatitis B serum Antigen/core Antibody, HCV AB= Hepatitis C Viral Antibody
78 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
MATERIALS AND METHODS
Informed consent
Informed consent for intestinal biopsies was obtained from relatives of all donors together
with consent for organ donation. In living kidney donors, informed consent was asked for
control blood samples.
Establishment of a clinical donor data and bio-bank
A dedicated student team was trained to collect patient data, blood and intestinal samples
of the proximal (jejunum) and distal (ileum) small intestine during MOD procedures in the
Northern Dutch region. Intestinal tissue samples were retrieved in DBD and DCD donors with
the use of a linear stapling device (GIA 60, 3.8 mm Covedien, Zaltbommel, The Netherlands)
after the standard vascular in-vivo washout of abdominal organs was completed and all the
transplantable organs were retrieved. In all but 2 donors the intestine was not retrieved for
clinical transplantation. Hence, in the great majority of the MOD procedures, the transplantable
organs were retrieved first – before the intestinal samples for this study were taken. In 95%
of all donor procedures, University of Wisconsin (UW) preservation solution (Viaspan, Belzer,
Du Pont, Bristol, UK) was used. In the other 5%, Histidine-Tryptophan-Ketoglutarate (HTK,
Custodiol) was used for vascular washout. After retrieval, samples were preserved by cold
storage (CS) for a variable duration of time depending on the time to travel from the donor
location to the research laboratory. Intestinal tissue was stored in the same cold preservation
solution as used for washout on melting ice until storage at -80ºC or in formalin. CIT is defined
as the time from the start of the vascular systemic washout, followed by a variable CS time
(depending on the journey from the donor to the laboratory) until sample storage. Blood
samples were drawn before start of the standard in-vivo systemic vascular washout of the
abdominal organs. Control blood samples were collected prior to kidney retrieval from 5 living
kidney donors. Blood samples were kept on ice, centrifuged (for 20 min at 1500g) and stored
at -80ºC until analysis. Donor data were stored anonymously in the data bank.
Sample analysis
Histological examination of intestinal tissue
Full thickness samples of intestinal tissue were fixed in 4% buffered formalin, dehydrated,
embedded in paraffin, cut (3-5 µm) and stained with haematoxylin and eosin (H&E).
Histological damage (Park score 0-8) was assessed by two experienced analysts (AMR and
HvG) who were blinded for to donor type 25.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
79
5
Serum analysis
Serum Lipopolysaccharide Binding Protein (LBP)
Serum LBP concentration was measured with a commercially available enzyme linked
immunosorbent assay (ELISA) for human LBP according to instructions in the manual (LBP
human ELISA kit HK315 SanbioUden, the Netherlands). Samples were analyzed in duplicate and
read at 450 nm, in a microplate reader (Victor3, 1420 multilabel counter, Perkin Elmer, Waltham)
Serum CRP
Serum CRP concentration was measured by particle-enhanced immunoturbidimetric assay
by MODULAR P analyzer: CAN 210 as described in Tina-quant C-Reactive Protein Gen3
(Roche Diagnostics, Mannheim Germany).
Immunohistochemical examination of intestinal tissue
Tight junction distribution was examined by immunohistochemical staining of intestinal
sections fixed with 4% paraffin (3 µm) for Claudin-3. Nonspecific binding sites were
blocked with H2O2 and the sections where incubated (1 hr, room temperature (RT)) with
the primary Claudin-3 Rabbit PAB Antibody (Ab) 34-1700 (Invitrogen, The Netherlands),
followed by incubation (30 min RT) with the secondary and tertiary Ab (GaRPODako: P0448,
RaGPOvDako:P0160). Claudin staining was assessed by light microscopy by a blinded analyst,
attributing a semi-quantitative score between 0-4.
80 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
mRNA expression (Polymerase Chain Reaction (PCR))
RNA was extracted from snap frozen tissue using TRIzol (Invitrogen, Breda, The Netherlands).
The integrity of total RNA was analysed by gel electrophoresis and treated with Daze I, Amp
Grade (Invitrogen, Breda, The Netherlands) to avoid genomic DNA contamination. cDNA
synthesis was performed from 1 ug total RNA using T11VN oligo’s and M-MLV Reverse
Transcriptase, according to supplier’s protocol (Invitrogen). Amplification and detection were
performed with the ABI Prism 7900-HT Sequence Detection System (Applied Biosystems,
Foster city, USA) using emission from SYBR Green (Applied Biosystems, Foster city, USA). All
assays were performed in triplicate. After an initial activation step at 50 °C for 2 min and a
hot start at 95 °C for 10 min, PCR cycles consisted of 40 cycles of 95 °C for 15 sec and 60 °C
for 60 sec. Gene expression was normalized with the mean of b-actin or villin mRNA content
and calculated relative to controls. Results were expressed as 2-∆CT, which is an index of
the relative amount of mRNA expressed in each tissue. Genes and primer sequences were
as follows: (Gene: Forward primer sequence/ Reverse primer sequence/Amplicon size (bp));
18S: GCAATTATTCCCCATGAACGA/ CAAAGGGCAGGGACTTAATCAAC/ 76,
Clau-3: CTGCATGGACTGTGAAACCTCA/ TCAAGTATTGGCGGTCACCC/ 62,
HO-1: GCTCAGCCTCAAATGCAGTATTTT/ACCCACGCATGGCTCAA/ 81,
HSP-70: GTTGAAATTTTTTGGTGAAGTACTGAAC/
GAAATAGTCGTAAGATGGCAGTATAAATTC/ 89,
IL-6: CAGAAAACAACCTGAACCTTCCA/ CCAGGCAAGTCTCCTCATTGA/ 80,
Villin: CCCCGGCTCTTTGAGTGTTC, CTCTGTGGCCAGGAAGCG/ 50.
STATISTICS
Statistics were calculated with Statistical Package for the Social Sciences (SPSS Statistics
for Mac, Version 18.0. ChicagoL SPSS Inc). The following tests were used; Chi-Square test,
T-test and Mann-Whitney U tests for comparison between groups, Wilcoxon Signed Rank
Test for comparison between jejunal and ileal samples (only assessed if both jejunal and ileal
tissue from the same donor was available), and Pearson correlation coefficient. Statistical
significance was accepted for p values < 0.05.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
81
5
RESULTS
Donor characteristics
Between January 2009 and July 2011, 97 intestinal tissue samples (52 jejunum, 45 ileum)
were recovered from 59 MOD (46 DBD, 13 DCD). In all but 2 cases the intestine was not
retrieved as a potential intestinal graft to be transplanted but the samples were taken for
the purpose of this study. Table 2 describes donor characteristics. Twenty donors (34%) met
the OPTN criteria for intestinal graft donation. Most common reasons for not meeting the
selection criteria were age (>50 yrs), donor type (DCD) or prolonged CIT (>9hrs).
Table 2 Donor characteristics including brain death (BD) and ischemia times; comparison between donor
types (DBD vs. DCD) and between donors meeting OPTN criteria vs. donors not meeting these criteria
Parameter
DBD
DCD
Donor numbers (%) Total 59
46 (78%)
13
(22%)
Mean age (range)
48 (1-72)
56
(21-67)
Reanimation ≥ 1
time
13 (28%)
Duration cardiac
arrestMean in min
(range)
Instability
Statistical
difference
Donorsmeeting
OPTNcriteria
Donors
notmeeting
OPTNcriteria
Statistical
difference
20 (34%)
39 (66%)
p=0.01
41 (20-48)
54 (1-72)
p<0.01
6 (46%)
NS
7 (35%)
12 (31%)
NS
6 (0-45)
9 (0-15)
NS
8 (0-45)
5 (0-20)
Hypotensive
episode(s)
14 (33%)
1 (9%)
NS
8 (44%)
7 (20%)
NS
Duration
hypotensive
episode(s)Mean in
min (range)
11
(0-120)
6
(0-30)
NS
16 (0-120)
6 (0-30)
NS
Brain death (BD)
696
Duration of BD
Mean in min (range) (352-1138)
-
715 (498-948)
683 (352-1138) NS
Ischemia times
Total warm ischemia timeMean in min
(range)
42
(22-107)
-
42 (22-107)
NS
243
p=0.01
(111-388)
332 (143-474)
339 (119-938)
NS
Cold ischemia time
(CIT) Mean in min
(range)
364
(126-938)
NS = Not Significant, Statistics are represented in the last column, if relevant.
82 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
5
Figure 1 Examples of low and high Park scores in jejunal intestinal tissue. The Park score is expressed on a
0-8 scale; (A) a score of 0 (normal), and (B) a score of 5 (mucosal damage with loss of villous tissue).
Figure 2
(A) Higher Park scores for the jejunum
compared to the ileum. Bars represent
mean Park scores for jejunum and ileum
for the total graft group, *p=0.001.
(B) Jejunal Park scores after subclassification into 3 groups: DBD donors
meeting OPTN criteria, DBD donors not
meeting OPTN criteria, and DCD (per
definition not meeting OPTN criteria)
donors. DBD grafts from donors that
met OPTN criteria show less jejunal
damage than DCD grafts, *p=0.03.
The error bars represent standard deviations
(SDs).
Intestinal histology
Figure 1 illustrates examples of low and high Park scores in jejunal intestinal tissue. The Park
score is expressed on a 0-8 scale; Figure 1A shows a score of 0 (normal), and Figure 1B shows
a score of 5 (damage with loss of villous tissue).
Longer CIT and CS correlated with more histological jejunal damage as assessed by the
Park score (Pearson correlation coefficient ((r)= 0.33/0.31 p=0.02/p=0.03)). The jejunum was
more susceptible to ischemic histological damage than the ileum (Park score 3.9/ 2.6 p=0.001,
Figure 2A). There was no significant difference between the Park score of samples taken of the
jejunum or ileum from different donor types (DBD/DCD) (mean Park score jejunum 3.7/4.6
(p=0.07) ileum 2.4/3.4 (p=0.1)). However, a trend for more jejunal damage was observed in
DCD donors (p=0.07). There was no significantly increased histological jejunal or ileal damage
in grafts from donors meeting the OPTN criteria versus those not meeting these criteria
(mean Park score jejunum 4.1/3.4 (p=0.08) ileum 2.8/2.2 (p=0.2)). A trend for more jejunal
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
83
damage in grafts from donors that did not meet OPTN criteria was observed (p=0.08). After
sub-classification into 3 donor groups: 1 DBD donors meeting OPTN criteria, 2 DBD donors
not meeting OPTN criteria, and 3 DCD donors (per definition not meeting OPTN criteria), no
difference in jejunal Park score was seen between grafts from group 1 and 2 (p=0.2). Grafts
from group 1did show significantly better jejunal Park scores compared to group 3 (p=0.02,
Figure 2B). Ileal Park scores after sub-classification did not differ (2.2 (group 1), 2.6 (group 2)
and 3.4 (group 3)). Jejunal and ileal Park scores correlated positively (r=0.36 p=0.02). There
was no correlation between warm ischemia time (WIT (in DCD)), BD duration (in DBD) and
Park scores for jejunum or ileum.
Figure 3 illustrates the maximal (best) staining score of 4 (on a scale of 0-4) for Claudin-3 in jejunal
intestinal tissue.
84 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
Figure 4
(A) DBD grafts show better jejunal Claudin-3
staining than DCD grafts. Bars represent
mean Claudin-3 staining scores on a scale
from 0-4, *p=0.02.
(B) Grafts from donors that met OPTN criteria
show higher jejunal Claudin-3 staining
scores than grafts from donors that did not
meet these criteria. Bars represent mean
Claudin-3 stain scores on a scale from 0-4,
*p=0.03.
The error bars represent standard deviations
(SDs).
Immunohistochemical Claudin-3 staining
Figure 3 illustrates an example of the maximal (best) staining score of 4 (on a scale 0-4) for
Claudin-3.
DBD intestinal allografts showed improved mean jejunal and ileal Claudin-3 scores than
grafts obtained from DCD donors (jejunum 2.7 vs. 2.0 p=0.02 / ileum 3.0 vs. 1.9 p=0.01,
Figure 4A). Furthermore, grafts from donors meeting OPTN criteria showed superior jejunal
staining than grafts from donors that did not meet these criteria (2.8 vs. 2.5 p=0.03, Figure
4B). In the ileum, there was a trend for better staining in grafts from donors meeting OPTN
criteria (3.2 vs. 2.6 p=0.06). Both in the jejunum and ileum, a higher Park score correlated
with inferior Claudin-3 staining (r=-0.6/-0.5, p<0.01). WIT correlated negatively with jejunal
claudin staining (r=-0.9/ p=0.01); in contrast to BD and CIT. Ileal staining did not correlate
with BD or ischemia times. Mean Claudin-3 scores did not differ between jejunum and ileum
(2.6/ 2.8 p=0.2).
Systemic inflammation (CRP)
CRP levels were <5 mg/L in control blood samples (serum from living kidney donors, n=5)
in contrast to elevated CRP levels in the serum of both DBD and DCD donors (51.9 mg/L
p=0.001, 160.7 mg/L p=0.004). CRP levels of DCD donors were higher compared to DBD
donors (p=0.001). CRP levels did not differ between donors that met OPTN criteria versus
those that did not meet these criteria (p=0.76).
Endotoxemia (LBP)
LBP levels of living kidney donors (n=5, 12.8 mg/L) were lower in contrast to LBP levels from
both DBD and DCD donors (57.5mg/L p=0.005, 79.3mg/L p=0.004). LBP levels did not differ
between deceased donor types (p=0.19) or donors that met OPTN criteria versus those that
did not meet these criteria (p=0.76).
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
85
5
mRNA expression
PCR results are described in Table 3. Jejunal and ileal expression of HSP-70 was higher in DCD
grafts vs. DBD grafts. The same elevation was observed for HSP-70 expression in grafts from
donors that did not meet OPTN criteria vs. those that met these criteria. Jejunal IL-6 and
Claudin-3 expression was higher in DBD vs. DCD and ileal IL-6 expression was higher in DBD.
A higher Park score correlated with higher ileal HSP-70 expression (r=0.352, p=0.026). Jejunal
Il-6 expression inversely correlated with a serum CRP level (r=-0.5, p=0.02).
Table 3 PCR Results: differences between donor types (DBD vs. DCD) and between donors meeting vs.
donors not meeting OPTN criteria
Donors not meeting
OPTN criteria
Statistics
(mean±SD)
Marker Expression
(relative to B-actin)
DBD (±SD)
DCD (±SD)
Statistics
Donors meeting OPTN
criteria (mean±SD)
HSP-70 jejunum
0.6 ± 0.4
2.3 ± 2.3
p<0.01
0.5 ± 0.3
1.3 ± 1.6
p=0.04
HSP-70 ileum
0.7 ± 0.5
2.2 ± 1.6
p<0.01
0.4 ± 0.2
1.4 ± 1.3
p<0.01
IL-6 jejunum
0.9 ± 2.8
0.03 ± 0.03
p<0.01
0.6 ± 0.9
0.8 ± 3.1
NS
IL-6 ileum
1.1 ± 2.2
0.1 ± 0.2
p<0.01
0.3 ± 0.4
1.1 ± 2.3
NS
HO-1 jejunum
1.3 ± .9
0.9 ± 0.5
NS
1.3 ± 0.9
1.1 ± 0.8
NS
HO-1 ileum
1.0 ± .7
0.9 ± 0.5
NS
0.9 ± 0.4
1.1 ± 0.8
NS
Clau-3 jejunum
2.3 ± 2.6
1.2 ± 1.1
p=0.02
2.3 ± 3.0
2.0 ± 2.0
NS
Clau-3 ileum
1.7 ± 1.5
1.6 ± 1.1
NS
1.6 ± 1.5
1.7 ± 1.4
NS
Marker Expression
(relative to villin)
Values represent means ±SD (= Standard Deviation) for HSP-70= Heat Shock Protein 70, IL-6= Interleukin
6, HO-1= Heme Oxygenase 1, Clau 3= Claudin-3, NS= Not Significant
86 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
DISCUSSION
Optimizing the selection of small bowel grafts will improve transplant outcome, but clear
parameters to assess the actual quality and to select optimal graft donors are missing. The
relation between the empirical OPTN donor selection criteria and histopathological and
molecular features of injury has not been studied. We assessed these parameters in the
human intestinal graft in relation to donor characteristics and in that way evaluated the
OPTN criteria for graft selection. The results indicate that these criteria (Table 1) do select
optimal grafts when considering the histological and molecular markers evaluated in this
study. The main donor characteristics are discussed successively.
Donor type - A detrimental effect of WIT (characteristic for DCD) has been claimed, but
little literature is available on ITx and DCD donation specifically. Several reports stated that
intestinal donors should not have any significant history of cardiac arrest or hemodynamic
instability 26-30. Experimental studies demonstrated a higher grade of histological ischemic
injury, higher infectious-related mortality and a lower absorptive function in DCD grafts
compared to DBD grafts 31. However, more recent studies denote that a donor history of
cardiac arrest and consequent CPR should not automatically preclude donation of the
intestinal graft for ITx 32. We confirmed the assumption of inferior intestinal graft quality in
DCD donors after the analysis of multiple molecular and histopathological parameters. WIT
inversely correlated with Claudin-3 scores indicating that this period should be as short as
possible. DCD grafts showed inferior integrity (Claudin-3 staining) and elevated expression
of HSP-70 compared to tissue from DBD donors. Heat shock proteins are formed in reaction
to many noxious stimuli; induction prevents protein denaturation as an attempt to protect
tissue from damage 8, 33. The elevated expression of heat shock proteins in DCD grafts affirms
the detrimental effect of WIT. The increased cell stress is likely to be related to the observed
inferior (micro)structure in these grafts.
DBD grafts showed higher levels of IL-6 expression compared to DCD intestinal allografts.
Similar findings of upregulated IL-6 in DBD donors and higher pro-inflammatory markers in
DBD liver grafts (compared to DCD) have been described 9, 11. The IL-6/p-STAT3 pathway plays
a crucial role in maintaining gastrointestinal homeostasis by regulating epithelial turnover
and mucosal healing 34. Therefore the higher IL-6 expression in DBD grafts may reflect a
protective inflammatory response that is not generated in DCD and further supports the
inferior quality of DCD grafts. The observed inverse relation between jejunal IL-6 expression
and serum CRP level is consistent with this speculation.
CIT - CIT and CS time separately correlated with structural integrity (Park score)
indicating that CIT is directly related to structural graft quality. Ischemia is widely believed
to have negative effects on organ quality 14, 35, 36. The Pittsburg group, led by Abu el Magd,
has repeatedly identified CIT as a factor of influence of outcome after ITx 37, 38. We did not
observe a difference in histology between grafts with > or < 9 hrs of CIT. Therefore, the
maximum allowed CIT of 9 hrs, remains disputable. Balaz et. al confirmed that significant
histological differences in the human jejunum appear after 12 hrs CIT 39. 12 hrs of CIT indeed
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
87
5
seems justifiable since Fischer-Fröhlich et al. achieved good results (1 yr outcome after ITx)
with ischemia times < 12 hrs in their clinical series between 2006-2011 22. We could not
confirm a ‘critical threshold’ at 12 hrs by a difference in structural graft quality after > /
< 12 hrs CIT with our data. Thus, the true maximum CIT deserves further study. Ischemia
has also been associated with the loss of intestinal tight junctions (TJ’s; e.g. Claudin-3
staining) 13. Intact tight junction microstructure seems critical for intestinal barrier function;
essential to prevent translocation of toxins and bacteria, predisposing to inflammation and
infection 40. Oltean et al. described a direct relation between intestinal histology (Park
score), tight junctions (Claudin-3 staining) and barrier function (permeability). Decrement
of functionality was assessed along with increment of Park scores and loss of tight junctions.
Furthermore, decreased Claudin-3 staining was observed with increment of CIT, suggesting
that CIT compromises intestinal barrier function 41. In line with latter findings, we noticed a
decreased Claudin-3 score paralleling increased Park scores (more structural damage) as well
as decreased jejunal Claudin-3 staining with increment of ischemia time. The measurement of
higher levels of systemic inflammatory markers (CRP and LBP) in deceased donors compared
to living donors is in line with this hypothesis of inflammation along with structural damage.
However, a contributing role of the production of inflammatory markers by non-intestinal
organs as a result of the endured transplant related damage couldn’t be ruled out since
inflammatory marker levels were measured systemically.
Donor age
Donor age is a much-discussed donor selection criterion. We could not confirm inferior
histology in older donors, and there was no difference in graft histology between donors < /
> 50 yrs in our data.
Hemodynamic instability and inotropic medication - There is concern that high doses
of vasopressive medication can induce visceral vasoconstriction damaging the intestinal
allograft, but to what extent hemodynamic instability can be tolerated is unclear. FischerFröhlich et al. describe that 31% of the donors in their clinical ITx series were hemodynamically
unstable right after hospital admission, but recovered 22. On this basis, they conclude that
short-term use of high dose vasopressors in unstable donors does not exclude intestinal
donation. At a later stage, marginal circulation seems crucial; high doses of vasopressors
(either > 10 microgr/kg/min of dopamine or (nor)epinephrine) during the donor operation
worsened 3 month survival. None of the donors evaluated in this study were treated with
more than two vasopressors, only one donor needed high (> 10 microgram/kg/min) doses,
and the transplant phase was not studied (all suggested as selection criterion). Therefore,
the results of our study cannot contribute to the discussion on the effect of hemodynamic
instability in the donor and to what extent vasopressive medication can be tolerated.
The “total set” of OPTN criteria - The upregulated heat shock response (HSP-70) and
reduced Claudin-3 staining revealed that grafts from donors not meeting the OPTN criteria
do seem to be inferior. Surprisingly, donors meeting the OPTN criteria did not show superior
88 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
histological Park scores compared to donors not meeting the criteria. Reasons for not meeting
the OPTN criteria were mainly donor type (DCD), age >50 yrs or CIT > 9 hrs. Mean CIT was not
longer in donors not meeting the OPTN criteria; as CIT does seem to be related to histological
outcome, this might explain the lack in the histological discriminative value of the OPTN
criteria or (as discussed before) the ‘critical’ threshold for CIT is unjustly set at 9 hrs. Although
no histological difference was found in dividing between grafts meeting vs. not meeting the
criteria, further subdivision into 3 donor groups disclosed a histological superiority of DBD
grafts meeting the criteria compared to (only) DCD grafts not meeting the criteria (exclusive
of DBD grafts not meeting the criteria). This further supports the selective value of the OPTN
criteria and the assumption that DCD grafts are qualitatively inferior.
The expression of HO-1 - considered as a protective protein in the intestine 42 - was
not statistically different between donor types and/or between grafts from donors that met
OPTN criteria versus those that did not meet these criteria. The lack of differences with regard
to this outcome parameter can be due to the missing reperfusion element in the present
study.
Along with the described findings regarding donor conditions, we observed that the
proximal human small intestine (jejunum) is more sensitive to donation- and preservation
related damage than the more distal ileum. Generally, animal studies are inconclusive
regarding loco-regional vulnerability to transplant damage. Some studies have reported
no immunological, histological or metabolic differences 43-45. Contradictory, the ileum was
claimed to be more resistant than the jejunum 46, but results vice-versa are also described 47.
Balaz et al. specifically studied the loco-regional issue in the human intestinal graft but did
not observe a difference between jejunal and ileal human grafts in susceptibility to ischemia
within 24 hours 48. Results of the latter study cannot be directly compared to our results since
HTK was used as preservation solution while we used UW solution in all but two cases. We
are unable to fully explain why the ileum would be more resistant to preservation injury than
the jejunum. Superior histological villous regeneration in the ileum compared to the jejunum
49 may be partly responsible. The same mechanism might be responsible for the colon being
more resistant than the ileum 50.
We would like to emphasize that the aim of this study was primarily descriptive. An
optimal human study design including defined donor circumstances, sequential pre-defined
preservation intervals and - most importantly - reperfusion/transplantation raises difficulties
both ethically and logistically. The design of the study was subject to logistic constraints that
led to some limitations such as the variable preservation times and donor circumstances and
the lack of assessment after reperfusion or transplantation. Also, the timing of the retrieval
of the intestinal samples after all transplantable organs were retrieved could have negatively
affected our outcome. However, studies on the quality of the human intestinal graft are
scarce and the OPTN criteria have not been evaluated before.
In conclusion, our data confirm the presumed inferior graft quality in DCD grafts
compared to DBD grafts, affirm a discriminative value of the current OPTN criteria for
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
89
5
donation of the intestinal graft and reveal loco-regional intestinal differences in graft
vulnerability to ischemia.
ACKNOWLEDGEMENTS
We are indebted to the transplant coordinators for their support and communication with the
families of the donors, the medical students for collections of donor data and material and we
thank Zeeshan Aktar for English linguistic correction of the manuscript.
90 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
REFERENCES
1. Fishbein, T. M. Intestinal transplantation. N. Engl. J. Med. 361: 998-1008, 2009.
2. Zweers, N., Petersen, A. H., van der Hoeven, J. A., de, H. A., Ploeg, R. J., de Leij, L. F., and Prop, J. Donor brain
death aggravates chronic rejection after lung transplantation in rats. Transplantation 78: 1251-1258, 2004.
3. Avlonitis, V. S., Wigfield, C. H., Kirby, J. A., and Dark, J. H. The hemodynamic mechanisms of lung injury and
systemic inflammatory response following brain death in the transplant donor. Am. J. Transplant. 5: 684-693,
2005.
4. Pratschke, J., Kofla, G., Wilhelm, M. J., Vergopoulos, A., Laskowski, I., Shaw, G. D., Tullius, S. G., Volk, H. D.,
Neuhaus, P., and Tilney, N. L. Improvements in early behavior of rat kidney allografts after treatment of the
brain-dead donor. Ann. Surg. 234: 732-740, 2001.
5. Kusaka, M., Pratschke, J., Wilhelm, M. J., Ziai, F., Zandi-Nejad, K., Mackenzie, H. S., Hancock, W. W., and
Tilney, N. L. Activation of inflammatory mediators in rat renal isografts by donor brain death. Transplantation
69: 405-410, 2000.
6. Jassem, W., Koo, D. D., Cerundolo, L., Rela, M., Heaton, N. D., and Fuggle, S. V. Cadaveric versus living-donor
livers: differences in inflammatory markers after transplantation. Transplantation 76: 1599-1603, 2003.
7. Jassem, W., Koo, D. D., Cerundolo, L., Rela, M., Heaton, N. D., and Fuggle, S. V. Leukocyte infiltration and
inflammatory antigen expression in cadaveric and living-donor livers before transplant. Transplantation 75:
2001-2007, 2003.
8. Nijboer, W. N., Schuurs, T. A., van der Hoeven, J. A., Fekken, S., Wiersema-Buist, J., Leuvenink, H. G., Hofker,
S., Homan van der Heide JJ, van Son, W. J., and Ploeg, R. J. Effect of brain death on gene expression and tissue
activation in human donor kidneys. Transplantation 78: 978-986, 2004.
9. Jassem, W., Koo, D. D., Muiesan, P., Cerundolo, L., Rela, M., Fuggle, S. V., and Heaton, N. D. Non-heartbeating versus cadaveric and living-donor livers: differences in inflammatory markers before transplantation.
Transplantation 75: 1386-1390, 2003.
10. Koudstaal, L. G., ‘t Hart, N. A., Ottens, P. J., van den Berg, A., Ploeg, R. J., van Goor, H., and Leuvenink, H. G.
Brain death induces inflammation in the donor intestine. Transplantation 86: 148-154, 2008.
11. Koudstaal, L. G., ‘t Hart, N. A., Ploeg, R. J., van Goor, H., and Leuvenink, H. G. D. Inflammation and structural
changes in donor intestine and liver after brain death induction. Eur. J. Gastroenterol. Hepatol. 17: A44-A45,
2005.
12. Koudstaal, L. G., ‘t Hart, N. A., van den Berg, A., Olinga, P., van Goor, H., Ploeg, R. J., and Leuvenink, H. G. D.
Brain death causes structural and inflammatory changes in donor intestine. Transplant. Proc. 37: 448-449,
2005.
13. Thuijls, G., de Haan, J. J., Derikx, J. P., Daissormont, I., Hadfoune, M., Heineman, E., and Buurman, W. A.
Intestinal cytoskeleton degradation precedes tight junction loss following hemorrhagic shock. Shock 31: 164169, 2009.
14. Varga, J., Stasko, P., Toth, S., Pristasova, Z., Bujdos, M., and Pomfy, M. Development of jejunal graft damage
during intestinal transplantation. Ann. Transplant. 14: 62-69, 2009.
15. Kawai, M., Kitade, H., Koshiba, T., Waer, M., and Pirenne, J. Intestinal ischemia reperfusion and
lipopolysaccharide transform a tolerogenic signal into a sensitizing signal and trigger rejection.
Transplantation 87: 1464-1467, 2009.
16. Tilney, N. L., and Guttmann, R. D. Effects of initial ischemia/reperfusion injury on the transplanted kidney.
Transplantation 64: 945-947, 1997.
17. Southard, J. H., and Belzer, F. O. Organ preservation. Annu. Rev. Med. 46: 235-247, 1995.
18. Lenaerts, K., Ceulemans, L. J., Hundscheid, I. H., Grootjans, J., Dejong, C. H., and Olde Damink, S. W. New
insights in intestinal ischemia-reperfusion injury: implications for intestinal transplantation. Curr. Opin.
Organ. Transplant. 18: 298-303, 2013.
19. Chong, A. S., and Alegre, M. L. The impact of infection and tissue damage in solid-organ transplantation. Nat.
Rev. Immunol. 12: 459-471, 2012.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
91
5
20. Abu-Elmagd, K. M., Kosmach-Park, B., Costa, G., Zenati, M., Martin, L., Koritsky, D. A., Emerling, M., Murase,
N., Bond, G. J., Soltys, K., Sogawa, H., Lunz, J., Al Samman, M., Shaefer, N., Sindhi, R., and Mazariegos,
G. V. Long-term survival, nutritional autonomy, and quality of life after intestinal and multivisceral
transplantation. Ann. Surg. 256: 494-508, 2012.
21. Mazariegos, G. V., Steffick, D. E., Horslen, S., Farmer, D., Fryer, J., Grant, D., Langnas, A., and Magee, J. C.
Intestine transplantation in the United States, 1999-2008. Am. J. Transplant. 10: 1020-1034, 2010.
22. Fischer-Frohlich, C. L., Konigsrainer, A., Schaffer, R., Schaub, F., Pratschke, J., Pascher, A., Steurer, W., and
Nadalin, S. Organ donation: when should we consider intestinal donation. Transpl. Int. 25: 1229-1240, 2012.
23. Tuttle-Newhall, J. E., Krishnan, S. M., Levy, M. F., McBride, V., Orlowski, J. P., and Sung, R. S. Organ donation
and utilization in the United States: 1998-2007. Am. J. Transplant. 9: 879-893, 2009.
24. Chiu, C. J., McArdle, A. H., Brown, R., Scott, H. J., and Gurd, F. N. Intestinal mucosal lesion in low-flow states.
I. A morphological, hemodynamic, and metabolic reappraisal. Arch. Surg. 101: 478-483, 1970.
25. Park, P. O., Haglund, U., Bulkley, G. B., and Falt, K. The sequence of development of intestinal tissue injury
after strangulation ischemia and reperfusion. Surgery 107: 574-580, 1990.
26. Gondolesi, G., and Fauda, M. Technical refinements in small bowel transplantation. Curr. Opin. Organ.
Transplant. 13: 259-265, 2008.
27. Tzakis, A. G., Kato, T., Levi, D. M., Defaria, W., Selvaggi, G., Weppler, D., Nishida, S., Moon, J., Madariaga, J. R.,
David, A. I., Gaynor, J. J., Thompson, J., Hernandez, E., Martinez, E., Cantwell, G. P., Augenstein, J. S., Gyamfi,
A., Pretto, E. A., Dowdy, L., Tryphonopoulos, P., and Ruiz, P. 100 Multivisceral Transplants at a Single Center.
Ann. Surg. 242: 480-90; discussion 491-3, 2005.
28. Abu-Elmagd, K., Fung, J., Bueno, J., Martin, D., Madariaga, J. R., Mazariegos, G., Bond, G., Molmenti, E., Corry,
R. J., Starzl, T. E., and Reyes, J. Logistics and technique for procurement of intestinal, pancreatic, and hepatic
grafts from the same donor. Ann. Surg. 232: 680-687, 2000.
29. Pascher, A., Kohler, S., Neuhaus, P., and Pratschke, J. Present status and future perspectives of intestinal
transplantation. Transpl. Int. 21: 401-414, 2008.
30. Nieuwenhuijs, V. B., Oltean, M., Leuvenink, H. G., and Ploeg, R. J. Preservation of the Intestine. In A.
Langnas, O. Goulet, E. M. Quigley, and K. A. Tappenden (Eds.), Intestinal Failure Diagnosis, Management and
Transplantation. : Blackwell Publishing, 2009. Pp. 275-282.
31. Cobianchi, L., Zonta, S., Vigano, J., Dominioni, T., Ciccocioppo, R., Morbini, P., Bottazzi, A., Mazzilli, M.,
De Martino, M., Vicini, E., Filisetti, C., Botrugno, I., Dionigi, P., and Alessiani, M. Experimental small bowel
transplantation from non-heart-beating donors: a large-animal study. Transplant. Proc. 41: 55-56, 2009.
32. Matsumoto, C. S., Kaufman, S. S., Girlanda, R., Little, C. M., Rekhtman, Y., Raofi, V., Laurin, J. M., Shetty, K.,
Fennelly, E. M., Johnson, L. B., and Fishbein, T. M. Utilization of donors who have suffered cardiopulmonary
arrest and resuscitation in intestinal transplantation. Transplantation 86: 941-946, 2008.
33. Zapletal, C., Fallsehr, C., Reidel, M., Loffler, T., Gebhard, M. M., Golling, M., and Klar, E. Induction of HSP70
shows differences in protection against I/R injury derived by ischemic preconditioning and intermittent
clamping. Microvasc. Res. 80: 365-371, 2010.
34. Tebbutt, N. C., Giraud, A. S., Inglese, M., Jenkins, B., Waring, P., Clay, F. J., Malki, S., Alderman, B. M., Grail, D.,
Hollande, F., Heath, J. K., and Ernst, M. Reciprocal regulation of gastrointestinal homeostasis by SHP2 and
STAT-mediated trefoil gene activation in gp130 mutant mice. Nat. Med. 8: 1089-1097, 2002.
35. Olson, D. W., Jijon, H., Madsen, K. L., Al Saghier, M., Zeng, J., Jewell, L. D., Bigam, D. L., and Churchill, T. A.
Human small bowel storage: The role for luminal preservation solutions. Transplantation 76: 709-714, 2003.
36. Thuijls, G., Derikx, J. P., de Haan, J. J., Grootjans, J., de Bruine, A., Masclee, A. A., Heineman, E., and Buurman,
W. A. Urine-based detection of intestinal tight junction loss. J. Clin. Gastroenterol. 44: e14-e19, 2010.
37. Furukawa, H., Smith, C., Lee, R., Knisely, A. S., Irish, W., Reyes, J., Abu-Elmagd, K., Starzl, T. E., and Todo, S.
Influence of donor criteria on early outcome after intestinal transplantation. Transplant. Proc. 29: 690, 1997.
38. Abu-Elmagd, K. M., Reyes, J., Fung, J. J., Mazariegos, G., Bueno, J., Martin, D., Colangelo, J., Rao, A., Demetris,
A., and Starzl, T. E. Clinical intestinal transplantation in 1998: Pittsburgh experience. Acta Gastroenterol. Belg.
62: 244-247, 1999.
39. Balaz, P., Kudla, M., Lodererova, A., Oliverius, M., and Adamec, M. Preservation injury to the human small
bowel graft: jejunum vs. ileum. Ann. Transplant. 12: 15-18, 2007.
92 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
40. Koudstaal, L. G., Ottens, P. J., Uges, D. R., Ploeg, R. J., van Goor, H., and Leuvenink, H. G. Increased intestinal
permeability in deceased brain dead rats. Transplantation 88: 444-446, 2009.
41. Oltean, M., Joshi, M., Bjorkman, E., Oltean, S., Casselbrant, A., Herlenius, G., and Olausson, M. Intraluminal
polyethylene glycol stabilizes tight junctions and improves intestinal preservation in the rat. Am. J. Transplant.
12: 2044-2051, 2012.
42. Roskott, A. M., Nieuwenhuijs, V. B., Leuvenink, H. G., Dijkstra, G., Ottens, P., de Jager, M. H., Gonalves Dias
Pereira, P., Fidler, V., Groothuis, G. M., Ploeg, R. J., and de Graaf, I. A. Reduced ischemia-reoxygenation injury
in rat intestine after luminal preservation with a tailored solution. Transplantation 90: 622-629, 2010.
5
43. Stangl, M. J., Schraut, W. H., Moynihan, H. L., and Lee, T. Rejection of ileal versus jejunal allografts.
Transplantation 47: 424-427, 1989.
44. Benchimol, D., Pesce, A., Delque-Bayer, P., Saint-Paul, M. C., Giudicelli, J., Mouroux, J., Taillan, B., Bourgeon,
A., and Richelme, H. Jejunal versus ileal segmental allografts in the dog: comparison of immunologic and
functional results. Surgery 112: 918-927, 1992.
45. Nakao, M., Taguchi, T., Yanai, K., Yamada, T., and Suita, S. Energy metabolism during cold ischemia and
reperfusion in rat small intestinal transplantation: comparison of jejunal and ileal grafts. J. Pediatr. Surg. 32:
1675-1678, 1997.
46. Chan, K. L., Chan, K. W., and Tam, P. K. H. Segmental small bowel allograft - Ischemic injury and regeneration.
J. Pediatr. Surg. 33: 1703-1706, 1998.
47. Takeyoshi, I., Zhang, S., Nomoto, M., Zhu, Y., Kokudo, Y., Suzuki, T., Hamada, N., Nemoto, A., Starzl, T. E., and
Todo, S. Mucosal damage and recovery of the intestine after prolonged preservation and transplantation in
dogs. Transplantation 71: 1-7, 2001.
48. Balaz, P., Kudla, M., Lodererova, A., Oliverius, M., and Adamec, M. Preservation injury of the small bowel graft
in clinical small bowel transplantation. Bratisl. Lek. Listy 108: 516-518, 2007.
49. Rahman, M. S., Taguchi, T., Nakao, M., Yamada, T., and Suita, S. Long-term results of short segmental
syngeneic small intestinal transplantation: comparison of jejunal and ileal grafts. J. Pediatr. Surg. 31: 908-911,
1996.
50. Kawashima, Y., Takeyoshi, I., Furukawa, H., Lee, R. G., and Todo, S. Ischemia and reperfusion injury of the
human colon and ileum. Transplant. Proc. 28: 2624-2625, 1996.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
93
94 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
CHAPTER 6
SMALL BOWEL PRESERVATION
FOR INTESTINAL TRANSPLANTATION: A REVIEW
Anne Margot C. Roskott1, Vincent B. Nieuwenhuijs1, Gerard Dijkstra2, Lyan G. Koudstaal1,
Henri G.D. Leuvenink1, Rutger J. Ploeg1
Affiliations
Department of Surgery1, Department of Gastroenterology and Hepatology2, University Medical Center Groningen
ABSTRACT
Intestinal transplantation (ITx) has become the therapy of choice for patients with intestinal
failure and life-threatening complications from total parenteral nutrition. Results, however,
remain inferior compared to other transplant types with the quality of the organ graft as the
most important factor of outcome after transplantation. The intestine is extremely sensitive
to ischemia. Unfortunately, a relatively long ischemic preservation period is inevitable. The
current standard in organ preservation (cold storage (CS) with UW solution) was developed
for kidney/liver preservation and is suboptimal for the intestinal graft despite good results for
other organs.
This review aims to appraise the results from previous and current solutions and
techniques to identify keys for improvement. As the studies available do not reveal the
most effective method for intestinal preservation, an optimal strategy will result from a
synergistic effect of different vital elements concluded from the literature. A key factor is
the composition of the solution using a low-viscosity solution to facilitate washout of blood,
including amino acids to improve viability, impermeants and colloids to prevent edema, and
buffer for PH-homeostasis. Optimizing conditions include a vascular flush before CS and
luminal preservation. The best composition of the luminal solution and a practical, clinically
applicable delicate technique are yet unknown. Brief oxygenized arterial and/or luminal
perfusion have to be considered.
Thus, a tailored luminal preservation solution and technique need further investigation
in transplant models and the human setting to develop the ultimate technique meeting the
physiological demands of the intestinal graft during preservation.
96 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
INTRODUCTION
Intestinal Transplantation (ITx) has become an established treatment for intestinal failure
(IF) when parenteral nutrition (PN) fails 1. ITx is a challenging procedure. Long-term outcome
remains inferior compared to other solid organ transplants, despite significant improvement
over the past 20 years 2;3. Postoperative infectious complications and rejection are the main
limiting factors. Results need further improvement to replace PN as primary treatment for IF
since long-term PN is associated with life-threatening complications and a poor quality of life.
Graft viability prior to implantation is a key factor in the outcome after organ
transplantation 4;5. Along with brain death in the donor, surgical manipulation, and ischemiareperfusion injury (IRI), preservation damage is one of many essential factors that affect the
quality of the intestinal graft and its barrier function 6-10. The compromised barrier function
induces inflammatory upregulation and bacterial translocation (BT), predisposing the
recipient to rejection and infectious complications (fig 1).
Figure 1 Hypothetic relation between graft damage and outcome after ITx
Brain Death in the donor
Preservation
Ischemia-Reperfusion-Injury
Quality of the
Intestinal Graft
Intestinal
inflammation
Compromised
intestinal barrier
Bacterial
Translocation
Inflammatory mediators/
immuno-inflammatory
upregulation
Sepsis
Transplant failure
Rejection
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
97
6
Figure 2 Principles of organ preservation
Principles of Organ Preservation
Devascularization
Metabolic & cellular distress
‘The temperature effect’
effect’
•Hypothermia (4ºC) to reduce metabolism
Hypothermia: negative effects
•Edema
•Acidosis
•Reactive oxygen species (ROS)
‘The solution effect’
effect’
•Preservation solution to propagate
physiological/biochemical conditions &
counteract negative effects of cold
ischemia
•Impermeants & colloids
•Buffers
•Biochemical agents
Mucosal cells remain relatively active at 4ºC
The intestinal mucosa is extremely vulnerable to injury resulting from hypoperfusion 11;12.
Unfortunately, ischemia is inevitable during preservation to bridge the gap between donor
and recipient. In figure 2 the key principles of organ preservation are illustrated. The lack of
an adequate strategy to preserve the intestinal graft allows only a short (6-10 h) preservation
span and results in variable degrees of tissue injury 13 limiting the clinical success of ITx. Better
intestinal preservation (IP) is a first step to improve the results of ITx.
98 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
The intestine has the complex dual task to digest and absorb nutrients while maintaining
a selective barrier against the external environment. The intestinal mucosa is composed of
surface-increasing, fingerlike (villous), absorptive columnar epithelium covering the lamina
propria, which hosts blood vessels and lymphatics. In the crypts, at the base of the villi, the
intestinal stem cells reside, which are pivotal for regeneration and repair. The absorptive
columnar enterocyte is the main epithelial cell: characterized by its apical microvilli, which
contain transport proteins and digestive enzymes. The intestinal transcellular barrier is primarily
based on selectively permeable epithelial enterocytes. Passive paracellular passage between
cells, however, would nullify this transcellular barrier without the intercellular sealing junctions.
Especially the tight junction proteins (TJ) are critical for a proper barrier function. Unfortunately,
these pivotal epithelial enterocytes and TJ are very sensitive to hypoperfusion 8;14.
To identify key factors for improvement, this paper appraises the results of attempts to
alternative strategies reported in the literature. Table 1, outlines the characteristics of the
studies reviewed.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
99
6
Table 1 Characteristics of reviewed studies
Reference:
Author, journal, year
Purpose/Aim
Materials & methods
Study design: Species and
total sample size
Materials & methods
Study design:
Experimental groups
Materials & methods
Surgical/ experimental procedure
Animal studies
Rodriguez,
J. of Invest. Surg., 1994
Evaluate determinants of failure PS grps.:
after 24h IP and ITx and the
-control, saline flush
effects of different PS
-no vasc. flush, 6h CS
-no vasc. flush, 24h CS
IP and Tx study
-vasc. flush + CS: EC
Syngeneic ITX model
-vasc. flush + CS: UW
-vasc. flush + CS: ADAAV
Spraque-Dawley rat N=107
Entire small intestine
Lum. flush 30-40ml neomycin +
saline
+/- ex-vivo vasc. flush 8ml
respective preservation solution
(RPS), CS 24h 4-7°C
Muller,
Transplantation, 1994
Delineate most optimal PC and 1st part PC grps.:
PS for IP
a. rewarming before reperf.
b. 2nd vasc. flush after CS
IP and Tx study
(for all PC CS with ECF)
Syngeneic heterotopic ITx
model
2nd part PS grps.: (in proofed
Lewis rat N=66
optimal PC)
7 PS grps.: UW/ EC/ HTK/ PBS/
ECF/ LF/ LF2 /saline
Entire small intestine retrieved
Lumen rinse 2-3 ml RPS
Vasc. flush with 1,5 ml RPS+
neomycin
CS in RPS + neomycin 12h 4ºC
Kokudo,
Transpl. Proc., 1994
Determine optimal PS for ITx
PS grps.:
Vasc. flush and CS
UW/ EC/ RL
Entire small intestine
Vasc. flush 20 ml RPS + lum. flush 40
ml cold NaCl 0,45%+2,5% glucose+
neomycin)
CS in RPS for 0, 6, 12, 18h 4ºC
Ito,
Transpl. Proc., 1995
Effect of luminal GLN to RL on
IP graft injury in ITx
PS. grps .:
vasc./ lum. perfused
preservation:
1. RL+GLN/ RL+GLN
2. RL+GLN/ RL
3. RL/ RL
Jejunum 10cm segments
Lum. flush saline + AB
24h perfusion at 4ºC according to PS
grps. (vasc./lum.)
IP and Tx study
Syngeneic orthotopic ITX model
Lewis rat N=?
NB. Rats fasted for 18h and pretreated with oral neomycin
IP study
Mongrel dog N=?
Mueller,
Transpl. Proc., 1996
Identify most optimal PC & the 1st part PC grps.:
role of PS
a. rewarm. before reperf.
b. vasc./ lum flush after CS with
IP and Tx study
saline
Syngeneic heterotopic ITx
c. temp. 8ºC/ 4ºC
model
d. pH 7.4/ 6.8
Lewis rat N=66
(for all PC grps. CS with ECF)
NB. ITx with bowel ostostomy
to abdominal wall, POD 10
anastomosis after native bowel
excision
Entire small intestine retrieved
Lumen rinse 2-3ml RPS+ neomycin
Vasc. flush 1 ml RPS.
CS in RPS + neomycin 12h 4ºC
2nd part PS grps.:
UW/ EC/ PBS/ HTK/ ECF (all grps.
rewarm., no 2nd flush)
100 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
Materials & methods
Outcome parameters and
assessment time points
Comments
Strength/ weakness /
remarks
Results (p<0,05)
Conclusion
-3-day survival 80% control vs.
66,6% ADAAV, 53,5% UW, 46,6% EC,
ADAAV= n.s. diff. control
-no survival if no vasc. flush
-biochemical/ histology no diff.
between PS
-no >14 day survival for any of PS
grps.
-no PS can preserve rat
intestine under hypothermia
for 24h
-no survival >14 days in any
of PS grps.
-factors of failure: IP
injury was expressed as
hemorrhagic necrosis &
sepsis after 24h of IP
Parameters:
Survival (POD7), histology,
glutaminase activity (reflects
enterocyte integrity)
Time points:
20 min after reperf. and at POD7.
PC
-outcome optimal when vasc. flush
after CS is omitted and topical
rewarm. with 37ºC saline i.p.
performed: 4/6 surv. (67%) for IP
Different PC have an impact Surplus value:
on graft surv. and PBS might 2-part study, compares PC
be preferable to any of the
and PS
other PS tested
Parameters:
Survival, electro-fysiol.
enterocyte & crypt cell function
(ussing chamber), histology(Park
Score)
Time points:
After CS, 1h after reperf., survival
-surv. decreased with CS time
-at 0,6,18h no diff. in surv.
-after CS 12h CS, less surv. for UW
than other PS
-cell function better RL & C than UW
(6/12h CS)
-for rat IP, UW not superior
to EC or RL
-12h CS with UW: decreased
surv.
-crypt cell function better
with RL/EC than UW
Information lack: survival
duration and numbers of
animals
Parameters:
Amino acids in perfusate, GLN
metabolism
Tissue morphology, viability of
enterocytes, enterocyte protein
synthesis
Time points: after 24h perfused
preservation
-Villus structure best in group 1: lum.
GLN favors epithelial cells at tip of
villi, vasc. GLN favors crypt cells
-GLN favors number of epithelial
cells, viability and protein metabolism
-optimal PS for the intestine
has not been established
-lum. + vasc. perfused IP with
RL + GLN favors mucosal
intestinal cells and is useful
for IP
Weakness:
GLN supplementation
concentration not
mentioned.
Parameters:
Survival, histology, glutaminase
activity, Park score
Time points:
20 min after reperf. and at POD7
PC
-surv. better (4/6) with PC: 4ºC, Ph
6.8, no extra vasc./ lum. flush after
CS, topic rewarm. before reperf. vs.
1/6 no rewarm, 2/6 vasc. flush, 0/6
vasc.+lum. flush
-surv. depends on PC: vasc.
washout, vasc.+ lum. flush
after CS decrease surv.
-topic rewarm. with 37ºC
saline i.p. beneficial
-pH 6.8 better than 7.4
-best PC: no flush after CS,
pH 6.8, topic rewarm. at
reperf.
-no diff. results for diff. PS
Flush after CS is detrimental,
possibly by mechanical
damage to microvasculature
Parameters:
lactic acid, SGPT, SGOT, LDH,
histology, lum. glucose conc.,
survival, clinical evaluation,
determinants of failure
Time points:
1h after ITx
Surv. early/ late= 3/>3 days
Strength:
Studies (causes of) death
and graft failure in relation
to diff. PS.
Remark:
Best luminal glucose uptake
in UW, however these were
not the grafts with best
survival.
6
PS
-no diff. in surv.
-histology 20 min. reperf. minor diff.
b) glutaminase activ. > 20 min reperf.
for PBS
PS
-surv. UW, EC, ECF (4/6), HTK (3/6),
PBS (5/6)
-glutaminase activity after 20 min.
reperf. better for PBS
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
Remark:
Histological damage severe
in most grps. but recovered
at POD7
101
Table 1 Characteristics of reviewed studies
Reference:
Author, journal, year
Purpose/Aim
Materials & methods
Study design: Species and
total sample size
Materials & methods
Study design:
Experimental groups
Materials & methods
Surgical/ experimental procedure
Animal studies
Kokudu,
Transpl. Proc., 1996
Study the effect of lum. flush
on mucosal injury during/ after
cold ischemia
PS. grps.:
Vasc. flush RL
- control: no CS
- lum flush RL
- no lum flush
CS with RL
Vasc flush RL, +/- lum. flush with RL
according to exp. gr.
CS RL 4ºC 12h,
re-oxygenation in Krebs medium
IP study
Lewis rat N=74
PS grps:
Vasc., lum. flush and CS:
-Saline
-UW
-UW + 1/ 2/ 4 % GLN
-UW+ 1/ 2/ 4% NEAA
Jejunum segment
Vasc. flush 5ml RPS, lum. flush 20 ml
RPS according to PS grps.
CS 18h in RPS 4°C
Evaluate potential of CLS to
protect the intestine during
ischemic CS
PS grps.:
Vasc. flush, lum. flush and CS
UW/ CLS
IP and in-vitro isolated (re)
perfusion study
Wistar rat N=18
NB. Control samples from vital
intestines
Segments 15 cm jejunum. Vasc. flush
RPS + lum. flush 10-15 ml of RPS
CS in RPS 18h 4ºC
Reperf. in-vitro (after vasc. flush 5 ml
NaCl 37ºC) in NaCl organ bath, nonrecirc. vasc. flow (5 ml/ min) with
Krebs + 5% dextran 78 + 95% O2 +
5% CO2, lum. flow saline + galactose
(0,5ml/min)
IP + in vitro reperf. study
Lewis rat N=18
Sasaki,
J. of Surg. Research,
1997
Minor,
Transpl. Int., 1998
Olson,
Am J. Transpl., 2001
To prove that UW + GLN
improves intestinal quality
after CS
Study the requirements for
PS. grps.
In vivo vasc. flush with RPS
impermeant (osmotic/ oncotic) Vasc. flush and CS
Entire intestine retrieved
support in IP
-NaCl
CS 0, 1, 2, 4, 10h with 30 ml. RPS 4ºC
-NaCl+5% Dextran
IP study
-NaCl +100mM LB +5% Dextran
Spraque-Dawley rat N=16
-UW
NB. Rats fasted
Olson,
Transplantation, 2002
To test if BES (buffer)
potentiates the effect of vasc.
GLN during IP by regulating PH
IP study
Spraque-Dawley rat N=16
Fujimoto,
Am. J. of Transpl., 2002
To assess if a lum. tailored PS
protects the intestinal graft
during IP
IP study
Spraque-Dawley rat N=20
102 PS. grps.
Vasc. flush and CS
- UW
- UW+BES (UWB)
- UW+GLN (UWG)
- UW+GLN+ BES (UWBG)
In vivo vasc. flush with RPS
Entire intestine retrieved
CS 4, 10h in RPS 4ºC
PS grps.:
All grps. UW vasc. flush
-Control: no lum. flush, CS UW
-Lum. flush and CS UW
-Lum. flush and CS UW+GLN
-Lum. Flush and CS AA1 (Table 2)
-Lum. Flush and CS AA2 (Table 2)
Rats fasted
Entire intestine retrieved
In vivo UW vasc. flush
Lum. flush with 20 ml RPS, distal
ileum closed, infusion of 7-8 ml→
CS in RPS for 1, 2, 4, 10, 24h 4ºC
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
Materials & methods
Outcome parameters and
assessment time points
Results (p<0,05)
Conclusion
Parameters:
Electrophysiological function
(ussing chamber): PD/ R,
morphology by EM, apoptosis
-function (PD) preserved by lum.
flush, R not
-lum. flush causes more apoptotic
changes
-lum. flush decreases
mucosal injury but does not
prevent apoptosis,
-more protection is needed
for a longer IP span
Remark;
decreased barrier function at
12 h IP as a result of mucosal
destruction
-glucose transport better in
UW+2/4% GLN vs. UW
-histology & mucosal enzymes better
in UW+ 2/4 % GLN (4% not better
than 2%) vs UW
-4% NEAA increased glucose
transport, villous height and mucosal
protein vs. UW
-addition of 2/4% GLN to
UW decreases mucosal
damage in rat intestine
-2% GLN is optimal for IP
Surplus:
Addresses effects of diff.
conc. of GLN
After CS
-no diff. CLS/UW for edema/energy/
CP after CS
-Lactate less in CLS
-Histology no diff.
CLS may be a suitable
alternative for IP: within
limits of in-vitro pilot study,
CLS better post-ischemic
recovery of intestine than
UW (vascular perfusion
characteristics, enzyme
release, galactose absorption)
Remarks:
Tissue edema measured:
both PS equally prevent
increase in tissue water
content
Less glucose content for CLS
Time points: after CS and after
re-oxygenation
Parameters:
Glucose transport, mucosal
protein, maltase, AF, villous
height, histology
Time points:
After 18h preservation
Parameters:
Vasc. resistance at reperf.
Metabolic & functional integrity
(edema, energy, glucose,
lactate, creatine phosphate
(CP), histology, oxidative
tissue injury (ROS), effluent
LDH and lipid peroxides (LPO),
intestinal galactose absorption,
transcapillary fluid loss
Time points: After CS, during
reperf.
Reperfusion
-vascular resistance and LDH release
in perfusate less for CLS and better
galactose absorption for CLS
Comments
Strength/ weakness /
remarks
Remark:
4% NEAA superior to UW:
osmolarity effect?
Parameters:
-energetics as fresh tissue at all times
Energetics (ATP/ TA), radio-active for NaCl +LB+ Dextran group vs.
Mannitol permeability., histology decrease in energy for NaCl and UW
-ATP best for UW
Time points:
-function (permeability) better for
At t=0, 1, 2, 4, 10h after CS
NaCl +LB+ Dextran vs. UW
-UW and NaCl histological damage
vs. intact microvilli for NaCl +LB+
Dextran group
-NaCl +LB+ Dextran group
Remark:
less histological damage and All groups showed a
better cell function after 10h decrease in ATP after 4h CS
CS compared to UW or NaCl
-osmotic and oncotic
agents are a fundamental
requirement for IP
Parameters:
Energetics (ATP/ TA), barrier
function, GLN catabolism,
histology (light microscopy
and EM)
-increased GLN use in UWBG
-UWBG higher energetics after 10 hr
vs. other grps.
-barrier better for UWBG after 10
hrs. CS
-histological injury + structural
damage less for UWBG vs. UW/ UWG
The positive effect of GLN
supplementation to UW is
amplified when combined
with BES buffer
Strength:
Addresses the metabolic
principle that GLN
metabolism without hepatic
detoxification causes nonphysiologic PH shifts.
-All grps. but UW vasc. + lum.
flush better energetics over 10h vs.
control/ UW vasc., by 24h no diff.
-UW vasc.+AA1/AA2 lum. better
function after 10h vs. control/ UW
vasc., only AA2 barrier ~ fresh tissue
at 10h
- least damage with AA2
-good correlation Park score and
other parameters
-A luminal PS based on
physiologic requirements
(AA2: 18 AA’s, BES, LB)
provides targeted IP and
protects intestinal graft quality
-AA2 showed best results
-vasc. PS alone is unable to
protect the intestinal barrier:
lum PS decreases epithelial
injury in-vitro
Remark:
Lum. nutritional support
(AA) improves cellular
energy and barrier function
after < 10h CS, but also
causes non-energy-related
benefit
Time points:
At t= 4, 10h after CS
Parameters:
Energetics, histology (Park score),
functionality (permeability in
ussing chamber with mucosa
stripped)
Time points:
At t= 1, 2, 4, 10, 24h after CS
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
6
NB! Table 1 gives
composition of AA solution
103
Table 1 Characteristics of reviewed studies
Reference:
Author, journal, year
Purpose/Aim
Materials & methods
Study design: Species and
total sample size
Materials & methods
Study design:
Experimental groups
Materials & methods
Surgical/ experimental procedure
Animal studies
Leuvenink,
Transpl. Proc., 2005
Compare luminal PS of rat
intestine with UW/ CLS
IP study
Wag Rij rat N=18
Salehi,
Transplantation, 2005
Effect of nutrient rich (aminoacid AA) lum. PS in rat ITx
PS grps.:
All grps. vasc. flush UW
-no lum. PS
IP and ITx study
-UW lum. flush
Syngeneic orthotopic ITX model -AA3 (Table 2 review) lum. flush
Lewis rat N= 15
Rats fasted
In vivo UW vasc. flush
Entire intestine retrieved
Lum. flush according to PS grps
(40ml PS at max 40 cmH2O)
CS 6 h 4ºC
NB! vasc. flush RL after CS, no lum
flush after CS
Wei,
W. J. Gastroent., 2007
Compare Polysol (P) with UW/
CLS/HTK for IP
Entire small intestine
Vasc. flush 10ml RPS, lum. flush
saline 20 ml., RPS 15ml
CS 18h according to lum. PS grps.
30 min in vitro reperfusion (in Krebs
medium)
PS grps.:
Lum. flush and CS
- UW
- UW+GLN
- CLS
PS grps.:
Vasc., lum. flush and CS:
-UW
IP study and 30 min. isolated
-CLS
reperf. in vitro Wistar rat N=28 -HTK
-P
Intestinal segments
No vasc. flush
Lum flush RPS
CS for 0, 2 ½ , 24h in RPS 4°C
NB. Rats fasted 24h
Human studies
Olson,
Transplantation, 2003
Test if results with lum. PS in
rat can be reproduced in human
setting + find a feasible method
for lum. IP
IP study
Human intestine from MOD
N= 9
DeRoover ,
Trans. Proc., 2004
Compare UW and CLS vasc. PS
for human IP
IP study
Human intestine from MOD
N=8
DeRoover,
Transpl. Proc., 2004
Magnus,
Transplantation, 2008
Vasc. in-vivo UW flush,
Entire intestine divided in 3 segments
for IP according to PS grps.
(lum.: 400 ml RPS (90 cm H20)+ fill
50-75 ml & close)
CS 24h with RPS (as for lum. flush)
PS. grps..
-Control: UW vasc. flush
-CLS vasc. flush
During MOD proce-dure 2 ileal
segments retrieved for IP according
to PS grps.
CS in RPS for 0, 6, 12, 24h 4ºC
No lum. IP
Impact of lum. contact with
UW during 12 hrs. CS on
intestinal integrity
IP study
Human intestine from MOD
N=10
PS grps.
-control: UW vasc. flush
-UW vasc. + lum. flush
Compare HTK and UW for
human IP+ ITx
Compares clinical results/
outcome from HTK/ UW
preserved (vasc. flush + CS)
intestinal grafts
Retrospective clinical review
Human ITx N=57
104 PS grps.:
Vasc. flush UW,
Intestine from 1 MOD
-control: no lum. flush
-UW lum. flush (UWL)
-AA lum. flush (AAL)
MOD procedure, UW vasc. flush,+/lum UW according to PS grps.
CS 0, 3, 6, 12h with UW 4ºC
Lum. UW: antimesenteric side cut
open!
Reviews ITx & (modified)
multivisceral ITx results 2003-2007
Immunosuppression: Induction:
steroid, ATG, antiCD20-Ab,
Maintenance: Prograft/ tacrolimus
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
Materials & methods
Outcome parameters and
assessment time points
Results (p<0,05)
Conclusion
Comments
Strength/ weakness /
remarks
Parameters/ time points:
Park score after CS, injury
markers (LDH/ glucose/ lactate)
in PS after 0, 2 ½, 24h CS
Injury starts at 2½h CS
-damage markers > for CSL Remark:
Injury markers less in CLS vs. UW, but lum. than UW lum., but still Histological damage to
still severe histological damage
severe histological damage
jejunum more than ileum
-in addition to vasc. IP
alternative lum. PS is needed
Parameters:
14-day survival, histology,
energetics, tissue oxidative stress
(MDA, glutathione), neutrophil
recruitment (MPO)
Time points:
After CS, 35 min. reperf, POD
3,7,14
-AA3 lum. 100% 7-day and 80% 14day survival vs. no survival > 12h for
other groups.
-ATP levels rise after 35 min. reperf,
highest rise for AA3 lum.
-oxidative stress low in AA3 gr. over
14 days, high in other grps.
-neutrophil recruitment reduced and
improved histology for AA3
-AA3 lum. gr. showed better
results on all endpoints and
resulted in full regeneration
of histology at POD 14:
-lum. flush with nutrient rich
(AA3) PS improves overall
graft viability when tested
in a small animal model of
orthotopic ITx
Parameters and time points:
Integrity (EM), function
after CS
after 30 min in vitro reperf.:
tissue lipid peroxidation, O2
uptake, ATP, LDH and apoptosis
markers in effluent
-ATP: P higher than UW/ CLS, HTK
higher than UW
-LDH release: UW less than P
-peroxidation: UW less than all other
grps.
-O2 uptake: P better than all other
grps
-apoptosis: UW less than all other
grps.
-EM: P better than all other grps.
IP with P improves graft
quality on some parameters,
UW shows worst trends
Parameters:
Energetics, histology
permeability (ussing chamber ,
NB! stripped mucosa)
-UWL/AAL improved barrier over 24h
- UWL/AAL better histology at 12h
(24h no diff.)
-UWL better energetics at 24h vs.
AAL, but n.s. diff. from control (UW
vasc.), strange!: diff. from rat because
full thickness samples were assessed
in rat?
For human IP, AA lum. not
superior to UW lum, but
both lum. PS superior to UW
vasc. alone
Remark:
Human mucosal injury
became evident after 4h
CS; human intestine better/
more resist ant to ischemia
compared to rat intestine
-histology equal in diff. PS
No diff. for human intestinal
-damage starts after 6h CS at apex
histology after CLS/ UW
of villi, after 12h epithelial sloughing, vasc. flush and CS over 24h
partial villous loss, finally full mucosal
damage after 24h CS
Remark:
Absent superiority of CLS
also seen in experimental
setting (Minor, Transpl. Int.
1998)
-control: damage starts after 3hrs.
CS, at 12h villous tissue loss +
detachment from BM
-UW vasc. + lum. showed improved
mucosal structure at all time points
Delayed damage pattern
seen when UW lum. PS is
used after UW vasc. flush
for human IP vs. “closed”,
standard CS with UW
Remark:
Histological damage starts
at 3 h CS using clinical
standard IP
-57 ITx: 22 UW/ 35 HTK IP
-no diff. in early graft function/ scopy
results / rejection
-no pancreatitis in grafts including
pancreas (44)
-no diff. in patient/ graft survival at
POD 30 and 90
UW & HTK show similar
results of 30/90 day graft/
patient survival, initial
function, endoscopy results,
rejection, or Tx pancreatitis
for IP followed by clinical ITx.
Remarks:
-UW possibly superior for
longer CS, this series max.
14h CS
-clinically better blood
washout of arterioles with
HTK vs. UW
Time points:
At 0, 4, 8, 12, 24h CS
Parameters:
Histological Park score
Time points:
At 0, 6, 12, 24h CS
Parameters:
Histological Park score
Time points:
At 0, 3, 6, 12, 24h CS
Outcome parameters:
Primary outcome: graft & patient
survival, early graft function,
rejection episodes
Also results from 2-weekly
surveillance scopy +biopsy
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
6
Weakness: Used method for
lum. IP not clinically feasible
105
Table 1 Characteristics of reviewed studies
Reference:
Author, journal, year
Purpose/Aim
Materials & methods
Study design: Species and
total sample size
Materials & methods
Study design:
Experimental groups
Materials & methods
Surgical/ experimental procedure
Perfused +/- oxygenized IP
Toledo-Pereyra.,
Archives of Surgery, 1973
Compare oxygenized perfusion
(perf.) and non-perfusion (CS)
for IP and ITx
IP and ITx study
Orthotopic alloTx model
Dog N=24
IP grps.:
Oxygenized perf. / non-perf.
(CS) IP
4 grps.
-Mox-100 pulsatile perf. 24h
-Mox-300 pulsatile perf. 24h
-non-perf. Collins (CS) method
24h
-6 hrs. CS + 18h pulsatile perf.
Dogs fasted 5 days
Toledo-Pereyra,
Surgery, 1974
Compare survival of fresh
intestinal grafts with survival
of grafts preserved by hypothermic bloodless perf.
IP and ITx study
Orthotopic alloTx model Dog
N= ?
Kuroda,
Transplantation, 1996
IP groups:
-control: no CS
1. C2LM: UW lum. +CS in PFC
with O2
2. UW lum. + CS in PFC without
IP and ITx study
O2
heterotopic segmental auto-ITx 3. CS in UW
model
4. CS in UW + O2
Lewis rat N=51
Rats fasted overnight
IP and ITx study
Heterotopic, segmental alloTx
model
Beagle dogs N= 28
Perfusate: CPP + extra’s
Lum. Xylose (100gr/L) infused at
start of perf.
CS: Collins PS+ extra’s
Perf. system: pH 7.4, 7°C, O2,
200mmHg, pulse freq. 60/min,
pressure 60mmHg.
Entire intestine retrieved, lum.
drainage, vasc. flush with RL,
followed by IP according to IP grps.
Perfus: 7°C, pH 7.4, PO2 200mmHg,
60 beats/ min, 60mmHg
NB! both perfusate contain
extra’s
Assess ability of the cavitary
2-layer method (C2LM) to
prolong the IP time of rat
intestine.
Tsuijmura,
Assess quality of canine
Am Journal of Transplantation, intestinal graft after 24h IP
2002
using the C2LM as CS method
106 IP grps.
-control: fresh grafts/ no IP
-hypothermic pulsatile perf. with
canine CPP
-hypothermic pulsatile perfus.
with human plasmanate
Entire intestine retrieved, 24h–perf.
grps. ex-vivo vasc. flush with RL 4°C,
other grps. vasc. flush with Collins
IP according to IP grps.
IP grps.:
-control: no CS
-CS with UW
-CS with C2LM: UW lum. +CS in
PFC + O2
Dogs fasted 24h
15-cm jejunum retrieved
in vivo vasc. flush RL+ heparin, lum.
cleaned with RL & Gentamycin
lum. + vasc. flush UW
IP according to IP grps.
24, 48h 4°C
C2LM: UW/PFC, lum. UW, graft
immersed in PFC (=95%O2
+5%CO2)
40cm jejunum. segments isolated,
lum. cleaned with RL +neomycin,
then filled with 30 ml UW 4°C,
backtable vasc. flush with RL+
heparin & with UW
IP according to IP grps. 24h
!After IP lum. cleaned with RL, vasc.
flush RL+ heparin
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
Materials & methods
Outcome parameters and
assessment time points
Results (p<0,05)
Conclusion
Comments
Strength/ weakness /
remarks
Parameters:
Function restoration ITx
survivors; daily exam, xylose
absorption , postmortem exam
Perfusate flow/ pressure/ vasc.
resistance, fluid loss, weight gain.
Perfusate: lactate, O2 use,
xylose
Time points:
During IP/after ITx
-no diff. in flow rate, perf. pressure,
vasc. resistance
-all 6 dogs in 24h CS/ static gr. died
<2 days
-both 24h perf. grps. >20 day surv.:
and returned to normal xylose
absorption (bowel function) POD3
-clinical differences not striking:
weight loss, anemia, hypoproteinemia, anorexia, diarrhea in
most dogs
-24h cold, pulsatile ,
oxygenized perf.(with this
perfusate) shows better
outcome than 24h CS in
electrolyte (Collins) solution
-possible place for perf. IP for
future longer clinical storage
times
Remarks:
-hemorrhagic necrosis in
non-perfused grafts vs.
no evidence of edema/
hemorrhage/ ischemia in
perf. grafts
-rejection appeared several
weeks after ITx
Parameters and time points:
-Perfus.: intestinal. output,
haemo- dynamics, composition
of perfusate 2-24h Absorptive
capacity (D-xylose test/ VitA).
Intralum. samples: proteins,
globulin, electrolytes à 6h
-PostITx: biopsy at reperfus.,
daily clinical exam, blood
sample/2 days, D-xylose + VitA
test weekly. Survival
-perf. grps. no diff. (O2 use, D-xylose
test) after 24h perf. IP, characteristics similar, fluid loss slightly more
vs. control
-Perf. grafts histologically almost
normal after IP
-control gr. surv. >2wks
-perf. IP grafts surv. better than
control, best surv. with human
plasmanate as perfusate.
Moderately immunosuppressed dogs surv. longer
after orthotopic ITx with
preserved grafts than fresh
grafts; when hypothermic
bloodless perf. with canine
CPP or human plasmanate is
used for IP.
Suggests evidence that
animals & humans possess
AB against tissue antigens
of xenogenic species which
bind during hypothermia
interfering with perception
of allogenic antigens of graft
Parameters and time points:
Daily clinical exam, 7-day surv.,
histology POD7
-7-day surv. after 24h IP grps. 1-4:
100, 80,86,80%
-7 day surv. after 48h IP 86,20,0,0%,
most deaths due to intralum.
bleeding/ graft necrosis
-histology: most grafts highly
damaged from IP/ IRI
-gr.1 after 24h IP normal mucosa, mild
damage after 48h
Oxygenation of the intestine
during IP using cavitary
2-layer PFC//UW method
extends IP time up to 48h in
this model
Remark:
Segmental heterotopic ITx
was suggested to show a
different rejection pattern
and will not answer the
question of bowel function
if recipient would be
dependent on graft only.
Parameters and time points:
-7-day surv., graft morphology
POD 7
-POD7 functional analysis:
maltose & acetaminophen
absorption tests
-histology: 1h reperf. & POD4
-survival.: 11/12 dogs died in CS
with UW gr., most deaths < 24h:
hemorrhagic necrosis
vs. 8/8 dogs survival POD7 in C2LM
gr./control gr.
-histology: 1h reperf.: all grps. loss
of villous tissue, day 7: normal in
control/ C2LM gr., vs. loss of villous
height in UW gr.
-absorption: control/ C2LM similar
all time points, vs. UW gr. inferior
function
In this segmental canine
alloTx model, the intestine
was successfully preserved by
CTLM for at least 24h, while
this IP time was beyond the
limit with UW.
Remark:
CTLM method is simple,
cheap, practical, safe &
without unfavorable effect
while continuously supplying
O2 to the intestine
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
6
107
Table 1 Characteristics of reviewed studies
Reference:
Author, journal, year
Purpose/Aim
Materials & methods
Study design: Species and
total sample size
Materials & methods
Study design:
Experimental groups
Materials & methods
Surgical/ experimental procedure
Perfused +/- oxygenized IP
Zhu,
Transplantation, 2003
Test if oxygenized lum. perf.
(UW) facilitates energy
production and preserves
mucosal barrier during long IP
IP study
Spraque-Dawley rat N=16
Guimares,
Transpl. Proceedings, 2006
108 Assess apoptosis and nuclear
proliferation in rat intestine
after hypo- thermic hyperbaric
oxygenized IP
IP study
Wistar rat N=20
IP grps.:
All grps. vasc. flush UW
-CS UW 24h
-lum. flush UW + CS UW 24h
-1h lum. perf. with UW+O2., 23h
CS with UW
-24h lum. perf. with UW+O2
Rats fast overnight
Vasc in vivo flush 10ml UW, entire
intestine retrieved, IP according to
IP grps.
lum. flush: 20ml UW, lumen filled
perfus.: after lum. flush recirculating
perfus. UW (20ml/min) +
ciprofloxacin +100% O2, 4°C
IP grps.:
-12h CS with RL
-12h CS with hyperbaric O2
-24h CS with RL
-24h CS with hyperbaric O2
In vivo vasc. and lum. flush with?
3 cm. jejunal segments preserved
according to IP groups
Abbreviations used in the table:
activity (activ.), adenosine triphosphate (ATP), alkaline phosphatase (AF), amino acid (AA), antibiotics (AB),
anti-thymocyte globulin (ATG), albumin-dextran-adenosine-allopurinol-verapamil solution (ADAAV),
N,N-Bis(2-hydroxyethyl)-2-aminoethanesulfonic Acid (BES), cavitary 2-layer method (C2LM), Celsior
solution (CLS), concentration (conc.), cold storage (CS), creatine phosphate (CP), cryoprecipitated plasma
(CPP), difference (diff.), electro-physiological (electro-physiol.), electron microscopy (EM), Eurocollins
solution (EC), extracellular fluid (ECF), glutamine (GLN), group (gr.), groups (grps.), histidine tryptophan
ketoglutarate (HTK), intestinal preservation (IP), intestinal transplantation (ITx), intra-peritoneal (i.p.),
ischemia reperfusion injury (IRI), lactobionate (LB), lactated Ringer’s solution (RL), lactate dehydrogenase
(LDH), lactobionate fructose (LF), lactobionate fructose 2 (LF2), lipid peroxidase (LPO), luminal (lum.),
malonaldehyde (MDA), myeloperoxidase (MPO), non-essential amino acids (NEAA), non-recirculating
(non-recirc), non-significant (n.s.), multi organ donor (MOD), perfusion (perf.), phosphate buffered
sucrose (PBS), preservation conditions (PC), post-operative day (POD), potential difference (PD),
preservation solution (PS), reactive oxygen species (ROS), reperfusion (reperf.), resistance (R), respective
preservation solution (RPS), rewarming (rewarm.), saline (S), serum glutamic oxaloacetic transaminase
(SGOT=AST=ALAT), serum glutamic pyruvic transaminase (SGPT=ALT=ALAT) survival (surv.), temperature
(temp.), total adenylates (TA), transplantation (Tx), University of Wisconsin solution (UW), vascular (vasc.),
versus= compared to (vs.)
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
Materials & methods
Outcome parameters and
assessment time points
Parameters:
Histology, energetics, lipid
peroxidation
Time points:
4,8,12,24h after vasc. flush
Parameters:
Immunohistochemis-try:
apoptotic/ mitotic indices
Time points:
After 12/ 24h IP
Comments
Strength/ weakness /
remarks
Results (p<0,05)
Conclusion
-ATP levels higher in 24h lum. perf.
grp. (12/24h) +energy charge as fresh
tissue over 24h
-Lactate/ammonia less at 24h in 24h
lum. perf. grp.
-MDA levels > with perfus. time
-histology better in perf. grps., best
in 1h perf. gr.
Oxygenized hypothermic
perf. improves tissue
energetics; however, mucosal
integrity is superior with only
a brief 1h period lum. perf.
despite better energetics
-apoptotic index higher RL grps. vs.
hyperbaric O2 grps.
-mitotic index (nuclear proliferation)
higher in gr. 24h CS + hyperbaric O2
Hypothermic hyperbaric
Weakness:
oxygenation reduces
Solution of vasc. and lum. in
intestinal epithelial apoptosis vivo flush is not mentioned
& increases nuclear
proliferation during rat IP
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
Remark:
Mucosal. layer can only
tolerate a limited period of
hypothermic lum. perf.
6
109
Effective IP should therefore protect enterocytes, epithelial crypts and conserve TJ.
In the 1980s, the University of Wisconsin (UW) solution was introduced by Belzer and
Southard. UW is an intracellular-type preservation solution based on the trisaccharide
raffinose and the anion lactobionate as osmotic impermeants, hydroxyethyl starch (HES)
as colloid, a phosphate buffer, glutathione and allopurinol as ROS scavengers and the ATP
precursor adenosine (table 2). Vascular wash-out and CS with UW is currently considered
the gold standard for preservation of abdominal organs 15;16. This regime effectively protects
kidney, pancreas and liver but less sufficiently protects intestinal integrity and function 17-19.
Adequate preservation of the intestine should therefore be performed in two ways: using
intravascular and intraluminal preservation. An optimal solution and technique for IP have
yet to be identified. The aim of this review is to clarify demands of the intestinal graft during
preservation to achieve a tailor-made intestinal-specific preservation policy.
Preservation solutions: Components and characteristics
Electrolyte composition
Originally, an intracellular electrolyte ratio with high potassium and low sodium was thought
to prevent edema due to alternate electrolyte-transport during hypothermia. Therefore, the
original UW solution is an example of such an intracellular–like solution. Over time and due
to more insight, it was demonstrated that extracellular-like solutions containing high sodium
and low potassium were more effective in maintaining the Donnan equilibrium of the cell
membrane, without potassium-induced vasospasm.
Celsior is a simple, UW-like extracellular-type preservation solution differing from UW
by its monosaccharide impermeant mannitol, the buffer histidine and absence of a colloid.
Minor et al. 20 described that Celsior provided better post-ischemic (18 h) intestinal graft
recovery than UW in the rat, with less vascular resistance upon reperfusion, lower lactate
production and better carbohydrate absorption. The differences in reperfusion pressure
have possibly caused the encountered metabolic and functional differences although no
histological differences were seen. Prolonged vasoconstriction and increased pressure upon
reperfusion in reaction to the high-potassium concentration of UW was proposed to have a
deleterious impact on vascular endothelium 21;22. De Roover et al. 23 compared histology of
human tissue after UW or Celsior vascular flush followed by 24 h CS. In line, no histological
differences could be demonstrated.
Histidine tryptophan ketoglutarate (HTK) is a more distinct, extracellular-type, lowviscosity solution. HTK is based on the impermeant mannitol, the buffer histidine and two
amino acids: tryptophan, which is membrane stabilizing and anti-oxidative, and ketoglutarate,
a substrate for anaerobic metabolism (table 2). HTK is postulated to have clinical advantages
over UW (e.g. easier diffusion and faster cooling during wash-out). Clinical results regarding
the superiority of HTK over UW, however, are controversial 16. Magnus et al. 24 compared
110 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
clinical results of ITx after use of HTK or UW for preservation. No differences were seen
in initial graft function, endoscopic appearance and rejection episodes, although a better
blood wash-out was seen with HTK during intestinal procurement. This study has important
limitations: short follow-up (max. 90 days) and lack of randomization.
The new, extracellular-type Polysol is a complex experimental solution, which has a
high oncotic pressure and a three times lower viscosity than UW. Polysol contains the colloid
polyethylene glycol (PEG), the impermeants raffinose and gluconate, a phosphate buffer, the
buffer histidine and a sulfonic buffer HEPES, a variety of ROS scavengers, 21 different amino
acids (AA) and 16 different vitamins (table 2). Wei et al. 25 Compared rat intestinal graft quality
after CS (18 h) with UW, HTK, Celsior and Polysol followed by 30 min. in-vitro reperfusion.
Polysol exhibited higher ATP levels, lower lactate dehydrogenase (LDH) production, higher
tissue oxygen consumption and a better preserved microstructure (e.g. mitochondria) vs. UW.
However, the much simpler HTK and Celsior also showed similar benefits. Malondialdehyde,
reflecting peroxidation, and apoptotic cell death was higher with UW than other solutions.
Also, ATP levels were higher for HTK vs. UW. The extracellular character of Celsior, HTK and
Polysol could be related to the superior results. Due to the model of ex-vivo reperfusion in
the rat and the short reperfusion period, the clinical impact of these findings remains limited.
Muller et al. 26 evaluated the two commercially available solutions UW and Euro Collins,
and in addition a variety of fundamental solutions with different electrolyte compositions:
phosphate buffered sucrose (PBS, containing sodium), extracellular fluid (ECF, high potassiumlow sodium), lactobionate fructose (LF, high potassium-low sodium), and saline (high
sodium) were tested for their effectiveness in rat IP (12 h). This study appraised histology
and glutaminase activity, which reflects enterocyte integrity, after 20 min. reperfusion and
7-day graft survival. No difference in graft survival was observed suggesting that electrolyte
composition is probably of minor importance.
Kokudo et al. 17 aimed to identify the optimal IP solution composition by evaluating
rat survival and graft electrophysiological functional performance (using an Ussing chamber)
during 18 h preservation. UW, Euro Collins and Lactated Ringer’s solution (RL, low potassiumlow sodium) were compared. In all solutions, enterocyte function rapidly deteriorated. Crypt
cell function was better preserved with RL and EC than with UW. After 12 h of CS, survival
was lower in the UW group. After 18 h, however, no differences in survival were seen between
the preservation groups.
Summarizing, extracellular-like, high sodium, low-viscosity solutions seem beneficial for
wash-out and reperfusion characteristics, but the exact role of sodium-potassium ratio and
separate electrolytes in maintenance of intestinal graft viability is unclear.
Impermeant and colloid support
One of the unwanted negative effects of hypothermia is a passive sodium influx into the
cytosol followed by water, resulting in tissue edema. To counteract this phenomenon
impermeants and colloids are key factors in hypothermic preservation.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
111
6
Table 2 Composition of preservation solutions
Colloids/impermeants
(MW in kDa)
Components mmol/L
(or indicated otherwise)
EC14
Glucose
195
HES (250) (g/L)
UW14
CLS19
HTK 24
100
Mannitol (MW 182)
20
80
60
100
30
Na+-Gluconate
74.99
PEG (35) (g/L)
20
Raffinose
30
3
Trehalose
5.3
BES
90
H2PO 4
21.7
HEPES
20
Histidine
30
KH2PO 4
43
K2 HPO 4
15
NaHC03
10
Allopurinol
198
1
5x10-5
0.11
3
3
3
Sodiupyruvate
0.23
Tryptophan
2
Adenine
5
Adenosine
5
5
Hydroxy-butyrate
1
Ornithine
2
Alanine
1.01
Arginine
1.18
10
Asparagine
0.08
10
Aspartate
0.23
20
Cysteine
0.58
5
Glutamate
Glutamic acid
112 5
3
Ketoglutarate
Amino acids
5
1.2
Ascorbic acid
Glutathion
6.3
25
Alpha-tocopherol
Additives
11.1
20
Lactobionate
Antioxidants
AA solution
example61
50
K+-Gluconate
Buffers
Polysol24
5
20
20
0.34
Glutamine
0.002
35
Glycine
0.67
10
Isoleucine
0.38
5
Leucine
0.57
5
Lysine
0.48
10
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
Amino acids
Vitamins
Components mmol/L
(or indicated otherwise)
Methionine
EC14
UW14
CLS19
HTK 24
0.3
AA solution
example61
5
Phenylalanine
0.3
Proline
0.78
5
Serine
0.29
10
Threonine
0.34
10
Valine
0.88
10
Tryptophan
0.43
1
Tyrosine
0.19
1
Ascorbic acid
0.11
Biotin
0.21
Ca-pantothenate
0.004
Choline-Chloride
0.01
Ergocalciferol
3x10-4
Folic acid
0.002
Inositol
0.07
Menadione
4x10-5
Niacinamide
0.01
Nicotinic acid
0.004
Pyridoxal
0.005
Ribovlavin
0.003
Thiamine
0.03
Vitamin A
3x10-4
Vitamin B12
1x10-4
Vitamin E
Electrolytes
Magnesium-sulphate
Measured electrolytes
Calcium
Chloride
5x10-5
0.25
0.02
2
15
20
13
4
4
Potassium
115
120
15
10
5
Sodium
10
25
100
15
135
pH
7.0
7.4
7.3
7.2
7.4
Osmolarity (mOsm/L)
355
330
320
310
320
5.7
1.3
1.8
1.8
Viscosity (cP)
6
5
Magnesium
Properties (if given)
Polysol24
32
7.4
AA: Amino Acid
BES: N,N-Bis(2-hydroxyethyl)-2-aminoethanesulfonic-acid
CLS: Celsior solution
EC: EuroCollins solution
HEPES: 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid
HTK: histidine tryptophan ketoglutarate
kDa: Kilo-dalton
MW: Molecular Weight
PEG: Polyethylene Glycol
UW: University of Wisconsin solution
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
113
UW includes the large trisaccharide impermeant raffinose and the anionic impermeant
lactobionate, which is also present in Celsior in combination with the monosaccharide
mannitol. Dialyzed hydroxyethyl starch (HES) is the colloid component in UW. Its efficacy has
been debated because it increases viscosity and could cause red blood cell (RBC) aggregation
-both negatively affecting wash-out and reperfusion 27-33. Alternatively, polysaccharide
dextrans and PEG have been applied as colloid agents. PEG was assumed to result is less
RBC aggregation and lower viscosity, seemed to stabilize lipid membranes 29 minimizing
permeability 28;32, and furthermore acts as a free radical scavenger 29;34. PEG was proved to
be effective for IP 35-38. Nevertheless, none of the clinically used solutions contains PEG. Wei
et al. 23 suggested that the low viscosity resulting from replacing HES with PEG in Polysol
was partly responsible for the superiority of Polysol over UW. This is plausible, since simple
crystalloid solutions earlier demonstrated a better wash-out and reperfusion characteristics
than UW 24;26. On the other hand, colloids are important during CS 39 to minimize cellular
edema and therefore are to be included.
The clearly demonstrated sequential pattern of morphologic damage to the intestinal graft
is caused by edema 40. Mucosal damage starts with the formation of sub-epithelial clefts at
the villus tip, followed by epithelial lifting from the lamina propria along the villus, progressive
denudation, loss of villi and finally mucosal infarction. Morphological damage negatively
affects the protective barrier and absorptive capacity of the intestine.
The necessity for oncotic impermeant support during IP particularly was investigated for
prolonged (10 h) CS of rat intestine 41. The intestinal vasculature was flushed with one of four
solutions: (1) saline (0.9%), (2) saline+5% dextran, (3) saline+lactobionate+dextran or (4)
UW. Cellular energy, function (permeability) and histology were analyzed during a 10-h time
course of CS. Saline+lactobionate+dextran resulted in better maintenance of energy levels
and improved function (vs. UW) in combination with intact morphology, versus extensive
villus denudation and loss of crypt cells in saline and UW. Noteworthy, since crypt cells carry
the regenerative capacity. These results confirm the importance of osmotic and oncotic
impermeant support during IP and may imply that dextran might be a superior alternative for
the colloid HES in UW. Unfortunately, wash-out, reperfusion characteristics and ITx outcome
were not assessed. In contrast, Rodriguez et al. 42 showed that a dextran-allopurinoladenosine-verapamil (ADAAV) preservation solution, also containing albumin and glucose,
was not superior to UW (HES, lactobionate, raffinose) or Euro Collins (glucose) for rat IP.
Outcome was assessed after 24 h CS and ITx. Biochemical and histological parameters did
not differ among preservation groups. These results suggest the crucial role of lactobionate
since the superiority of dextran in combination with lactobionate has been demonstrated 40.
Impermeants and colloids are key factors to counteract deteriorating fluid shifts during
intestinal preservation 40. Dextrans or PEG might be superior colloid alternatives for HES
with better wash-out and reperfusion characteristics 25;26;41. Substantial evidence exists that
lactobionate is important for effective impermeant support.
114 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
Buffering capacity
Ischemia results in anaerobic glycolysis and glycogenolysis. These anaerobic processes
produce lactic acid and hydrogen ions resulting in acidosis, which subsequently damages
cells, lysosymes, and mitochondria. Prevention of tissue acidosis is therefore an important
prerequisite for good organ preservation.
A variety of buffers are applied to regulate pH homeostasis during preservation: UW relies
on a phosphate buffer; HTK is based on histidine, while Polysol contains a phosphate buffer,
histidine and the sulfonic buffer HEPES. The exact value of buffer type in the preservation
solution regarding intestinal viability after CS cannot be determined since no single study has
compared solutions and assessed pH homeostasis in relation to ITx outcome.
The physiologic buffering agent histidine has been related to minimized pH fluctuations
during CS 43. The buffering potential of histidine was investigated for IP particularly 44.
Histidine supplementation to UW resulted in a >3 fold increase in buffering capacity (pH
range 7.4-6.8) and enhanced glycolytic capacity with a higher ATP and total energy charge
during 10 h CS of rat intestine. Improved energy levels were attributed to activation of the key
enzyme phosphofructokinase (PFK) and alleviation of intracellular acidosis in the presence of
histidine. Although these findings give valuable insight into biochemical processes during IP,
histology, functionality and outcome after ITx were not studied
Anti-oxidants
Upon reperfusion, accumulated anaerobic end products contribute to the generation of
reactive oxygen species (ROS). These ROS will severely damage lipids, nucleic acids and
proteins and provoke a profound inflammatory response. It has also been suggested that ROS
are already generated during CS. To reduce injury, preservation solutions contain variable
ROS scavengers to counteract ROS-mediated injury during CS and reperfusion.
UW includes allopurinol and reduced glutathione to counteract the effect of ROS; in
Celsior just glutathione is present. Allopurinol blocks XO, whereas the tripeptide glutathione
converts peroxides as it is oxidized. Minor et al. 20 demonstrated that neither glutathione (in
Celsior), nor the combination of glutathione and allopurinol (in UW) prevent oxidative stress
in rat intestine after 18 h of CS and in-vitro reperfusion.
In HTK, tryptophan functions as a ROS-scavenger by its oxidative (electron–accepting)
metabolites. Wei et al. 25 reported that 18 h CS of rat intestine with HTK, CLS or Polysol
resulted in less peroxidation than with UW after 30 min in-vitro reperfusion since malondialdehyde was lower in Polysol. In addition, Polysol exhibited the highest ATP concentrations
and least apoptosis, versus the lowest ATP concentrations and highest apoptosis with UW
solution. The favourable results with Polysol could be in part explained by an optimized ‘antioxidative potential’ resulting from supplementation with a broad variety of ROS-scavengers
(table 2). It appears that anti-oxidative ability attenuates damage through improved energetics and reduced apoptosis. Celsior and HTK (table 2) both contain relatively high concentrations of histidine, which is also suggested to neutralize ROS. The protective capabilities of
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
115
6
L-histidine were specifically linked to the ability to scavenge toxic ROS 45. Possibly, the low
concentrations of allopurinol and glutathione in UW provide ‘marginal oxidative potential’,
which might explain increased tissue oxidation for UW.
In conclusion, low concentrations of allopurinol and glutathione (as in UW) do not
entirely prevent oxidative stress 20. High concentrations of histidine in addition to glutathione/
tryptophan or a combination of antioxidants as used in Polysol can attenuate oxidative stress
and benefit intestinal graft quality.
Amino acid (AA) supplementation
Following preservation and at time of reperfusion the presence of a substrate to rapidly
regenerate cellular energy is crucial. To facilitate this process ATP precursors such as AA are
added during IP in order to improve viability. Hypothermia causes rapid degradation of highenergy compounds 5;46. Energetic status is related to metabolic cell stress, histological damage
and apoptosis, all affecting structural and functional integrity 25;47. At the ultra-structural
level of intestinal tissue, TJ depend on ATP. Depletion of energy leads to delocalization and
degradation of TJ resulting in increased epithelial permeability and influx of macromolecules
48. Upon energetic restoration, fortunately, TJ re-assemble and barrier function is restored.
AA are postulated to play a protective role by their facilitation of metabolic and synthetic
cellular processes during preservation (43;49-51). Nevertheless, Olson et al. 41 demonstrated
that maintenance of mucosal structural integrity with AA supplementation may not be
energy-dependent but substrate-specific, since AA solution favoured histology, while UW
resulted in higher energy levels. Energy levels should therefore be interpreted carefully when
used as a solitary parameter of viability.
Especially glutamine, the principle energy substrate for the enterocyte, is suggested to
be beneficial. Glutamine-supplied RL was shown to be beneficial for mucosal cell structure
during IP compared to RL. Vascular glutamine supply merely favoured crypt cells, whereas
luminal supply ameliorated cells at the tip of the villi 14. In line, glutamine-enriched UW
improved rat mucosal function and structure of after 18 h CS 52. Upon comparison of different
glutamine concentrations and other AA (2-4%), the solitary addition of 2% glutamine to UW
solution was most effective. Olson et al. 53 addressed a potential danger of detrimental pHshifts when glutamine metabolism is sustained in a system devoid of hepatic detoxification.
Specifically, acidic TCA cycle end products like ammonia must be buffered. This possibly
explains why 4% glutamine was not superior to 2%. Considering AA supplementation in
general, only the 4% AA concentration showed better results than UW, perhaps indicating
a threshold to provide energy stores. The superiority of Polysol over UW (and over Celsior
and HTK on some endpoints) has been attributed to the variety of AA (table 2) in Polysol 25.
Recapitulating, Polysol resulted in higher ATP levels, lower LDH production, higher oxygen
consumption and better preserved microstructures compared to UW. Although a benefit of
the extensively enriched Polysol was reported, the exact mechanisms and the separate values
of the 21 different AA compounds were not clarified. Noteworthy, in the latter study both a
vascular flush and a luminal flush with the different solutions was applied.
116 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
In summary, 4% AA or 2% glutamine supplementation to the preservation solution in the
presence of sufficient buffering capacity has a potential to ameliorate rodent intestinal graft
quality. The mechanisms are to be elucidated more extensively in ITx models and in human
IP studies.
Preservation conditions
Intravascular preservation
A standard, high-volume, in-situ, systemic washout before CS is applied for rapid blood
clearance and temperature decrease of the donor organ. In contrast to most solid organs, the
intestine lacks a supportive capsule and might be unable to withstand strong mechanical forces
leading to edema and mucosal detachment. Consequently, the intestine is recovered first after
a limited volume of systemic flush 54. The precise volume or pressure not to ‘overstretch the
mechanical endurance’ of the intestine is unknown yet. Short-term (1 h) pulsatile perfusion at
a pressure of 60 mmHg in combination with CS appears to be superior to only CS for 24 h graft
preservation in the dog model, as described in the last paragraph of this review.
The value of the first vascular flush before CS was evaluated over 24 h CS and ITx in the
rat 42. Rat intestine was preserved with different solutions directly after recovery or after a
vascular flush ex-situ. Outcome was based on biochemistry, histology, functional glucose
uptake, survival and determinants of failure. Survival was 0% without a vascular flush before
CS, whereas 47-67% survival in the flushed groups.
After CS, a second vascular flush has been considered harmful. Muller et al. assessed
survival, histology and glutaminase activity after 12 h with and without a second vascular
flush after CS 39. Also, the effect of intra-peritoneal abdominal rewarming upon reperfusion
was studied out of concern for insufficient blood supply after CS. Survival was highest when a
second vascular wash-out was omitted and re-warming with 37ºC saline intra-peritoneal was
applied. A second vascular flush after CS appeared to cause substantial mechanical damage,
overruling any theoretical advantage of removing accumulated toxic components.
Thus, a vascular (in-situ) wash-out before CS appears to be critical and a vascular flush
after CS should be omitted. Topical abdominal rewarming during reperfusion may deserve
further evaluation.
Intraluminal preservation
In addition to the intra- and extra-vascular compartments, the intestinal lumen represents
an additional space of interest. Tissue edema is believed to originate from the lumen along
with increased permeability during ischemic preservation 55. Furthermore, it is potentially
contaminated by bacteria. Finally, its surface-volume and the susceptible epithelial top layer
underline a role for the lumen. These characteristics possibly explain why a vascular washout and CS are unable to support the intestinal graft sufficiently. Since highly vulnerable
epithelial cells at the villus apex rather rely on nutrient absorption from the lumen than
vasculature 14;56, the lumen forms a logical route to improve preservation conditions.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
117
6
A benefit of luminal preservation (before CS) was originally explained through clearance/dilution
of resident enteric cytotoxic contents 57;58. Luminal preservation with a crystalloid solution
ameliorated mucosal function compared to vascular preservation alone, but the benefit was
at the expense of morphological integrity 59. Luminal preservation with nutritive substances
was another conceived strategy. Continuous luminal and/or arterial perfusion (24 h) of canine
jejunum with glutamine-enriched RL suppressed preservation injury and improved function
and structure compared to perfusion with just RL 14. The combination of luminal and arterial
perfusion with glutamine-enriched RL prevented cell damage due to energetic deficiency, and
favourably maintained the number of epithelial cells, viability, and protein metabolism. Yet, a
benefit of glutamine-enriched luminal flush and CS (24 h) of rat intestine could not be shown
by Leuvenink et al. 60 when comparing Celsior, UW, and glutamine-enriched UW. As regards
the biochemical endpoints, Celsior seemed to be the best luminal preservation solution.
However, histology showed severe damage in all groups. Since a vascular wash-out before CS
was omitted, histological findings might again confirm the critical role of this element.
De Roover et al. evaluated luminal preservation with UW (after vascular wash-out)
on human intestinal histology 61. Luminally preserved segments showed less histological
damage than standard-preserved intestinal segments from the same donor after 12 h CS.
Functionality and outcome after reperfusion were not studied.
Further studies were directed at improvement of graft viability by tailoring luminal
solutions to support energy and non-energy related processes. Luminal exposure to AA was
held responsible for the overall superiority of Polysol compared to UW 25 when applying
vascular and luminal flush with different solutions before CS. In an attempt to develop the
optimal tailored luminal solution, Fujimoto et al. 62 compared luminal preservation (after
UW vascular flush) and 24 h CS of rat intestine with four different luminal solutions (UW,
glutamine-enriched UW, and two similar AA (table 2) solutions) to the clinical standard
of vascular wash-out alone followed by CS (control). All enriched luminal groups showed
improved functionality, energetics, and histology compared to the control group. Best
functionality and morphology was seen after luminal preservation with the AA solution
including lactobionate and BES buffer. Outcome after ITx must prove if the luminal benefit is
substantial enough to withstand the negative effects of reperfusion.
Salehi et al. 63 attempted to further clarify the potential beneficial mechanisms of
luminal AA-enriched IP. Luminal flush and exposure during CS with AA-enriched solution
(after vascular UW flush) resulted in recovery of energetics within post-transplant day 3 and
reduced malondialdehyde/glutathione, indicating less oxidation following reperfusion. The
reduction in energetic- and oxidative stress was likely responsible for a simultaneous decrease
in neutrophil recruitment and histological damage in grafts after luminal AA preservation. AA
luminal preservation resulted in a 14-day survival of 80%, while all animals died within 12 h
after preservation with UW (vascular/luminal flush).
Despite a benefit of luminal AA-enriched preservation solution over luminal standard
UW in rodent studies this was not seen for human intestine. The effect of a luminal flush with
118 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
AA solution or UW (after UW vascular wash-out) on outcome of human intestine over 24 h
preservation was assessed 64. Luminal AA did not prevent ATP decay any better than isolated
vascular UW solution. Both luminal preservation groups resulted in better barrier function
and morphology compared to standard preservation.
Recently Oltean et al. 65 reported that intraluminal preservation (after UW vascular washout) with a low-sodium, PEG containing solution ameliorated preservation damage in rat intestine. Luminal preservation improved morphology and reduced edema after 14 h CS compared to
a vascular flush alone. Luminal PEG was suggested to have maintained epithelial integrity by its
ability to bind to negatively charged sphingolipids on the enterocytes. Since luminal preservation with UW was not assessed, the possibility of an aspecific luminal effect remains.
The benefit of luminal preservation of rodent and human intestinal grafts has been confirmed,
but AA-enriched luminal preservation showed no additional advantage (over UW) for
preservation of human intestine. Furthermore, outcome after human ITx must ultimately
prove if a luminal benefit can reduce reperfusion injury.
Hypothermic perfused preservation and oxygenized techniques
Hypothermic machine perfusion (HMP) generates a flow of recirculating cold preservation
solution. For the intestine, CS is assumed to be superior to HMP fearing for pressure-induced
vascular injury. However, the comparison of two pulsatile-perfusion systems with CS using
Collins solution and with a combination of 6 h CS+18 h pulsatile-perfusion demonstrated a
better outcome after machine perfusion preservation (at 60 mmHg) in the dog 66. Significant
differences were noted between CS and the combined technique, suggesting that initial
pulsatile perfusion may be decisive.
Hypothermic oxygenized luminal perfusion -simultaneously delivering oxygen luminally
and removing toxic products- also ameliorated viability 66. Despite improved energy levels
(ATP) and decreased lactate/ammonia after 24 h perfusion, histology was superior with only a
1-h period of luminal perfusion. This reconfirms the limited value of energetics, and indicates
that the intestine tolerates a limited period of hypothermic luminal perfusion. Mechanical
disruption is likely to be responsible for the histological damage. Perhaps, the intestine
could profit from metabolic benefits with a different perfusion technique. Alternatively,
normothermic perfusion may be advantageous. Alterations in membrane fluidity may
be less problematic in this situation, but bacterial overgrowth becomes another concern.
Normothermic, oxygenized machine-perfusion (NMP) supports normal metabolism and
minimizes the accumulation of ROS precursor-substrates. Improved canine/rodent intestinal
graft quality and longer storage spans have been reported during 1960-1970’s 67 using
complicated techniques including continuous perfusion and hyperbaric oxygenation. ITx was
successful after 5 h of NMP with heparinised RL 68. Pulsatile perfusion with whole blood at
37°C maintained intestinal graft viability for 18 h (in-vitro). When non-pulsatile flow was
used, the graft survived only 6 h 69.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
119
6
Table 3 Lessons learned
Lessons learned from animal studies
LOE
Lessons learned from human studies
Low:
Animal
studies
3
• Luminal preservation: aspecific dilution/
cytoprotective contact between mucosa and
preservation solution
Beneficial strategies
•
•
•
•
•
•
•
•
•
•
•
LOE
Beneficial strategies
Vascular flush before CS
No 2nd vascular flush after CS
Topical intra-peritoneal rewarming during reperfusion
Luminal contact during preservation
Amino-acid supplementation in vascular/luminal
preservation solution
Vascular/luminal supplied colloid and impermeant
support
Buffering capacity of the preservation solution
Hypothermic perfused preservation with blood-like
solutions
Luminal oxygenized perfusion for a short period
Normothermic oxygenized perfusion
Assess viability based on combination of functional,
biochemical, and histological parameters
Harmful strategies
Harmful strategies
• Fasting of the donor
• Applying a second vascular flush after CS
Low:
Animal
studies
General Pitfalls
• Lack of a clinical applicable method for luminal
preservation
• Functional & biochemical parameters affected before
histology & possibly more sensitive than histology for
graft viability assessment
• Lack of practical functional/biochemical parameters to
assess intestinal viability
• Lack of ITx as the primary outcome parameter
Future considerations
• Similar short-time clinical outcome of ITx
after preservation with UW/HTK
• Potential superiority of HTK over-shadowed
by limited preservation span of intestine
• HTK less expensive & better wash-out of
blood and reperfusion characteristics
• Luminal tailored preservation
• Normothermic (perfused) oxygenized
techniques
CS: Cold Storage
HTK: Histidine Tryptophan Ketoglutarate solution
LOE: Level of evidence
UW: University of Wisconsin solution
120 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
Several intricate oxygenation techniques have been attempted. A static, hypothermic,
cavitary–two-layer-oxygenized-perfluorcarbon/UW-method (C2LM) was evaluated for it’s
ability to prolong preservation times of rat intestine in a transplant model 70;71. Survival
and graft histology was compared after C2LM±oxygen or hypothermic preservation with
UW±oxygen for 24/48 h. The C2LM(-oxygen) allowed preservation for 24 h. With oxygen,
preservation span was expanded up to 48 h. However, UW+oxygen was not effective without
PFC, indicating the necessity of a high oxygen-tension carrier. Tsujimura et al. 70;72 evaluated
the C2LM for canine preservation and ITx. All dogs in the C2LM group survived, while 11/12
dogs in the UW (static CS) group died. Graft histology and absorption capacity in the C2LM
group was similar to non-preserved grafts.
Normothermic oxygenized (luminal) preservation facilitates physiological metabolism
of the intestine by maintaining energy stores/reducing oxidative stress and removal of toxic
products. If a delicate technique can be developed, a role for normothermic oxygenized
(luminal) preservation is conceivable.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
121
6
CONCLUSION
Improvement of intestinal preservation is a subject of great interest since reduced graft quality
is recognized to limit the outcome of ITx. Apart from immunosuppressive interventions,
advancement should be directed towards new preservation strategies. The current
preservation regime with UW is adequate but probably suboptimal for the intestine. Study
results have been mostly incomparable due to a wide heterogeneity of species, experimental
set-up, and outcome parameters. Most studies are in animals, while human studies are
scarce. Furthermore, the compared solutions often have many different components and
any beneficial outcome is therefore not easily explained. Finally, inconsistency between
parameters occurs, questioning the validity of different parameters. Functional parameters
seem preferable: however, histological crypt status is critical to estimate reparative capacity.
Although available studies don’t reveal the most effective technique and solution for
intestinal preservation, this review illustrates that alternative strategies can improve graft
quality and outcome after ITx. The intended optimal strategy will not rely on just one factor,
but will result from a synergistic effect of different vital elements within a “package of
conditions” (table 3). A vascular flush before CS cannot be omitted. A low potassium/low
viscosity solution without HES allows for better washout of blood than UW. Amino Acids
offer advantages to viability. Osmotic, oncotic (e.g. PEG, lactobionate and raffinose) and
buffering agents are fundamental in a preservation solution. There is a benefit of luminal
flush and/or contact between the mucosa and the solution during preservation, although the
best composition of the luminal solution for the human intestine and a practical, clinically
applicable delicate technique are yet unknown.
Oxygenized arterial and/or luminal perfusion for short periods are to be considered,
since this technique maintains viability and additionally removes accumulated toxic products.
Organic powerful oxygen carriers, allowing for high oxygen-tension, can be applied.
Thus, a tailored luminal preservation solution and/or (oxygenized perfused) technique
need to be further investigated for the human setting and in transplant models to finally
develop the ultimate technique that meets physiological demands of the intestinal graft
during preservation.
122 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
REFERENCE LIST
1. Fishbein TM. Intestinal transplantation. N Engl J Med 2009 Sep 3;361(10):998-1008.
2. Fryer JP. The current status of intestinal transplantation. Curr Opin Organ Transplant 2008 Jun;13(3):266-72.
3. Pascher A, Kohler S, Neuhaus P, Pratschke J. Present status and future perspectives of intestinal
transplantation. Transpl Int 2008 May;21(5):401-14.
4. Belzer FO, Southard JH. Principles of solid-organ preservation by cold storage. Transplantation 1988
Apr;45(4):673-6.
5. Maathuis MH, Leuvenink HG, Ploeg RJ. Perspectives in organ preservation. Transplantation 2007 May
27;83(10):1289-98.
6
6. Koudstaal LG, ‘t Hart NA, van den Berg A, Olinga P, van Goor H, Ploeg RJ, et al. Brain death causes structural
and inflammatory changes in donor intestine. Transplantation Proceedings 2005 Jan;37(1):448-9.
7. Koudstaal LG, ‘t Hart NA, Ploeg RJ, van Goor H, Leuvenink HGD. Inflammation and structural changes in
donor intestine and liver after brain death induction. European Journal of Gastroenterology & Hepatology
2005 Jan;17(1):A44-A45.
8. Thuijls G, de Haan JJ, Derikx JP, Daissormont I, Hadfoune M, Heineman E, et al. Intestinal cytoskeleton
degradation precedes tight junction loss following hemorrhagic shock. Shock 2009 Feb;31(2):164-9.
9. Wang M, Li Q, Wang J, Li Y, Zhu W, Li N, et al. Intestinal tight junction in allograft after small bowel
transplantation. Transplant Proc 2007 Jan;39(1):289-91.
10. Zou Y, Hernandez F, Burgos E, Martinez L, Gonzalez-Reyes S, Fernandez-Dumont V, et al. Bacterial
translocation in acute rejection after small bowel transplantation in rats. Pediatr Surg Int 2005
Mar;21(3):208-11.
11. Chiu CJ, McArdle AH, Brown R, Scott HJ, Gurd FN. Intestinal mucosal lesion in low-flow states. I. A
morphological, hemodynamic, and metabolic reappraisal. Arch Surg 1970 Oct;101(4):478-83.
12. Park PO, Haglund U, Bulkley GB, Falt K. The sequence of development of intestinal tissue injury after
strangulation ischemia and reperfusion. Surgery 1990 May;107(5):574-80.
13. Bigam DL, Grant D. Small bowel transplantation. In: Morris PJ, Wood WC, editors. Oxford Textbook of Surgery.
2 ed. Oxford: Oxford University Press; 199.
14. Ito A, Higashiguchi T, Kitagawa M, Yokoi H, Noguchi T, Kawarada Y. Effect of luminal administration
of glutamine to suppress preservation graft injury in small bowel transplants. Transplant Proc 1995
Feb;27(1):780-2.
15. Ploeg RJ, Leuvenink HG. Renal Preservation. In: Morris PJ, Knechtle SJ, Morris AKK, editors. Kidney
Transplantation: Principles and Practice. 6ht ed. Saunders Elsevier; 2008. p. 128-39.
16. Tuttle-Newhall JE, Krishnan SM, Levy MF, McBride V, Orlowski JP, Sung RS. Organ donation and utilization in
the United States: 1998-2007. Am J Transplant 2009 Apr;9(4 Pt 2):879-93.
17. Kokudo Y, Furuya T, Takeyoshi I, Nakamura K, Zhang S, Murase N, et al. Comparison of University of
Wisconsin, Euro-Collins, and lactated Ringer’s solutions in rat small bowel preservation for orthotopic small
bowel transplantation. Transplant Proc 1994 Jun;26(3):1492-3.
18. Schweizer E, Gassel A, Deltz E, Schroeder P. Morphologic and histologic alterations after small-bowel
transplantation--a comparison of different perfusion solutions. Transplant Proc 1992 Jun;24(3):1087.
19. Schweizer E, Gassel AM, Deltz E, Schroeder P. A comparison of preservation solutions for small bowel
transplantation in the rat. Transplantation 1994 May 15;57(9):1406-8.
20. Minor T, Vollmar B, Menger MD, Isselhard W. Cold preservation of the small intestine with the new Celsiorsolution. First experimental results. Transpl Int 1998;11(1):32-7.
21. Pearl JM, Laks H, Drinkwater DC, Sorensen TJ, Chang P, Aharon AS, et al. Loss of endothelium-dependent
vasodilatation and nitric oxide release after myocardial protection with University of Wisconsin solution. J
Thorac Cardiovasc Surg 1994 Jan;107(1):257-64.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
123
22. Delyani JA, Nossuli TO, Scalia R, Thomas G, Garvey DS, Lefer AM. S-nitrosylated tissue-type plasminogen
activator protects against myocardial ischemia/reperfusion injury in cats: role of the endothelium. J
Pharmacol Exp Ther 1996 Dec;279(3):1174-80.
23. DeRoover A, de Leval L, Gilmaire J, Detry O, Boniver J, Honore P, et al. A new model for human intestinal
preservation: Comparison of University of Wisconsin and Celsior preservation solutions. Transplantation
Proceedings 2004 Mar;36(2):270-2.
24. Mangus RS, Tector AJ, Fridell JA, Kazimi M, Hollinger E, Vianna RM. Comparison of histidine-tryptophanketoglutarate solution and University of Wisconsin solution in intestinal and multivisceral transplantation.
Transplantation 2008 Jul 27;86(2):298-302.
25. Wei L, Hata K, Doorschodt BM, Buttner R, Minor T, Tolba RH. Experimental small bowel preservation using
Polysol: a new alternative to University of Wisconsin solution, Celsior and histidine-tryptophan-ketoglutarate
solution? World J Gastroenterol 2007 Jul 21;13(27):3684-91.
26. Muller AR, Nalesnik M, Platz KP, Langrehr JM, Hoffman RA, Schraut WH. Evaluation of preservation
conditions and various solutions for small bowel preservation. Transplantation 1994 Mar 15;57(5):649-55.
27. ‘t Hart NA, van der Plaats A, Leuvenink HGD, Wiersema-Buist J, Olinga P, van Luyn MJA, et al. Initial blood
washout during organ procurement determines liver injury and function after preservation and reperfusion.
American Journal of Transplantation 2004 Nov;4(11):1836-44.
28. Daniel MR, Wakerley CL. Factors influencing the survival of cell monolayers during storage at 4 degrees. Br J
Exp Pathol 1976 Apr;57(2):137-47.
29. Mack JE, Kerr JA, Vreugdenhil PK, Belzer FO, Southard JH. Effect of polyethylene glycol on lipid peroxidation
in cold-stored rat hepatocytes. Cryobiology 1991 Feb;28(1):1-7.
30. Morariu AM, Vd Plaats A, Oeveren V, ‘t Hart NA, Leuvenink HG, Graaff R, et al. Hyperaggregating effect of
hydroxyethyl starch components and University of Wisconsin solution on human red blood cells: a risk of
impaired graft perfusion in organ procurement? Transplantation 2003 Jul 15;76(1):37-43.
31. Ploeg RJ, van Bockel JH, Langendijk PT, Groenewegen M, van der Woude FJ, Persijn GG, et al. Effect of
preservation solution on results of cadaveric kidney transplantation. The European Multicentre Study Group.
Lancet 1992 Jul 18;340(8812):129-37.
32. Robinson JR. Control of water content of non-metabolizing kidney slices by sodium chloride and polyethylene
glycol (PEG 6000). J Physiol 1971 Feb;213(1):227-34.
33. van der Plaats A, ‘t Hart NA, Morariu AM, Verkerke GJ, Leuvenink HG, Ploeg RJ, et al. Effect of University of
Wisconsin organ-preservation solution on haemorheology. Transpl Int 2004 Jun;17(5):227-33.
34. Hauet T, Han Z, Doucet C, Ramella-Virieux S, Hadj Aissa A, Carretier M, et al. A modified University of
Wisconsin preservation solution with high-NA+ low-K+ content reduces reperfusion injury of the pig kidney
graft. Transplantation 2003 Jul 15;76(1):18-27.
35. Zheng TL, Lanza RP, Soon-Shiong P. Prolonged pancreas preservation using a simplified UW solution
containing polyethylene glycol. Transplantation 1991 Jan;51(1):63-6.
36. Wicomb WN, Hill JD, Avery J, Collins GM. Optimal cardioplegia and 24-hour heart storage with simplified
UW solution containing polyethylene glycol. Transplantation 1990 Feb;49(2):261-4.
37. Itasaka H, Burns W, Wicomb WN, Egawa H, Collins G, Esquivel CO. Modification of rejection by polyethylene
glycol in small bowel transplantation. Transplantation 1994 Mar 15;57(5):645-8.
38. Ben Abdennebi H, El Rassi Z, Steghens JP, Scoazec JY, Ramella-Virieux S, Boillot O. Effective pig liver
preservation with an extracellular-like UW solution containing the oncotic agent polyethylene glycol: a
preliminary study. Transplant Proc 2002 May;34(3):762-3.
39. Southard JH, van Gulik TM, Ametani MS, Vreugdenhil PK, Lindell SL, Pienaar BL, et al. Important components
of the UW solution. Transplantation 1990 Feb;49(2):251-7.
40. Geheb MA Krause JA, Haupt MT et al. Medical and surgical conditions associated with fluid and electrolyte
disorders. In: Maxxwell and Kleeman, editor. Clinical Disorders of Fluid and Electrolyte Metabolism. 5th ed.
New York: McGraw-Hill, inc.; 1994. p. 1463-89.
41. Olson D, Stewart B, Carle M, Chen M, Madsen K, Zhu J, et al. The importance of impermeant support in small
bowel preservation: a morphologic, metabolic and functional study. Am J Transplant 2001 Sep;1(3):236-42.
124 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
42. Rodriguez FJ, Toledo-Pereyra LH, Suzuki S. Twenty-four-hour total small bowel hypothermic storage
preservation and transplantation in the rat: a study of various preservation solutions. J Invest Surg 1994
Sep;7(5):439-51.
43. Stoll B, Henry J, Reeds PJ, Yu H, Jahoor F, Burrin DG. Catabolism dominates the first-pass intestinal
metabolism of dietary essential amino acids in milk protein-fed piglets. J Nutr 1998 Mar;128(3):606-14.
44. Salehi P, Spratlin J, Chong TF, Churchill TA. Beneficial effects of supplemental buffer and substrate on energy
metabolism during small bowel storage. Cryobiology 2004 Jun;48(3):245-53.
45. Wade AM, Tucker HN. Antioxidant characteristics of L-histidine. Journal of Nutritional Biochemistry
1998;9:308-15.
46. Marshall VC. Preservation by simple hypothermia. In: Collins GM, Dubernard JM, Land W, editors.
Procurement, Preservation and Allocation of Vascularized Organs. Dordrecht: Kluwer Academic Publishers;
2010. p. 115-29.
6
47. Higashi H, Takenaka K, Fukuzawa K, Yoshida Y, Sugimachi K. Restoration of ATP contents in the transplanted
liver closely relates to graft viability in dogs. Eur Surg Res 1989;21(2):76-82.
48. Tsukamoto T, Nigam SK. Tight junction proteins form large complexes and associate with the cytoskeleton in
an ATP depletion model for reversible junction assembly. J Biol Chem 1997 Jun 27;272(26):16133-9.
49. Castillo L, Chapman TE, Yu YM, Ajami A, Burke JF, Young VR. Dietary arginine uptake by the splanchnic region
in adult humans. Am J Physiol 1993 Oct;265(4 Pt 1):E532-E539.
50. Lux GD, Marton LJ, Baylin SB. Ornithine decarboxylase is important in intestinal mucosal maturation and
recovery from injury in rats. Science 1980 Oct 10;210(4466):195-8.
51. Reeds PJ, Burrin DG, Stoll B, Jahoor F, Wykes L, Henry J, et al. Enteral glutamate is the preferential source for
mucosal glutathione synthesis in fed piglets. Am J Physiol 1997 Aug;273(2 Pt 1):E408-E415.
52. Sasaki K, Park JO, Bain A, Reilly KJ, Adamson WT, Koide S, et al. Glutamine protects function and improves
preservation of small bowel segments. J Surg Res 1997 Nov;73(1):90-4.
53. Olson DW, Fujimoto Y, Madsen KL, Stewart BG, Carle M, Zeng J, et al. Potentiating the benefit of vascularsupplied glutamine during small bowel storage - Importance of buffering agent. Transplantation 2002 Jan 27;
73(2):178-85.
54. Abu-Elmagd K, Fung J, Bueno J, Martin D, Madariaga JR, Mazariegos G, et al. Logistics and technique
for procurement of intestinal, pancreatic, and hepatic grafts from the same donor. Ann Surg 2000
Nov;232(5):680-7.
55. Haglund U. Gut ischaemia. Gut 1994 Jan;35(1 Suppl):S73-S76.
56. Nieuwenhuijs VB, Oltean M, Leuvenink HG, Ploeg RJ. Preservation of the Intestine. In: Langnas A, Goulet
O, Quigley EM, Tappenden KA, editors. Intestinal Failure Diagnosis, Management and Transplantation. 1 ed.
Blackwell Publishing; 2009. p. 275-82.
57. Bounous G. Role of the intestinal contents in the pathophysiology of acute intestinal ischemia. Am J Surg
1967 Sep;114(3):368-75.
58. Bounous G. Acute necrosis of the intestinal mucosa. Gastroenterology 1982 Jun;82(6):1457-67.
59. Kokudo Y, Itoh M, Mori S, Karasawa Y, Okano K, Yachida S, et al. Effect of luminal flush on mucosal injury
during cold ischemia in the rat small bowel. Transplant Proc 1996 Jun;28(3):1841-2.
60. Leuvenink HGD, van Dijk A, Freund RL, Ploeg RJ, van Goor H. Luminal preservation of rat small intestine with
University of Wisconsin or Celsior solution. Transplantation Proceedings 2005 Jan;37(1):445-7.
61. DeRoover A, de Leval L, Gilmaire J, Detry O, Coimbra C, Boniver J, et al. Luminal contact with University
of Wisconsin solution improves human small bowel preservation. Transplantation Proceedings 2004
Mar;36(2):273-5.
62. Fujimoto Y, Olson DW, Madsen KL, Zeng J, Jewell LD, Kneteman NM, et al. Defining the role of a tailored
luminal solution for small bowel preservation. American Journal of Transplantation 2002 Mar;2(3):229-36.
63. Salehi P, Zhu LF, Sigurdson GT, Jewell LD, Churchill TA. Nutrient-related issues affecting successful
experimental orthotopic small bowel transplantation. Transplantation 2005 Nov 15;80(9):1261-8.
64. Olson DW, Jijon H, Madsen KL, Al Saghier M, Zeng J, Jewell LD, et al. Human small bowel storage: The role for
luminal preservation solutions. Transplantation 2003 Aug 27;76(4):709-14.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
125
65. Oltean M, Joshi M, Herlenius G, Olausson M. Improved intestinal preservation using an intraluminal
macromolecular solution: evidence from a rat model. Transplantation 2010 Feb 15;89(3):285-90.
66. Zhu JZ, Castillo EG, Salehi P, Avila J, Lakey JR, Churchill TA. A novel technique of hypothermic luminal
perfusion for small bowel preservation. Transplantation 2003 Jul 15;76(1):71-6.
67. Toledo-Pereyra LH, Najarian JS. Small bowel preservation. Comparison of perfusion and nonperfusion
systems. Arch Surg 1973 Dec;107(6):875-7.
68. Iijima K, Salerno RA. Survival of small intestine following excision, perfusion and autotransplantation. Ann
Surg 1967 Dec;166(6):968-75.
69. Austen WG, McLaughlin ED. In vitro small bowel perfusion. Surg Forum 1965;16:359-61.
70. Kuroda Y, Sakai T, Suzuki Y, Tanioka Y, Matsumoto S, Kim Y, et al. Small bowel preservation using a cavitary
two-layer (University of Wisconsin solution perfluorochemical) cold storage method. Transplantation 1996
Feb 15; 61(3):370-3.
71. Toledo-Pereyra LH, Simmons RL, Najarian JS. Prolonged survival of canine orthotopic small intestinal
allografts preserved for 24 hours by hypothermic bloodless perfusion. Surgery 1974 Mar;75(3):368-76.
72. Tsujimura T, Salehi P, Walker J, Avila J, Madsen K, Lakey J, et al. Ameliorating small bowel injury using a
cavitary two-layer preservation method with perfluorocarbon and a nutrient-rich solution. American Journal
of Transplantation 2004 Sep;4(9):1421-8.
126 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
127
CHAPTER 7
REDUCED ISCHEMIA-REOXYGENATION-INJURY IN
RAT INTESTINE AFTER LUMINAL PRESERVATION
WITH A TAILORED SOLUTION
Anne Margot Roskott1, Vincent B. Nieuwenhuijs1, Henri G.D. Leuvenink1, Gerard Dijkstra2,
Petra Ottens1 , Marina H. de Jager3, Patricia Gonçalves Dias Pereira3, Vaclav Fidler4, Geny
M.M. Groothuis3, Rutger J. Ploeg1, Inge A.M. de Graaf3
Affiliations
1 Department of Surgery,
2 Department of Gastroenterology and Hepatology, University Medical Center Groningen, the Netherlands.
3 Department of Pharmacy, Division of Pharmacokinetics, Toxicology and Targeting,
4 Department of Epidemiology, University of Groningen, the Netherlands
ABSTRACT
Background
The intestine is extremely sensitive to ischemic preservation and reoxygenation injury.
Current vascular perfusion and cold storage with UW neglects the intestinal lumen and the
ongoing mucosal metabolism during hypothermia. This study was designed to test the effects
of luminal preservation with an alternative preservation solution in addition to the common
vascular flush with UW on graft viability after preservation and ex-vivo reoxygenation.
Methods
Rat intestine was preserved on ice for 6 h in UW or WMEplus (Williams Medium E with
additional buffering, impermeants and a colloid) after being stapled or after flushing and
filling the lumen with the respective preservation solution. Tissue slices were prepared from
fresh and preserved intestine and were incubated with oxygen for 6 h at 37 ºC to assess
viability after reoxygenation.
Results
Directly after preservation, histological damage was mild and unaffected by preservation
strategy. Contrary to luminal preservation, closed preservation resulted in significantly
decreased ATP levels compared to control. Reoxygenation aggravated damage and revealed
differences between the strategies. Luminal preservation better maintained ATP levels and
histological integrity (vs. closed preservation) for both solutions. Histomorphological integrity
was superior after preservation with WMEplus (vs. UW). Expression of stress responsive genes
was least up-regulated in slices from tissue preserved luminally with WMEplus.
Conclusions
In conclusion, preservation- and reoxygenation injury can be attenuated by luminal
preservation with WMEplus.
130 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
INTRODUCTION
Intestinal transplantation (ITx) was introduced in the 1990s as a promising permanent
therapeutic option for patients with irreversible intestinal failure. Over the past 20 years,
modifications in patient selection, surgical technique, postoperative management and the
evolution in immunosuppressive protocols have significantly improved results of ITx 1;2.
Nevertheless, ITx continues to be a challenging transplant procedure as long-term outcome
remains inferior compared to other organ transplants. Brain death in the donor, preservation
injury, surgical manipulation during retrieval and transplantation and ischemia-reperfusion
injury (IRI) compromise the mucosal barrier 3-8. This consequently leads to the induction
of immuno-inflammatory processes and bacterial translocation, which predispose the
recipient to sepsis and rejection as the main causes of morbidity and mortality after ITx
1-2;8. Maintenance of intestinal integrity is therefore critical to enhance the viability of the
intestinal graft and reduce post-transplant complications.
The intestinal mucosa is well perfused under physiological conditions and extremely
vulnerable to ischemia 9. Unfortunately, an ischemic period after retrieval during preservation
is inevitable to bridge the gap between donor and recipient. The current standard for intestinal
preservation is a vascular wash-out with University of Wisconsin solution (UW) followed by
cold, static storage (CS) in UW. Although the gold standard for many years, it has become clear
that UW is not optimal for preservation of the intestinal graft 10-13. Also, vascular preservation
alone without exposure of the mucosa to the preservation solution may be insufficient to
maintain intestinal integrity during clinically relevant storage periods 14;15. Recent studies
suggest that the intestine benefits from luminal contact with substrates in the preservation
solution that meet physiological demands 11;16-22. No consensus, however, has been reached
about the optimal solution composition and strategy for intestinal preservation.
Preservation damage is known to be aggravated by normothermic reperfusion and
reoxygenation. Unfortunately, all elements of injury to the intestine will accumulate upon
reperfusion during transplantation. For this reason, a transplant model complicates the
distinction of responsible factors of damage. To better unravel the possibly deleterious effect
of preservation and reoxygenation as such, we have used precision-cut intestinal tissue slices
that enabled us to specifically study the early events of reoxygenation injury. In the past,
we have successfully used reoxygenated precision-cut liver slices as an ex-vivo model for
reoxygenation of preserved liver 23. Intestinal slices contain all cell types in their natural
configuration and remain functionally active in culture for at least 8-24 h 24.
The aim of this study was to test the effect of luminal preservation with a modified
enriched intestinal preservation solution after a common vascular wash-out with UW on
the maintenance of intestinal graft viability. Intestinal integrity was evaluated directly after
preservation, and after reoxygenation of intestinal slices.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
131
7
MATERIALS AND METHODS
Animals
Adult male Wistar rats (n=8, HsdCbp:Wu, 330-400 gram, Harlan, Horst, The Netherlands)
were housed under standard conditions with free access to drinking water and rat chow. The
experiments were conducted in accordance with institutional and legislatory regulations.
Surgical procedure
Rats were anesthetized under 5% isoflurane/O2, followed by 2.5% to maintain anesthesia. A
midline laparotomy was performed to expose the aorta at the level of the celiac trunk. The
supraceliac aorta was clamped and 20 ml of ice-cold (4 °C) UW was administered retrogradely
via the infrarenal aorta through a 20 G canula. The suprahepatic vena cava was transected to
facilitate outflow of blood and perfusate.
Starting from 15 cm distally to the stomach, 30 cm of small intestine (jejunum) was
excised. Afterwards rats were sacrificed.
Preservation solutions
As preservation solutions, UW (Viaspan, Belzer, Du Pont, Bristol, UK) and WMEplus were
used. WMEplus was prepared by adding 20 g/L PEG (35 kDa), 50 mmol/L raffinose, 30
mmol/L lactobionate and 10 mmol/L HEPES (Sigma-Aldrich, St Louis, USA) to WME (with
L-glutamine, Invitrogen, Paisley, UK). Finally, 4 parts of the solution were diluted with 1 part of
distilled water to reach a final osmolarity of 330 mOsm/L. The pH was set to 7.4-7.5 by adding
NaOH (26 mmol/L). Solution composition is specified in table 1.
132 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
Table 1 Composition of the tested preservation solutions
Components
mmol/L if not defined
Physical characteristics PH
Osmolarity (mOsm/L)
WME
plus
7.4-7.5
333
Viscosity at 5°C (cP)
Colloid/ impermeants
Buffers
HES (250 kDa) (g/L)
WME
plus
0.8
320
L-Arginine
0.22
L-asparagine-H2O
0.104
50
Lactobionate
24
100
30
L-Aspartate
0.18
L-Cysteine
0.26
L-cysteine 2HCl
0.064
Raffinose
40
L-Glutamic acid
0.27
NaHC03
20.8
L-Histidine
0.08
NaH2PO 4
0.8
L-Glutamine
2.4
L-Glycine
0.48
HEPES
8
L-Isoleucine
0.30
Calciumchloride
1.44
Leucine
0.46
25
Cupricsulphate
0.00008
L-lycine-HCl
0.4
ferricsulphate
0.00008
L-Methionine
0.08
NaCl
94
L-Phenylalanine
0.12
KCl
4.2
L-Proline
0.21
Magnesiumsulphate
0.64
L-Serine
0.76
5
Manganesesulfate
0.8x10-6
Threonine
0.27
Zincsulfate
0.8x10-6
Tyrosine
0.15
NaOH
26
Total Potassium
Others
Components
mmol/L if not defined
Amino acids L-Alanine
5.7
16
KOH
Antioxidants
7.4
PEG (35kDa) (g/L)
KH2PO 4
Anorganic salts
UW
27
100
4.2
125
Vitamins
Tryptophan
0.04
Ascorbic acid
0.008
Biotin
0.0016
Total Sodium
142
27
Choline-Cl
0.008
Total Calcium
1.44
-
Ca-pantothenate
0.0016
Allopurinol
1
Ergocalciferol
0.0024
Glutathion
0.00016 3
Folic acid
0.0016
(Alpha-tocopherol)
1.1x10-5
Menadione-Na(SO3)2
3.2x10-5
(Ascorbic acid)
0.008
Niacinamide
0.0064
Glucose
8.9
Pyridoxal-HCl
0.004
Ribovlavin
0.00024
Sodium pyruvate
Adenosine
0.18
5
Thiamine-HCl
0.00024
Methyllineolate
0.00008
Vitamin A-acetate
0.00024
Vitamin B12
0.00008
i-Inositol
0.008
Vitamin E
1.1x10-5
UW
7
Components of WME are derived from Invitrogen (http://products.invitrogen.com/), bold indicates extra
additions to WME for this study. Components of UW are derived from the instruction leaflet supplied with
the solution.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
133
Experimental groups
The excised jejunum of one rat was divided into five pieces of 5-6 cm which were randomly
assigned to serve either as fresh control without preservation (group 1), or to be preserved
according to one of the four different preservation protocols (groups 2-5) as illustrated in
figure 1. CS was performed on melting ice for 6 h in 5 ml of preservation solution.
Figure 1 Experimental set-up
For all experimental groups a vascular flush with 20 ml of ice-cold (4 °C) UW was applied before preservation.
The jejunum was retrieved and divided into 5 equal pieces, which were randomly assigned to 5 different
groups to exclude confounding by anatomical factors
Group 1 Fresh control without preservation
Group 2 UW closed preservation: The intestinal lumen was directly stapled with vascular clips (Titanium
Clips, Horizon™, Teleflex Medical, North Carolina, USA) followed by CS in UW for 6 h
Group 3 UW luminal preservation: The intestinal lumen was flushed with 15-20 ml of UW. Then the distal
lumen was closed and the intestine was filled (1-2 ml, hydrostatic pressure max. 10 cmH2O). Finally, the
proximal lumen was closed, followed by CS in UW for 6 h
Group 4. WMEplus closed preservation: The intestinal lumen was directly stapled with vascular clips
followed by CS in WMEplus for 6 h
Group 5. WMEplus luminal preservation: The intestinal lumen was flushed with 15-20 ml of WMEplus. Then
the distal lumen was closed and the intestine was filled. Finally, the proximal lumen was closed, followed
by CS in WMEplus for 6 h
T0 reflects the time-point at which preservation starts, whereas T6 reflects the end of the 6 h preservation
period. After reoxygenation, T0-R6 reflects the time-point at which slices from non-preserved tissue have
been reoxygenated for 6 h, whereas T6-R6 reflects 6 h reoxygenation of slices derived from tissue that was
preserved for 6 h
134 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
’Ex-vivo’ reoxygenation
Precision-cut intestinal slices were prepared from control and preserved intestinal segments as
previously described 24;46 and incubated at 370C for 6 h in 12-wells culture plates in 1.3 ml Williams Medium E, supplemented with L- glutamine, extra D-glucose (final concentration 25 mM),
gentamicin (Invitrogen, Paisley, UK, 50 µg/ml) and fungizone (Invitrogen, Paisley, UK, 2.5 µg/
ml)24;46, in an atmosphere of 95% oxygen/ 5% CO2 (dissolved oxygen in the medium was 95%
of maximal saturation as measured by van de Midwoud et al 47. For each outcome parameter
three slices were incubated, except for mRNA analysis by RT-PCR for which six slices were used.
Outcome parameters
The viability of fresh control tissue and preserved intestinal segments was determined
by the assessment of histomorphological integrity and ATP level. In reoxygenated slices,
histomorphological integrity, ATP levels and mRNA expression of several stress-responsive
genes (table 2) were determined.
Table 2 Sequences of primers/genes of interest
forward primer
reverse primer
GAPDH1,2
CGCTGGTGCTGAGTATGTCG
CTGTGGTCATGAGCCCTTCC
Villin1,2
GCTCTTTGAGTGCTCCAACC
GGGGTGGGTCTTGAGGTATT
IL61
ATGTTGTTGACAGCCACTGC
ACAGTGCATCATCGCTGTTC iNOS1
CGTTCGATGTTCAAAGCAAA
CCCTGGACTTCTCACTCTGC
Occludin2
ATTGAGCCCGAGTGGAAAGG
AGAGTGCAGAGTGGAGAGCTGATTAA
ZO12
AACGCTATGAACCCATCCAG
CGGTTTGGTGGTCTGAAAGT
Claudin-32
CTCCGGTTGCCACCTGATTAC
TCCATTCGACTTGGACAGTTCC
HSP-702
GGTTGCATGTTCTTTGCGTTTA GGTGGCAGTGCTGAGGTGTT
HO-12
CTCGCATGAACACTCTGGAGAT
GCAGGAAGGCGGTCTTAGC
The following amplification conditions were used for real time PCR:
1 10 min at 95 oC and then 40 cycles of amplification at 95 oC for 15 s, at 56 oC for 15 s and at 72 oC for
40 s followed by a dissociation stage: at 95 oC for 15 s, at 60 oC for 15 s and at 95 oC for 15s
2 2
min at 50°C and 10 min at 95°C. This was followed by 40 cycles amplification consisting of denaturation
for 15 sec at 95°C followed by annealing and extension for 1 min at 60°C followed by a dissociation stage:
at 95 oC for 15 s, at 60 °C for 15 s and at 95 °C for 15s
Histological examination of tissue
Full thickness samples of control and preserved intestinal tissue were fixed in 4% buffered
formalin, dehydrated, embedded in paraffin, cut (3-5 µm) and stained with haematoxylin and
eosin (H&E). Histological damage was assessed using the Park score 9.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
135
7
Histological examination of slices
Histomorphological appearance of slices after reoxygenation was assessed using a scoring
system that was developed to evaluate the integrity of cultured intestinal slices. The structure
of the slices was evaluated by ascribing a score between 0 (no changes) and 3 to six aspects:
viability and shape (columnar or flat) of the epithelial cells, viability of the stroma, crypts and
muscle layer and flattening of the villi. Scores of the six separate morphological parameters
were added up to a total morphology score between 0-18, reflecting the overall integrity of
the slices.
All histological samples (tissue and slices) were evaluated by a pathologist blinded to the
assignment of experimental groups.
ATP measurement in tissue and slices
ATP samples were put in 1 ml ice-cold 70% ethanol, containing 2 mM EDTA (pH 10.9),
directly snap-frozen in liquid nitrogen and stored at -80 ºC. The ATP content was determined
after centrifugation in the supernatant as described before 24. The protein content of tissue
samples was determined in the pellet to normalize the ATP concentration. Slice ATP values
were corrected with the average protein content of three slices from non-preserved tissue.
For this purpose, the pellet was dissolved with 5 M NaOH and then diluted 50 times with
MilliQ water after which the protein content was determined colorimetrically using BioRad
protein assay dye reagent (Bio-Rad, Munich, Germany).
Gene expression levels
After reoxygenation, six slices were collected together in one sample vial, snap frozen in
liquid nitrogen and stored at -80ºC. After thawing, RNA was isolated using the RNeasy
Mini Kit (Qiagen, Hilden, Germany). cDNA was prepared as described previously 5. PCR was
performed according to table 2. All assays were performed at least in duplicate. Dissociation
curve analyses were performed for each reaction to check the formation of one specific
product. For each gene the expression was normalized with the mean computed tomographic
(CT) threshold value of villin (for genes expressed in epithelial cells) or GAPDH (other genes).
Results were expressed as 2-[ΔΔCT], which is an index of the amount of mRNA expressed
relative to the chosen housekeeping gene (GAPDH or villin) and the expression in slices
derived from non-preserved tissue.
136 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
STATISTICS
Data were analyzed by fitting mixed-effect models 48. For the ATP concentration and the RNA
expression calculations, values were first transformed to the natural logarithm. The fitted
models consisted of random intercepts that were related to the individual rats (intestines)
and the replicates (of slices or pieces) measured for each outcome parameter within the rat
(intestine). The calculated fixed effects express the influence of the preservation solution or
strategy on the outcome parameters. To be able to distinguish between the ‘solution effect’
(UW vs. WMEplus) and the ‘strategy effect’ (closed vs. luminal preservation), a possible
interaction between these parameters was determined. When no interactions were found, it
could be concluded that the ‘solution effect’ was independent of the strategy that was used,
and vice versa. Statistical package R (library NLME) was used for computations. P-values <
0.05 were considered to be significant.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
137
7
RESULTS
Viability of preserved intestinal tissue
Non-preserved intestine (T0) showed hardly any structural damage, reflected by a mean
Park score of 0.13 (range 0-1). Preservation clearly affected morphology: the mean Park score
after preservation was significantly higher (p<0.001) than for non-preserved control tissue,
regardless of preservation solution and strategy (table 3). No differences in Park score were
observed between the different preservation groups.
ATP levels were decreased after preservation (p<0.04) in tissue of both closed
preservation groups compared to control tissue, whereas no significant decrease was observed
in the luminally preserved group (table 3). However, there were no significant differences in
ATP levels between the different preservation strategy groups when directly compared with
each other.
Table 3 Park scores and ATP results of control and preserved tissue
Preservation
Park score
ATP level (nmol/mg protein)
Control, not preserved (T0)
0.13 (0–1.0)
1.96 (0.7-2.7)
UW closed (T6)
2.6a (0-5.0)
1.4b (0.4-3.2)
UW luminal (T6)
2.4a (0.5-4.0)
2.1 (1.3-5.3)
WMEplus closed (T6)
2.6a (1.0-3.8)
1.29b (0.6-2.5)
WME plus luminal (T6)
2.2a (2.0-3.0)
1.31 (0.7-2.6)
T0: control, no preservation, direct assessment
T6: 6 h preservation, followed by assessment
Values represent the mean of intestinal tissue of eight rats. The range is displayed between the brackets.
There were no significant differences in Park score or ATP levels between the preservation strategy groups
when directly compared with each other.
a Values are significantly higher than control (p<0.001)
b Values are significantly lower than control (P<0.05)
138 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
Viability of reoxygenated intestinal slices
Morphological integrity of reoxygenated slices from preserved intestinal tissue was
significantly decreased (reflected by the higher total morphology score) in comparison to
reoxygenated slices from control tissue (figure 2a) for all four preservation groups. However,
morphology was significantly less affected in slices from tissue preserved with WMEplus than
in slices from tissue preserved with UW, independent of the preservation strategy (p<0.001,
figure 2a, table 4). Also, independent of the preservation solution, morphology was superior
after luminal preservation than after closed preservation (p<0.001, figure 2a, table 4).
The beneficial effect of luminal preservation and WMEplus was reflected by all separate
morphology parameters (table 4) except for villus flattening, which was not prevented by
either combination of strategy and preservation solution. Furthermore, viability of the muscle
layer and the shape of epithelial cells were not significantly improved by luminal preservation.
The ATP content was significantly lower in reoxygenated slices from all preservation
groups than in reoxygenated slices of tissue that was not preserved (figure 2b). After
direct comparison of the preservation groups it was noted that, independent of the used
preservation solution, ATP content was higher in slices after luminal preservation than after
closed preservation (table 4).
Table 4 Effect of preservation strategy and solution on slice viability after reoxygenation
Viability parameter
luminal>closed1
WMEplus>UW2
interaction3
Total morphology score
p=0,0001
p=0,0001
no
Viability enterocytes
p=0,0031
p=0,0017
no
Shape epithelium
No
P<0,0001
no
Viability Stroma
P<0,0001
p=0,023
no
Villi flattening
No
no
no
Viability crypts
p=0,0018
p=0,0007
no
Viability muscle layer
No
p=0,023
no
RNA concentration
p=0,0003
p=0,0001
no
ATP content
P=0.0003
no
no
Morphology
1 p
value <0.05 indicates superiority of slices of luminally preserved tissue compared to slices of tissue that
was not luminally exposed to the preservation solution.
2 p value <0.05 indicates superiority of slices of tissue preserved with WMEplus compared to slices of
tissue that was preserved with UW.
3 I nteraction was found between preservation strategy and preservation solution.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
139
7
a
b
Figure 2 Viability of intestinal slices after reoxygenation
(a) Morphology score: Scores of separate morphological parameters were added up to a total morphology
score (maximum score 18) to indicate overall viability of the slices.
a Values are significantly higher than control value (p<.05)
b Values are significantly lower than for slices from tissue preserved with UW, independent of the
preservation strategy (p<0.001)
c Values are significantly lower than for slices of tissue after closed preservation, independent of the
preservation solution (p<0.001)
(b) ATP level: Values represent mean ATP level (nmol/mg protein) of tissue of 8 experiments (intestines of
8 rats).
a ATP levels are significantly lower than control (p<.05)
b ATP levels were significantly higher than after closed preservation, independent of the preservation
solution (p<0.001)
The band in the middle of the boxes reflects the median of the data set. The upper edge indicates the 75th
percentile of the data set, whereas the lower edge indicates the 25th percentile. The length of the box
represents the inter quartile range (IQR). The whiskers mark the highest and lowest values within a distance
of 1,5 IQR to the box.
Gene expression in reoxygenated slices
Remarkably, less RNA could be extracted from reoxygenated slices that were preserved with
UW without luminal exposure than from slices from preserved tissue from the other groups
(table 4). The highest RNA recovery was obtained from slices of tissue that was luminally
preserved with WMEplus. RNA yield reflects the capacity of cells to produce RNA. RNA
yield closely corresponded to the outcome of other viability parameters (histology and ATP
content), which indicates that more RNA could be extracted from qualitatively better tissue.
In general, gene expression was least affected (most resembled expression in slices from
control tissue) when luminal preservation with WMEplus was applied (table 5). Furthermore,
table 5 shows the contribution of the preservation solution and preservation strategy to the
differences in gene expression. The expression of villin, a protein that is exclusively expressed
in epithelial cells was unaffected by luminal preservation with WMEplus, but significantly
down-regulated in the other preservation groups. However, direct comparison of the
preservation solutions and preservation strategies only showed a beneficial effect of the
luminal preservation strategy.
140 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
The expression of genes known for their response to cellular stress, iNOS (inducible nitric
oxide synthase), IL6 (interleukin 6), HO-1 (heme-oxygenase 1) and Hsp70 (Heat shock protein
70), was most pronouncedly upregulated in slices preserved according to the clinical standard
(closed preservation with UW). This induction was significantly lower after preservation with
WMEplus, and in the case of iNOS and HO1, also after luminal preservation. Furthermore, the
mRNA expression of tight junction proteins was up-regulated in slices from preserved tissue
compared to control. Again, expression most closely resembled that of slices from control
tissue when WMEplus in combination with luminal preservation was applied.
Table 5 Gene expression in slices of preserved tissue
7
UW closed
UW
luminal
WMEplus
closed
WMEplus
luminal
GAPDH
1,4
(0,7-3,2)
1,2
(0,7-3,2)
1,2
(0,9-1,3)
1,2
(0,8-1,8)
no
no
no
Villin
0,4
(0,1-1,0)
0,5
(0,2-1,6)
0,4
(0,1-0,8)
0,9
(0,1-2,5)
p=0,007
no
no
IL6/GAPDH
Proinflammatory
marker
4,6
(0,2-11,9)
3,1
(0,4-6,3)
2,3
(0,2-5,9)
1,5
(0,3-4,2)
no
p=0,0082
no
tight junction Occludin/
proteins
villin
1,9
(0,9-5,3)
1,4
(0,9-2,7)
1,5
(0,8-2,5)
1,3
(0,8-2,5)
no
no
no
ZO1/villin
3,8
(1,5-7,0)
2,9
(1,7-2,0)
2,5
(1,5-3,4)
2
(0,9-3,7)
no
p=0,0065
no
Claudin-3/
villin
2,5
(1,2-6,1)
2
(1,2-2,9)
1,7
(1,1-2,4)
1,4
(0,9-2,3)
no
p=0,0059
no
Cellular stress HSP-70/
marker
GAPDH
10,4
(1,2-51,8)
10,1
(1,5-50,5)
5,9
(1,5-22,3)
3,4
(0,7-8,6)
no
p=0,04
no
HO-1/
GAPDH
5,4
(1,8-8,0)
3,1
(2,0-6,4)
3,
(1,7-8,5)
1,9
(0,8-4,7)
p=0,0006
p=0,006
no
iNOS/villin
14,4
(0,3-69,0)
4,1
(0,2-14,2)
p=0,0014
p=0,014
no
Housekeeping gene
Epithelial cell
marker
23,5
11
( 0,8-66,2) (0,3-63,4)
luminal>closed1 WMEplus>UW2 interaction3
Values represent average fold expression (in bold) and range of the measured values. mRNA expression of
control slices of not-preserved tissue incubated for 6 h is set to 1.
mRNA expression significantly up-regulated in comparison to control slices.
mRNA expression not significantly different from control slices,
mRNA expression significantly down-regulated in comparison to control slices.
1 Gene expression was significantly less affected in slices of luminally preserved tissue than in slices of
tissue that was not luminally exposed to preservation solution, p value is given.
2 Gene expression was significantly less affected in slices of tissue preserved in WMEplus than in slices of
tissue that was preserved with UW, p value is given.
3 Interaction between preservation strategy and preservation solution
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
141
DISCUSSION
Ischemic preservation and reoxygenation upon reperfusion negatively affect the intestinal
graft and result in inflammatory and immunological complications after ITx. Standard
hypothermic preservation causes substantial damage to the vulnerable intestinal graft,
particularly since vascular wash-out and CS with UW seem to insufficiently protect this organ
20. Development of a specific intestinal preservation solution and/or protective conditions
is essential to improve the long-term outcome of ITx. We assessed the potential of luminal
preservation and the use of an alternative CS solution to protect intestinal graft quality.
This study endorses that actual graft damage is not revealed directly after a clinically relevant
preservation span of 6 h, irrespective of the preservation solution and strategy, but becomes
manifest after reoxygenation 25. We were able to reduce the encountered preservation- and
reoxygenation injury by luminal preservation with an alternative solution (WMEplus) for
hypothermic preservation of the intestine after the standard vascular wash-out with UW.
WMEplus is based on WME (with L-glutamine), a relatively cheap, ready-to-use medium
that contains many ingredients that have previously shown to be beneficial for intestinal
preservation. To increase its potential as a preservation solution, we added PEG (35 kDa),
raffinose, lactobionate and the powerful HEPES buffer. Since the composition of WMEplus
differs in many aspects from UW (table 1) we can only speculate about which ingredients are
responsible for the apparent superiority of WMEplus in the present study. Earlier studies have
identified colloid agents, amino acids (AA) and/or buffering capacity as the possible crucial
factors responsible for the protective effect of luminal preservation with tailored solutions
(16;22;26).
WMEplus contains the colloid polyethylene glycol (PEG) instead of HES in UW to reduce
osmotic cell swelling. The efficacy of hydroxy ethyl starch (HES) is controversial 27;28. The
water-soluble PEG macromolecule with abundant hydroxyl groups is assumed to effectively
retain water. Furthermore, PEG binds to enterocyte-attached sphingolipids, which may
stabilize the epithelium and prevents shifts of luminal contents (e.g. water and electrolytes)
into the tissue. Additionally, PEG acts as a free radical scavenger 29-31. Recently, Oltean
et al. reported that intraluminal preservation with a PEG containing solution decreased
preservation injury 32.
Fujimoto et al. showed improved viability of intestinal grafts directly after preservation
by using an AA-rich solution. AA are postulated to play a cytoprotective role by catering
for metabolic and synthetic elements of intestinal metabolism 16;22. This benefit was most
pronounced after luminal exposure to AA during preservation 16;17;33 and was attributed
to a better maintenance of energy levels. Especially the most vulnerable epithelial cells at
the villus top seem to benefit from luminally supplied nutrients 17. WME (with L-glutamine)
contains 20 different AA. Particularly glutamine has been proposed to be favorable for
intestinal preservation, since it is the main energy substrate of the enterocyte. The addition
142 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
of glutamine to the preservation solution requires high buffering capacity to counteract
unphysiological pH shifts when glutamine metabolism is sustained in a system devoid of
hepatic detoxification 16. For this reason, we have added the powerful sulfonic buffer HEPES
to WMEplus. Future studies should identify the beneficial effect of each ingredient, or group
of ingredients, of WMEplus, by systematical comparison of a range of solutions with different
compositions.
Luminal preservation is postulated as an effective strategy to reduce intestinal graft
damage 11;14;16;17;32;33. We demonstrated that luminal preservation improved energy levels
of preserved tissue directly after preservation and after reoxygenation compared to closed
preservation. The luminal uptake of additional cytoprotective agents like AA may not be the
only explanation for the increased viability however, since luminal preservation with UW
also improved energy levels. Possibly, the dilution of enteric cytotoxic intestinal contents
by luminal flushing and the faster cooling during luminal preservation both contributed to
improved graft preservation, independent of solution composition, as suggested before
14;20. Luminal preservation is clinically feasible by nasogastric administration to the donor
simultaneously with cold vascular perfusion.
The local production of pro-inflammatory cytokines, chemokines and reactive oxygen
species (ROS) during reoxygenation of the ischemic tissue is a crucial early event in the
cascade that leads to tissue ischemia reperfusion injury (IRI) 34;35. These signaling factors
trigger a specific stress-response aiming to counteract the physiological challenges provoked
by reoxygenation. Precision-cut slices, which contain all intestinal cell types (including
resident macrophages) in their physiological matrix, have enabled us to mimic this early phase
of IRI, under ex-vivo well-controlled conditions.
Several transcription factors are known to be activated by reoxygenation associated
ROS formation. One of these transcription factors is NF-E2-related factor 2 (Nrf2). Activation
of Nrf2 has protective effects aiming to counteract an ischemic insult by upregulation of
the expression of the antioxidant HO-1 36, the stress response protein hsp70 37-38 and of
tight junction proteins 39 that play a central role in maintaining the integrity of the intestinal
physical barrier 6;7, necessary to prevent (systemic) inflammation after ITx 3;35;40. We found
that the gene expression of HSP70, HO1 and of the tight junction proteins ZO-1, Claudin-3
and Occludin-1 was generally up-regulated in reoxygenated slices from preserved intestinal
tissue. The most marked upregulation was consistently shown in reoxygenated slices of
tissue preserved with UW, without luminal exposure. Since these slices also showed most
morphological damage and had the lowest ATP content we concluded that most ischemic
stress as a result of ROS formation was induced in the latter preservation group.
Another key factor in the etiology of IRI is the nuclear factor kappaB (NF-κB), which
induces many pro-inflammatory reactions that serve as an adaptive mechanism on the one
hand, but also reflect tissue damage on the other hand. A number of studies have shown that
suppression of NF-κB protects against IRI 41-44. Amongst the proteins that are upregulated due
to induction by NF-κB are the pro-inflammatory cytokine IL-6 45 and iNOS, which both play
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
143
7
a role in IRI 3. We demonstrated that the expression of iNOS and IL6 is lower in tissue that is
preserved with WMEplus compared to UW. Furthermore, iNOS is significantly less upregulated
after luminal preservation compared to closed preservation. The lowest expression of both
Nrf2 and NF-κB driven stress responsive genes was consequently demonstrated in tissue that
was luminally preserved with WMEplus, which also showed the best morphology and highest
ATP content, indicating that the least stress was induced in this group.
A limitation of this study is the lack of ultimate proof using a transplant model. However,
since the cascade of injury after transplantation and in-vivo reperfusion is rather complex,
we have deliberately chosen to first study the effect of preservation in combination with
reoxygenation in a multi-cellular reperfusion model without any alloreactive features.
In conclusion, our data consistently demonstrate that luminal preservation as well as
preservation with WMEplus, independently reduce cellular stress and subsequent loss of
viability of preserved intestinal tissue after ex-vivo reoxygenation. Our next experiments will
concern assessment of the proposed strategy in a transplant model to further refine intestinal
preservation and reduce intestinal graft injury, ultimately improving the outcome after ITx.
144 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
REFERENCE LIST
1. Fryer JP. The current status of intestinal transplantation. Curr Opin Organ Transplant 2008 Jun;13(3):266-72.
2. Pascher A, Kohler S, Neuhaus P, Pratschke J. Present status and future perspectives of intestinal
transplantation. Transpl Int 2008 May;21(5):401-14.
3. Grotz MR, Deitch EA, Ding J, Xu D, Huang Q, Regel G. Intestinal cytokine response after gut ischemia: role of
gut barrier failure. Ann Surg 1999 Apr;229(4):478-86.
4. Koudstaal LG, ‘t Hart NA, van den Berg A, Olinga P, van Goor H, Ploeg RJ, et al. Brain death causes structural
and inflammatory changes in donor intestine. Transplantation Proceedings 2005 Jan;37(1):448-9.
5. Koudstaal LG, ‘t Hart NA, Ottens PJ, van den Berg A, Ploeg RJ, van Goor H, et al. Brain death induces
inflammation in the donor intestine. Transplantation 2008 Jul 15;86(1):148-54.
7
6. Thuijls G, de Haan JJ, Derikx JP, Daissormont I, Hadfoune M, Heineman E, et al. Intestinal cytoskeleton
degradation precedes tight junction loss following hemorrhagic shock. Shock 2009 Feb;31(2):164-9.
7. Wang M, Li Q, Wang J, Li Y, Zhu W, Li N, et al. Intestinal tight junction in allograft after small bowel
transplantation. Transplant Proc 2007 Jan;39(1):289-91.
8. Zou Y, Hernandez F, Burgos E, Martinez L, Gonzalez-Reyes S, Fernandez-Dumont V, et al. Bacterial
translocation in acute rejection after small bowel transplantation in rats. Pediatr Surg Int 2005
Mar;21(3):208-11.
9. Park PO, Haglund U, Bulkley GB, Falt K. The sequence of development of intestinal tissue injury after
strangulation ischemia and reperfusion. Surgery 1990 May;107(5):574-80.
10. Kokudo Y, Furuya T, Takeyoshi I, Nakamura K, Zhang S, Murase N, et al. Comparison of University of
Wisconsin, Euro-Collins, and lactated Ringer’s solutions in rat small bowel preservation for orthotopic small
bowel transplantation. Transplant Proc 1994 Jun;26(3):1492-3.
11. Leuvenink HGD, van Dijk A, Freund RL, Ploeg RJ, van Goor H. Luminal preservation of rat small intestine with
University of Wisconsin or Celsior solution. Transplantation Proceedings 2005 Jan;37(1):445-7.
12. Schweizer E, Gassel A, Deltz E, Schroeder P. Morphologic and histologic alterations after small-bowel
transplantation--a comparison of different perfusion solutions. Transplant Proc 1992 Jun;24(3):1087.
13. Schweizer E, Gassel AM, Deltz E, Schroeder P. A comparison of preservation solutions for small bowel
transplantation in the rat. Transplantation 1994 May 15;57(9):1406-8.
14. DeRoover A, de Leval L, Gilmaire J, Detry O, Coimbra C, Boniver J, et al. Luminal contact with University
of Wisconsin solution improves human small bowel preservation. Transplantation Proceedings 2004
Mar;36(2):273-5.
15. Takeyoshi I, Zhang S, Nomoto M, Zhu Y, Kokudo Y, Suzuki T, et al. Mucosal damage and recovery of the
intestine after prolonged preservation and transplantation in dogs. Transplantation 2001 Jan 15;71(1):1-7.
16. Fujimoto Y, Olson DW, Madsen KL, Zeng J, Jewell LD, Kneteman NM, et al. Defining the role of a tailored
luminal solution for small bowel preservation. American Journal of Transplantation 2002 Mar;2(3):229-36.
17. Ito A, Higashiguchi T, Kitagawa M, Yokoi H, Noguchi T, Kawarada Y. Effect of luminal administration
of glutamine to suppress preservation graft injury in small bowel transplants. Transplant Proc 1995
Feb;27(1):780-2.
18. Kokudo Y, Itoh M, Mori S, Karasawa Y, Okano K, Yachida S, et al. Effect of luminal flush on mucosal injury
during cold ischemia in the rat small bowel. Transplant Proc 1996 Jun;28(3):1841-2.
19. Olson DW, Fujimoto Y, Madsen KL, Stewart BG, Carle M, Zeng J, et al. Potentiating the benefit of vascularsupplied glutamine during small bowel storage - Importance of buffering agent. Transplantation 2002 Jan
27;73(2):178-85.
20. Olson DW, Jijon H, Madsen KL, Al Saghier M, Zeng J, Jewell LD, et al. Human small bowel storage: The role for
luminal preservation solutions. Transplantation 2003 Aug 27;76(4):709-14.
21. Salehi P, Zhu JZJ, Castillo EG, Avila J, Lakey J, Churchill TA. Preserving the mucosal barrier during small bowel
storage. Transplantation 2003 Sep 27;76(6):911-7.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
145
22. Wei L, Hata K, Doorschodt BM, Buttner R, Minor T, Tolba RH. Experimental small bowel preservation using
Polysol: a new alternative to University of Wisconsin solution, Celsior and histidine-tryptophan-ketoglutarate
solution? World J Gastroenterol 2007 Jul 21;13(27):3684-91.
23. ‘t Hart NA, van der Plaats A, Faber A, Leuvenink HG, Olinga P, Wiersema-Buist J, et al. Oxygenation during
hypothermic rat liver preservation: an in vitro slice study to demonstrate beneficial or toxic oxygenation
effects. Liver Transpl 2005 Nov;11(11):1403-11.
24. de Kanter R, Tuin A, van de Kerkhof E, Martignoni M, Draaisma AL, de Jager MH, et al. A new technique for
preparing precision-cut slices from small intestine and colon for drug biotransformation studies. J Pharmacol
Toxicol Methods 2005 Jan;51(1):65-72.
25. Oltean M, Pullerits R, Zhu C, Blomgren K, Hallberg EC, Olausson M. Donor pretreatment with FK506 reduces
reperfusion injury and accelerates intestinal graft recovery in rats. Surgery 2007 May;141(5):667-77.
26. Salehi P, Madsen K, Zhu J, Castillo E, Avila J, Lakey JRT, et al. Alleviating ischemia-reperfusion injury in small
bowel. American Journal of Transplantation 2004 May;4(5):728-37.
27. Morariu AM, Vd Plaats A, Oeveren V, ‘t Hart NA, Leuvenink HG, Graaff R, et al. Hyperaggregating effect of
hydroxyethyl starch components and University of Wisconsin solution on human red blood cells: a risk of
impaired graft perfusion in organ procurement? Transplantation 2003 Jul 15;76(1):37-43.
28. Ploeg RJ, van Bockel JH, Langendijk PT, Groenewegen M, van der Woude FJ, Persijn GG, et al. Effect of
preservation solution on results of cadaveric kidney transplantation. The European Multicentre Study Group.
Lancet 1992 Jul 18;340(8812):129-37.
29. Boni LT, Hah JS, Hui SW, Mukherjee P, Ho JT, Jung CY. Aggregation and fusion of unilamellar vesicles by
poly(ethylene glycol). Biochim Biophys Acta 1984 Sep 5;775(3):409-18 29.
30. Faure JP, Petit I, Zhang K, Dutheil D, Doucet C, Favreau F, et al. Protective roles of polyethylene glycol
and trimetazidine against cold ischemia and reperfusion injuries of pig kidney graft. Am J Transplant 2004
Apr;4(4):495-504.
31. Hauet T, Mothes D, Goujon JM, Carretier M, Eugene M. Protective effect of polyethylene glycol against
prolonged cold ischemia and reperfusion injury: study in the isolated perfused rat kidney. J Pharmacol Exp
Ther 2001 Jun;297(3):946-52.
32. Oltean M, Joshi M, Herlenius G, Olausson M. Improved intestinal preservation using an intraluminal
macromolecular solution: evidence from a rat model. Transplantation 2010 Feb 15;89(3):285-90.
33. Salehi P, Zhu LF, Sigurdson GT, Jewell LD, Churchill TA. Nutrient-related issues affecting successful
experimental orthotopic small bowel transplantation. Transplantation 2005 Nov 15;80(9):1261-8.
34. Carden DL, Granger DN. Pathophysiology of ischaemia-reperfusion injury. J Pathol 2000 Feb;190(3):255-66.
35. Deitch EA, Xu D, Franko L, Ayala A, Chaudry IH. Evidence favoring the role of the gut as a cytokine-generating
organ in rats subjected to hemorrhagic shock. Shock 1994 Feb;1(2):141-5.
36. Ishii T, Itoh K, Takahashi S, Sato H, Yanagawa T, Katoh Y, et al. Transcription factor Nrf2 coordinately
regulates a group of oxidative stress-inducible genes in macrophages. J Biol Chem 2000 May
26;275(21):16023-9.
37. Jaattela M. Heat shock proteins as cellular lifeguards. Ann Med 1999 Aug;31(4):261-71.
38. Tsuchihashi S, Fondevila C, Kupiec-Weglinski JW. Heme oxygenase system in ischemia and reperfusion injury.
Ann Transplant 2004;9(1):84-7.
39. Zhao J, Moore AN, Redell JB, Dash PK. Enhancing expression of Nrf2-driven genes protects the blood brain
barrier after brain injury. J Neurosci 2007 Sep 19;27(38):10240-8.
40. Wang M, Li Q, Wang J, Li Y, Zhu W, Li N, et al. Intestinal tight junction in allograft after small bowel
transplantation. Transplant Proc 2007 Jan;39(1):289-91.
41. Souza DG, Vieira AT, Pinho V, Sousa LP, Andrade AA, Bonjardim CA, et al. NF-kappaB plays a major role
during the systemic and local acute inflammatory response following intestinal reperfusion injury. Br J
Pharmacol 2005 May;145(2):246-54.
42. Suzuki T, Yamashita K, Jomen W, Ueki S, Aoyagi T, Fukai M, et al. The novel NF-kappaB inhibitor,
dehydroxymethylepoxyquinomicin, prevents local and remote organ injury following intestinal ischemia/
reperfusion in rats. J Surg Res 2008 Sep;149(1):69-75.
146 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
43. Pascher A, Klupp J, Langrehr JM, Neuhaus P. Anti-TNF-alpha therapy for acute rejection in intestinal
transplantation. Transplant Proc 2005 Apr;37(3):1635-6.
44. Coleman TR, Westenfelder C, Togel FE, Yang Y, Hu Z, Swenson L, et al. Cytoprotective doses of erythropoietin
or carbamylated erythropoietin have markedly different procoagulant and vasoactive activities. Proc Natl
Acad Sci U S A 2006 Apr 11;103(15):5965-70.
45. Matsui H, Ihara Y, Fujio Y, Kunisada K, Akira S, Kishimoto T, et al. Induction of interleukin (IL)-6 by
hypoxia is mediated by nuclear factor (NF)-kappa B and NF-IL6 in cardiac myocytes. Cardiovasc Res 1999
Apr;42(1):104-12.
46. van de Kerkhof EG, de Graaf IA, de Jager MH, Meijer DK, Groothuis GM. Characterization of rat small
intestinal and colon precision-cut slices as an in vitro system for drug metabolism and induction studies.
Drug Metab Dispos 2005 Nov;33(11):1613-20.
47. van Midwoud PM, Groothuis GM, Merema MT, Verpoorte E. Microfluidic biochip for the perifusion of
precision-cut rat liver slices for metabolism and toxicology studies. Biotechnol Bioeng 2010 Jan 1;105(1):18494.
48. Pinheiro and Bates. Mixed Effect Models in S and S-plus, Springer 2000. Springer, the Netherlands; 2000.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
147
7
CHAPTER 8
SUMMARY INCLUDING FUTURE PERSPECTIVES
SUMMARY INCLUDING FUTURE PERSPECTIVES
In Chapter 1 a general introduction and rationale for the thesis is presented. Chronic Intestinal
Failure (CIF) is described as the condition of a patient who cannot match his nutritional
demands to stay healthy by enteral intake. This condition can be caused by a variety of
underlying diseases that lead to either insufficient intestinal surface length or insufficient
functional intestinal capacity. Unfortunately, a good therapy to fully replace the intricate
function of the small intestine does not exist. The infusion of nutritional components via a
central venous device (parenteral nutrition, TPN) allows these patients to survive. TPN can
be administered at home; the treatment is then called home parenteral nutrition (HPN).
The situation of CIF patients is complex and all patients have an extensive medical history
involving multiple physicians and different hospital settings. In addition, TPN or HPN is a
radical, costly treatment full of ‘twists and turns’. There is an ever-existing threat of serious
complications and this intensive treatment has a great impact on the practical, social and
psychological life of the patient (and his/her family). In the Netherlands, HPN care is mainly
coordinated by specialists in the Academic Medical Center in Amsterdam and in Nijmegen.
Intestinal Transplantation is an alternative treatment for CIF. To date, the survival on
TPN treatment is still superior to survival after ITx. Therefore, ITx remains a rescue therapy
for a small group of selected patients with failure of HPN treatment. Although major
improvements in ITx have been achieved since it was introduced in the ‘90s, there are still
some challenges to overcome to further improve the results. The quality of the organ graft is
generally considered as a key factor of outcome. Therefore it is assumed that the selection of
the best intestinal graft donors and optimal preservation of the intestinal graft (bridging the
gap between graft procurement in the donor and implantation in the recipient) are suggested
as potential areas for improvements. In the Netherlands, ITx is exclusively performed in
the University Medical Center Groningen. Along with a focus on improvement of ITx, the
importance of a multidisciplinary collaboration between HPN Centers and the transplant
Center is being recognized to lift CIF care to a higher level. Treatment decision-making
and timing is complicated. It remains a difficult task to estimate which patient benefits
from continuation of HPN treatment and which patient is better of with ITx, -and if so-,
at what moment. A good overview of complete and update patient information is a crucial
starting point to timely identify and refer potential ITx candidates from the HPN Center to
the transplant Center. To facilitate this collaboration the online Dutch Registry of Intestinal
Failure and Transplantation (DRIFT) was developed in the Netherlands.
It should be clear that treatment superiority is paramount but, in these days, socioeconomic aspects cannot be ignored. Balancing medical innovation and patient needs with
prioritization of reimbursement has become standard practice for national health care
budgets. Both HPN and ITx are costly but exact amounts and data on cost effectiveness are
unknown.
The different chapters that form this thesis examine various aspects of CIF, HPN and ITx.
150 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
These different aspects and their relation are graphically displayed in figure 1.
CIF
2
Legend
3
HPN
4
Death
failure
HPN
5
failure
ITx
6 7
2
Chapter 2
Dutch multidisciplinary
Registry of Intestinal
Failure and Intestinal
Transplantation (DRIFT)
3
Chapter 3
Quality of life with HPN
4
Chapter 4
Cost of HPN and ITx
5
Chapter 5
ITx donor selection and
graft viability
6 7 Chapter 6/7 Graft preservation
ITx
donor
selection
ITx
graft
8
ITx
Abbreviations
CIF - Chronic Intestinal Failure
HPN - Home Parenteral Nutrition
ITx - Intestinal Transplantation
Figure 1 illustrates the course of the patient with CIF within time. The yellow numbers display different
aspects that have been introduced in Chapter 1 and that are the focus of study in the 7 Chapters comprising
this thesis.
In the past decade, exact data on Dutch patients with CIF receiving HPN, of potential
candidates for ITx and of patients after ITx have been lacking.
Chapter 2 describes the Dutch Registry of Intestinal Failure and Intestinal Transplantation
(DRIFT) that was initiated by the Dutch Intestinal Failure Foundation. This foundation is
the multidisciplinary collaboration of professionals from the different centers involved
in the treatment of patients with CIF and ITx in the Netherlands: the 2 main Dutch HPN
Centers (University Medical Center Nijmegen and Amsterdam Medical Center) and the
Dutch Intestinal Transplant Center (University Medical Center Groningen). The working
group consists of gastroenterologists, pediatricians, abdominal and transplant surgeons,
psychologists and a nutritional support team with experienced dieticians. At the beginning
the group experienced a lack of overview of the individual patient’s condition and (scattered)
treatment. Also indistinctness regarding the (timely) referral for ITx and was noted. After the
development of the DRIFT register between 2008-2012, in January 2013 patient data were
entered and a national multidisciplinary cross-sectional analysis of patients and treatment
could be performed. The analysis displayed that a total number of 173 patients were treated
in the Netherlands with HPN for CIF, indicating a prevalence of 11.39/million for adults and
6.72/million for children. Underlying diseases were short bowel syndrome (n=85, 49%),
motility disorder (n=73, 42%) or enteropathy (n=15, 9%). Complications are notorious
during HPN treatment. The occurrence of the most-feared complications (line occlusion and
infection, liver disease) was relatively moderate compared with our expectation. In 2012,
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
151
12.1% of the patients had ≥1 line occlusions and 26.6% ≥1 line sepsis. Hyperbilirubinemia was
4% in adults (0% in children) and portal hypertension was documented in 14% of adults and
31% of children. Bone density was decreased in a surprisingly high percentage (46.8%) of
the patients. We found a discrepancy between the number of patients who met the criteria
for ITx and the number of patients who actually underwent ITx. Forty-eight patients (27.7%)
met the ITx criteria, 12 patients underwent ITx since 2001 (underlying diseases short bowel
syndrome (n=7, 58%), enteropathy (n=3, 25%) or motility disorder (n=2, 17%)). This finding
suggests that an adjustment of the indications for ITx is necessary. On January 1, 2013, nine
transplanted patients (75%) were alive, 6 (50%) with a functioning graft. Four patients
(33.3%) had rejection with transplantectomy.
We feel that the introduction of this registry will benefit the quality of care for patients
with CIF. In addition to more detailed documentation of comorbidity and events, the registry
will facilitate adequate assessment and evaluation of chronic treatment and allows a timely
multidisciplinary decision to list patients for intestinal transplantation.
Chapter 3 focuses on the quality of life (QoL) as experienced by patients with CIF that are
treated with HPN.
This study introduces the distress thermometer (DT) and problem list (PL) that was
developed as a screening instrument for QoL assessment in oncological care. The instrument
was adapted to the specific situation of HPN or post-ITx patients to evaluate distress
during HPN/post ITx. Our new specific measurement tool was validated with the use of the
commonly used hospital anxiety and depression scale (HADS), referral wish for additional
care was examined, opinions on the DT/PL were assessed and the risk factors for distress
and referral wish were studied. Dutch and Scottish HPN patients were asked to complete
questions on socio-demographic and HPN-related general characteristics, the DT/PL, referral
wish, the HADS and their opinions on the DT. The HPN version of the DT/PL seemed valid, and
sufficiently reliable. Actually, 45% of patients were diagnosed as clinically distressed and 53%
expressed a referral wish. Emotional and physical problems were most strongly associated
with distress. Not being able to work related to elevated distress and female gender and comorbidity related to referral wish. Opinions on the DT were generally positive. We concluded
that the DT/PL would be a good instrument to regularly gain insight into distress and referral
wish in HPN patients as distress seemed to be frequent and a referral wish was common. Use
of the DT/PL can facilitate the psychosocial support to patients who most need and want it
and can improve quality of care and QoL.
As a future perspective, the DT/PL could be easily implemented in the online DRIFT
registry. A secured login option for patients can be created to keep their health professionals
periodically informed on their psychosocial status and to express a potential need for
individually adapted support in addition to the standard HPN care.
152 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
Chapter 4 considers the socio-economic/cost perspective of CIF. CIF treatment in adults was
simulated in a ‘discrete event model’. Discrete event modeling requires the clinical course of
patients to be represented as a series of consecutive steps or states.
Figure 2 Graphic illustration of the study model.
8
Model parameters were derived from DRIFT, the worldwide Intestinal Transplant Registry
(ITR), hospital records, the literature, and expert opinions from the HPN centers and the
intestinal transplant center. The model was filled with pretended patients at a rate of 40 per
month for a period of 10 years. Maximum simulated follow-up was 40 years. ITx was offered
in 10% of patients with a life expectation of < 12 months. Costs were calculated according to
Dutch guidelines. The cost-effectiveness of ITx was evaluated by comparing model simulations
with and without ITx as an alternative treatment option to HPN for CIF. The incremental costeffectiveness ratio (ICER: costs per life-year gained) was calculated. The model showed an
average survival of 14.6 years without ITx and 14.9 years with ITx. HPN cost comprised a sum
of €9.006 for treatment introduction, followed by an annual sum of €63.000. The cost of
ITx are €73.000 during the first year, followed by annual costs of €13.000. The costs per life
year gained with ITx -compared to HPN- were €20.654, which is relatively low for solid organ
transplantation. The absolute survival gain of 3 months in this model may seem marginal.
However, the survival benefit of the 10% transplanted patients is distributed over a large
simulated population of which 90% was not transplanted. Therefore, the appreciated survival
benefit of an individual patient undergoing ITx will, -in fact-, be longer than 3 months.
Most recent survival data from experienced ITx centers (as presented during the ITR
report 2013) have been compared favorably with the survival reported in retrospective series
of HPN patients. Furthermore, we increasingly become able to select those patients with
a poor prognosis remaining on HPN at an early stage. In this light, there is an upcoming
discussion on the suggestion that the future role of ITx should be expanded from a life-saving
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
153
procedure for patients developing HPN failure to a pre-emptive/rehabilitative procedure that
can be offered to all patients with CIF. In this discussion, the ICER results from our study are
relevant. As the next step, the cost-utility (taking into account the costs for quality adjusted
life years) of HPN and ITx has to be studied, in order to define the indications for a preemptive or a rehabilitative ITx more precisely. Clearly, we foresee a possible broadening of
indications and the inclusion of patient values (their opinion on QoL) and wishes in setting
the indication for ITx. Quite impressively, the British ITx patient Michael Seres has initiated
a blog platform for CIF patients to express their opinion and propagate their contribution to
indication setting with joined forces (http://www.michaelseres.com/).
Chapter 5 evaluates the unvalidated ‘Organ Procurement Transplant Network (OPTN)
selection criteria’ for intestinal graft donation. We aimed to describe histopathological and
molecular features of allograft injury in relation to donor conditions defined by the OPTN
criteria. Graft histology (Park Score), Claudin-3 staining, systemic inflammatory markers
(CRP/lipopolysaccharide binding protein (LBP)) and expression of heat shock protein (HSP70), heme-oxygenase-1 (HO-1) and IL-6 were evaluated in multi-organ deceased donors
(donation after brain death (DBD) and donation after cardiac death (DCD)). For this purpose,
97 samples (52 jejunum/45 ileum) were recovered from 59 donors (46 DBD/13 DCD). The
OPTN criterion cold ischemia time correlated with histological injury (Park score) to which the
jejunum appeared more susceptible than the ileum. Claudin-3 staining was higher, and HSP70 expression lower in donors meeting the OPTN criteria compared to donors not meeting the
criteria and in DBD versus DCD. In DBD donors, IL-6 expression was higher compared to DCD
donors and inversely related to CRP. This multi-parameter analysis suggests that the OPTN
criteria can be discriminative concerning intestinal graft quality. Our data further propose
that DCD intestinal allografts are qualitatively inferior and that the jejunum is more sensitive
to ischemia than the ileum. These results might form a modest basis of the understanding in
the transplant- (and donor) related damage mechanisms affecting the intestinal graft prior
to transplantation and the viability of the graft. As a fact, the major limitation of this study
is the lack of outcome after reperfusion and transplantation. Therefore, a clinical study is
now required including outcome parameters after transplantation to confirm our results.
Ultimately, a practical scoring system to predict the quality of the intestinal graft prior to
transplantation such as the Remuzzi score for kidney transplantation is needed.
Chapter 6 reviews intestinal preservation solutions and techniques to determine potential
targets for improvement. The available studies could not reveal one single ‘most effective
method for intestinal preservation’. Based on what has been written in previous times, we
would advocate that an optimal strategy could result from a synergistic effect of different
vital elements. A key factor is the composition of the solution using a low-viscosity solution
to facilitate washout of blood, including amino acids to improve viability, impermeants and
colloids to prevent edema, and buffer for pH-homeostasis. Optimizing conditions include a
154 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
vascular flush before CS and luminal preservation. The most effective composition of the
luminal solution and a practical, clinically applicable optimal technique are yet to reach
finality. Short-duration oxygenated arterial and/or luminal perfusion can also be considered.
Thus, a tailor-made approach to luminal preservation solution and technique deserves further
study.
Chapter 7 focuses on the extreme sensitivity to ischemia and re-oxygenation injury of
the intestine. Current vascular perfusion and cold storage with University of Wisconsin
(UW) solution neglect the intestinal lumen and the ongoing mucosal metabolism during
hypothermia. This study was designed to test the effects of luminal preservation with an
alternative tailored preservation solution in addition to the common vascular flush with
UW solution on graft viability after preservation and ex-vivo re-oxygenation. Therefore,
rat intestine was preserved on ice for 6 hours in UW solution or Williams Medium E with
additional buffering, impermeants, and a colloid (called WMEplus) after being stapled (closed
preservation) or after flushing and filling the lumen (luminal preservation) with the respective
preservation solution. Tissue slices were prepared from fresh and preserved intestines and
were incubated with oxygen for 6 hour at 37°C to assess the viability after (modeled) reoxygenation. The study reflected that -directly after preservation- histologic damage was
mild and unaffected by the preservation strategy. Contrary to luminal preservation, closed
preservation resulted in significantly decreased ATP levels compared with control. Reoxygenation aggravated damage and revealed differences between the strategies. Luminal
preservation better maintained the ATP levels and histomorphologic integrity (vs. closed
preservation) for both solutions. Histomorphologic integrity was superior after preservation
with WMEplus (vs. UW solution). Expression of stress responsive genes was least upregulated
in the slices from tissue preserved luminally with WMEplus. In conclusion, preservation and
re-oxygenation injury can be attenuated by luminal preservation with WME plus. Results
from this experimental study confirm/complement our suggestion based on the results
from our review described in Chapter 6. This proposed innovative tailor-made approach to
luminal preservation solution deserves further investigation in a transplant model first and
subsequently in the human setting to develop the ultimate technique meeting the delicate
physiologic demands of the intestinal graft during preservation.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
155
8
IN SUMMARY
CIF is a complex condition that deserves intense multidisciplinary care. HPN is the mainstay of
treatment with good survival rates despite frequent serious complications, psychosocial and
physical distress and substantial costs. ITx can be a cost-effective alternative treatment for
a selected number of CIF patients that fail on HPN therapy. International online registration
and monitoring of CIF patients aids multidisciplinary care and facilitates adequate and timely
referral for screening and ITx. Such a registry is difficult to establish but absolutely crucial
to improve best practice and results of ITx. Valid criteria to select good donor grafts, better
insight into transplant-related intestinal graft damage and the development of a tailor-made
intestinal preservation technique will improve outcomes after ITx.
To date, HPN and ITx are both challenging medical therapies applied to allow patients
with CIF - a life-threatening condition - to survive with a reasonable quality of life. The
decision-making for the best medical regimen when intestinal failure occurs is definitely a
team-effort. The treatment of CIF has to be tailored for each individual patient allowing all
medical knowledge to be present and providing dedicated care with great patience.
156 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
8
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
157
BEKNOPTE NEDERLANDSE SAMENVATTING
DARMFALEN EN DUNNEDARMTRANSPLANTATIE: ‘IS GOEDKOOP, DUURKOOP?’
De mens heeft de dunnedarm nodig voor voedsel en vocht opname. In Nederland leven er
173 patiënten waarbij er te weinig gezonde dunnedarm aanwezig is om ook na aanpassing
van de voeding gezond te blijven, dit noemen we chronisch darmfalen. Chronisch darmfalen
kan veroorzaakt worden door een aangeboren dunnedarm afwijking of door een te korte
dunnedarm omdat teveel zieke dunnedarm verwijderd moest worden. De enige manier om
te overleven met darmfalen is het toedienen van voeding via een infuusslang in een grote
lichaamsader; dit wordt parenterale voeding genoemd (TPV, in het Engels total parenteral
nutrition (TPN)). Voor sommige patiënten is dunnedarmtransplantatie een optie, hierbij
ontvangen ze een nieuwe dunnedarm van een gezonde donor. Als TPV behandeling thuis
plaatsvindt noemen we dit thuis-TPV (in het Engels home parenteral nutrition (HPN)).
Behandeling met TPV kent een aantal aanzienlijke problemen. Ten eerste kan deze behandeling
gepaard gaan met levensbedreigende complicaties zoals verstopping van de infuusslang,
bloedvergiftiging en/of ernstige leverbeschadiging. Bovendien heeft het een grote invloed op
het praktische en sociale leven van zowel patiënt als diens familie en omgeving. De helft van
de patiënten met chronisch darmfalen ervaart een beperkte kwaliteit van leven, met name
door psychosociale en lichamelijke stress. Tenslotte is TPV - en alles wat hierbij komt kijken
- kostbaar. In Nederland worden patiënten met chronisch darmfalen en TPV behandeld, en
begeleid door specialisten in het Academisch Medisch Centrum in Amsterdam (AMC) of het
Universitair Medisch Centrum Nijmegen (UMCN). Ondanks de genoemde beperkingen en
dankzij de goede specialistische TPV zorg in Nederland zijn de resultaten van TPV behandeling
goed, gemiddeld is de 5-jaars overleving ongeveer 80%.
Sinds de jaren negentig is dunnedarmtransplantatie een behandel mogelijkheid voor
patiënten met chronisch darmfalen. In Nederland wordt dit alleen uitgevoerd in het Universitair
Medisch Centrum Groningen (UMCG). Er is grote vooruitgang geboekt op dit gebied maar
de overleving na dunnedarmtransplantatie is nog niet zo goed als de overleving met TPV
behandeling. Daarom wordt dunnedarmtransplantatie alleen verricht als laatste redmiddel
bij een beperkt aantal patiënten als de behandeling met TPV te grote problemen geeft. In
dit geval is dunnedarmtransplantatie een kosteneffectief behandelalternatief. Het is van
groot belang dat er een goede multidisciplinaire samenwerking bestaat tussen de TPV Centra
(AMC, UMCN) en het Transplantatie Centrum (UMCG). Een nauwkeurig actueel beschikbaar
overzicht van de individuele situatie van elke patiënt is cruciaal. Het is namelijk erg lastig om
het beste tijdstip te bepalen voor een eventuele transplantatie. In Nederland is een online
patiënt registratie systeem (Dutch Registry of Intestinal Failure and Transplantation: DRIFT)
ontwikkeld om tijdige identificatie en screening van potentiële transplantatie kandidaten te
bevorderen. DRIFT verbeterd de kwaliteit van zorg voor deze complexe patiënten groep en
kan daarnaast bijdragen aan protocollaire zorg en onderzoek naar de beste behandeling van
chronisch darmfalen.
De overleving na dunnedarmtransplantatie blijft achter bij andere orgaan transplantaties
omdat de dunnedarm immunologisch erg actief en ook kwetsbaar is. De dunnedarm kan maar
heel kort zonder zuurstof en ondervindt veel schade als gevolg van het transplantatieproces
160 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
(donor-omstandigheden en de periode tussen orgaan-uitname in de donor en implantatie
in de ontvanger, de preservatiefase). Het is belangrijk dat er inzicht is in de factoren die
schade veroorzaken om goed te kunnen bepalen welke donor een geschikte darmdonor kan
zijn. Daarnaast wordt er idealiter een speciale techniek en vloeistof ontwikkeld die precies
tegemoetkomt aan de behoeften van een dunnedarm tijdens de genoemde preservatiefase.
Optimale zorg voor patiënten met darmfalen, TPV en darmtransplantatie is complex en
levert uitdaging voor verbetering en onderzoek. In dit proefschrift wordt in de verschillende
hoofdstukken (zie figuur 1) aangespoord tot nationale samenwerking en gezamenlijke
registratie van chronisch darmfalen, wordt aangetoond dat de kwaliteit van leven deze patiënt­
en erg matig is, dat dunnedarmtransplantatie een kosteneffectieve behandeling is en wordt
onderzocht welke factoren de kwaliteit van een donor dunnedarm bepalen en tenslotte, hoe
deze kwaliteit verbeterd kan worden.
Figuur 1
Darmfalen
2
Legenda
3
Parenterale voeding
4
Overlijden
TPV
falen
5
DDTx
donor en
transplantaat
DDTx
falen
6 7
DDTx
transplantaat
preservatie
DDTx
2
Hoofdstuk 2
Nederlandse registratie
van darmfalen en
darmtransplantatie
(DRIFT)
3
Hoofdstuk 3
Kwaliteit van leven
met TPV
4
Hoofdstuk 4
Kosten van TPV en DDTx
5
Hoofdstuk 5
Darmdonorselectie en
kwaliteit van het
transplantaat
6 7 Hoofdstuk 6/7 Transplantaat
preservatie
Afkortingen
TPV - Parenterale Voeding
DDTx - DunneDarmtransplantatie
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
161
NEDERLANDSE
WETENSCHAPPELIJKE SAMENVATTING
DARMFALEN EN DUNNEDARMTRANSPLANTATIE: ‘IS GOEDKOOP, DUURKOOP?’
INTRODUCTIE EN OVERZICHT
De dunnedarm is voor de mens een levensbelangrijk orgaan, net als het hart, de longen,
de lever en de nieren. Uitval van de functie betekent dat er – direct of binnen een relatief
korte periode - een levensbedreigende situatie ontstaat. Tegenwoordig zijn er verschillende
biotechnische mogelijkheden ter (tijdelijke) vervanging van orgaanfuncties en kan zelfs
een orgaan volledig worden vervangen door middel van orgaantransplantatie als er sprake
is van terminaal orgaanfalen. Meestal wordt de functie van het orgaan tijdelijk vervangen
bij (dreigend) orgaanfalen in afwachting op orgaantransplantatie. Een bekend en succesvol
voorbeeld hiervan is hemodialyse (nierspoelen) bij nierfalen. Voor sommige organen zijn er
zelfs implantaten en andere apparaten beschikbaar ter ondersteuning, zoals pacemakers.
Orgaantransplantatie is meestal een permanente en duurzame therapeutische oplossing
waarvan de uitkomsten duidelijk beter zijn dan die van een biotechnische functie-vervanging.
Voor patiënten die lijden aan darmfalen zijn de therapeutische overwegingen niet eenvoudig.
De patiëntenpopulatie met darmfalen is klein. De meeste patiënten hebben een complexe
medische voorgeschiedenis en worden behandeld door artsen in verschillende ziekenhuizen.
Darmfalen houdt in dat iemand niet in staat is om voldoende voedingstoffen en/of vocht
binnen te krijgen via de darm met (normale) voedingsmiddelen1,2. Er is of te weinig darm­
oppervlak of een niet goed werkende darm. Darmfalen kan worden veroorzaakt door een
verscheidenheid aan onderliggende ziekten. Tabel 1 beschrijft de meest voorkomende aan­
doeningen bij kinderen en volwassenen.
Kinderen
Volwassenen
-Aangeboren open buikje (gastroschisis) (22%)
-Darmperistaltiek (darmbeweging) ziekte (18%)
-Afgeklemde gedraaide dunnedarm (volvulus) (16%)
-Afsterving van dunnedarm in vroeg geborenen (NEC) (14%)
-Aangeboren dunnedarmafsluiting (atresie) (4%)
-Darmslijmvliesaandoening (enteropathie) (8%)
-Andere oorzaak (ernstige aangeboren navelbreuk, tumor) (18%)
-Afsterving van dunnedarm na darminfarct/trombose (24%)
-Ziekte van Crohn (darmontsteking) (11%)
-Afgeklemde gedraaide dunnedarm (volvulus)(8%)
-Darmperistaltiek (darmbeweging) ziekte (11%)
-Verwijdering van dunnedarm door een ongeluk (7%)
-Verwijdering van dunnedarm door tumor (13%)
-Andere oorzaak (26%)
Tabel 1 Onderliggende ziekten voor darmfalen bij kinderen en volwassenen, tussen haakjes staan de
percentages met dit ziektebeeld geïndiceerd voor dunnedarmtransplantatie volgens de International
Intestinal Transplant Registry Report 2013.
Deze gevarieerde verzameling van oorzaken kan gemakkelijker worden ingedeeld in twee
verschillende soorten oorzaken. De meest voorkomende vorm is het ontbreken van voldoende
effectief dunne darm oppervlak voor de opname van voedingsstoffen wat resulteert in het
korte darmsyndroom. De andere vorm van darmfalen noemen we functioneel falen, de
dunnedarm is wel aanwezig maar werkt in dit geval niet goed, zoals b.v. bij een darmbeweging
(motiliteit) stoornis of een darmslijmvliesziekte. Het klinische beeld van darmfalen wordt
gekenmerkt door gewichtsverlies, uitdroging met hardnekkige diarree (of zeer veel productie
via een stoma), vitaminen en mineralen tekorten, en ondervoeding.
164 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
Darmfalen kan ook nog op een andere manier worden ingedeeld in drie types op basis van de
klinische duur en de ernst. Deze indeling bepaalt de medische behandeling en de prognose. Type
1 darmfalen gaat vanzelf over, het treedt relatief vaak op na een dunnedarm operatie; ondersteuning met vloeistof en/of voedingsstoffen (nutriënten) is voor kortere tijd nodig. Het zeldzamere
type 2 darmfalen is geassocieerd met septische, metabole (stofwisseling) en complexe nutritionele complicaties, en komt meestal voor na chirurgische resectie bij patiënten met de ziekte
van Crohn of ziekte van de darmbloedvaten. In deze toestand is voeding via de bloedbaan (intraveneuze voeding, ofwel parenterale voeding (TPV) nodig. Type 3 darmfalen is onomkeerbaar en
wordt gekenmerkt door de noodzaak van langdurige, chronische parenterale voeding (TPV) 3 4.
Dit proefschrift is gericht op het derde, meest ernstige, chronische type darmfalen. Gelukkig is dit een uitzonderlijke situatie die relatief weinig voorkomt. Desalniettemin lijkt het aantal
patiënten met chronisch darmfalen toe te nemen. In 1997 was de Nederlandse prevalentie 3.7
per miljoen, terwijl er in Januari 2013 een punt-prevalentie werd beschreven van 10.3 per miljoen
(E. Neelis & A.M. Roskott et al., Eerste rapportage van een Nederlandse multidisciplinaire registratie van darmfalen en darmtransplantatie (DRIFT)). Het is onduidelijk of deze populatie-groei
wordt veroorzaakt door betere registratie, demografische veranderingen met een ouder wordende bevolking, of door voortschrijdende medische mogelijkheden. Een daadwerkelijk goed
overzicht van de totale populatie evenals de actuele medische situatie van de individuele patiënt
met chronisch darmfalen ontbreekt.
De dunnedarm speelt een grote rol binnen het maagdarmstelsel omdat deze een aantal
belangrijke functies vervult zoals opname van voedingsstoffen, stofwisseling en uitscheiding van
bepaalde stoffen. Een effectieve behandeling om de functie van de dunne darm te vervangen
met een bepaald apparaat of een machine bestaat niet. De enige manier ter vervanging is het
toedienen van voedingsstoffen direct in de bloedbaan via de ader, dit noemen we parenterale
voeding (TPV). De hoeksteen van de behandeling van chronisch darmfalen is permanente TPV
voeding. Dit kan ook worden toegediend in de thuissituatie, we noemen dit thuis-TPV. In Nederland wordt deze behandeling met thuis-TPV aangeboden- en gecoördineerd door een aantal gespecialiseerde academische ziekenhuizen: voor kinderen en volwassenen in Amsterdam (Amsterdam Medisch Centrum (AMC)) en Nijmegen (Universitair Medisch Centrum Nijmegen (UMCG))
en, alleen voor kinderen, in Rotterdam (Erasmus Medisch Centrum, Sophia Kinderziekenhuis).
TPV is mogelijk sinds 1967 en is sindsdien een levensreddende behandeling voor patiënten met chronisch darmfalen. Desondanks kan TPV de fysiologische complexe functie van
de dunne darm niet vervangen en heeft het aanzienlijke nadelen. TPV omvat de toediening
van een vloeistof met de benodigde voedingsstoffen in de bloedbaan via de ader. Hiervoor
is het noodzakelijk om permanent een toedieningsweg te hebben in de vorm van een infuus
in de ader of een onderhuids reservoir wat gemakkelijk kan worden aangeprikt. De basiscomponenten van TPV zijn eiwitten- of vrije aminozuren (eiwitbouwstenen) mengsels, glucose (suikerbouwstenen) en elektrolyten - waaraan vetten kunnen worden toegevoegd. TPV
is een relatief veilige behandeling met een goede lange-termijn overleving. In een groep met
volwassenen en kinderen varieert de gemiddelde vijf-jaars overleving tussen de 75%-85% 5-15.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
165
Hoewel deze overlevingskansen redelijk acceptabel lijken, gaat TPV gepaard met potentieel levensbedreigende bijwerkingen - mede als gevolg van de onnatuurlijke aard van deze manier van
voeding. De belangrijkste bijwerkingen zijn problemen met de toedieningsweg tot de bloedbaan
zoals dicht gaan zitten of infectie met bloedvergiftiging tot gevolg , leverfunctiestoornissen
(galophoping, vervetting, verlittekening en leverbeschadiging), botontkalking en ontregeling
van de stofwisseling. Leverbeschadiging is de complicatie met het grootste risico op overlijden,
vooral bij kinderen 4,6. TPV heeft een grote impact op het psychosociaal en dagelijkse leven
van een patiënt. Dit kan ten koste gaan van de kwaliteit van leven van de patiënt en personen in diens omgeving 16,17. Praktische dingen zoals de toedieningspomp, de toedieningsweg,
verschillende toedieningstijden (ook ‘s nachts) en ziekenhuisopnames kunnen zeer beperkend
zijn. Daarnaast kan het psychosociale aspect van het niet kunnen eten en/of het hebben van
diarree van grote invloed zijn op het welbevinden. Inzicht in dergelijke problemen en kwaliteit
van leven is belangrijk voor zorgverleners, zodat hier (op tijd) aandacht aan besteed kan worden
met eventueel verwijzing bij ernstige problemen. Verschillende studies hebben geprobeerd om
inzicht te krijgen in de mate van stress en de kwaliteit van leven van patiënten met chronisch
darmfalen. Deze studies zijn zeer verschillend uitgevoerd en de resultaten zijn daarom moeilijk
te vergelijken. Een goede manier om de kwaliteit van leven van patiënten met chronisch darmfalen en patiënten na dunnedarmtransplantatie te onderzoeken bestaat nog niet.
Bovendien is het belangrijk te realiseren dat TPV geen permanente oplossing voor
chronisch darmfalen is. Desondanks wordt dunnedarmtransplantatie (DDTx) alleen nog
aangeboden aan een beperkt aantal patiënten met chronisch darmfalen. Dit komt doordat
de overleving na DDTx op dit moment minder goed is dan de overleving met permanente
TPV. DDTx moet worden beschouwd als een ‘laatste reddingsmiddel’ voor een klein aantal
patiënten waarbij de behandeling met TPV faalt en niet kan worden voortgezet, bv. door
ernstige bijwerkingen. Tabel 2 beschrijft de indicaties en contra-indicaties voor DDTx 18,19.
Indicaties
Contra-indicaties
Irreversibel/chronisch darmfalen: >75% van de voeding in de vorm van
TPV voor meer dan zes weken
En
Falen van TPV als gevolg van:
- Verlies/sneuvelen van de toedieningsweg tot de bloedbaan (trombose
(dichtzitten) van twee of meer grote centrale aders)
- Twee of meer episodes per jaar van bloedvergiftiging door infectie van
het infuus waarvoor ziekenhuisopname noodzakelijk is.
- Een episode van schimmelinfectie van het infuus, shock door
bloedvergiftiging of acute bedreiging van het ademhalingsstelsel.
- (Dreiging van) leverfalen als bijwerking van TPV
- Frequent/herhaaldelijke uitdroging ondanks toediening van vocht in de
bloedbaan in aanvulling op TPV.
- Ernstig beperkte/verminderde kwaliteit van leven
-Niet te behandelen kanker met een slechte prognose
-Ernstige neurologische ziekte
-Verwachting van slechte therapietrouw
-Oncontroleerbare lokale of systemische infectie
-AIDS
-Irreversibel multi-orgaan falen
-Slechte voedingstoestand
-Alcohol of drugs misbruik
-Ernstige atherosclerose (vaatverkalking)
-Ernstige co-morbiditeit zoals ernstige ziekte van hart of longen
Tabel 2 Indicaties and contra-indicaties voor DDTx 20
166 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
Om te bepalen of een patiënt met chronisch darmfalen evt. in aanmerking komt voor DDTx is
een compleet medisch overzicht inclusief volledige informatie over de ernst van bijwerkingen
(complicaties) van TPV onmisbaar. Helaas is een dergelijk overzicht vaak niet beschikbaar.
Bovendien ontbreekt er een duidelijke overeenstemming over welke patiënten beter af
zouden zijn met TPV behandeling en voor welke patiënten het nou juist beter zou zijn om
DDTx te ondergaan. Deze onduidelijkheid wat betreft de indicatie voor DDTx kan leiden tot
het te laat doorverwijzen voor DDTx. Hiervan is inmiddels bekend dat dit gerelateerd is aan
de hoge kans op overlijden van patiënten die op de wachtlijst staan voor DDTx en een relatief
slecht resultaat na DDTx. Daarom is een integrale, multidisciplinaire benadering van de
behandeling van patiënten met chronisch darmfalen van groot belang. Deze multidisciplinaire
benadering zal tijdige verwijzing, standaardisatie van behandelplannen en (inter)nationale
patiëntregistratie systemen bevorderen. Dit alles ter optimalisatie van zorg en overleving van
patiënten met chronisch darmfalen 6,21-23, OPTN/SRTR jaarverslag 2010.
DDTx is een relatief nieuwe vorm van orgaantransplantatie en wordt verricht in veel
kleinere aantallen vergeleken met transplantatie van andere organen zoals de nier, de
lever en het hart. In Nederland wordt DDTx alleen verricht in het Universitair Medisch
Centrum Groningen (UMCG). Wereldwijd zijn er maar 82 ziekenhuizen die bevoegd zijn dit
te doen. Tot op heden zijn er over de wereld ongeveer 2887 darmtransplantaties verricht
(International Transplant Registry (ITR) 2013 jaarverslag). Ondanks dat de resultaten zijn
verbeterd sinds de introductie van DDTx in de jaren ’90 door verbetering op het gebied
van anti-afstotingmedicijnen (immunosuppressiva), verbeterde chirurgische technieken en
postoperatieve zorg, is de overleving na DDTx (nog) steeds minder goed dan na andere vormen
van orgaantransplantatie. Het wereldwijde internationale DDTx verslag van 2013 laat zien dat
de 5-jaars overleving naar de 70% toegaat (ITR 2013 jaarverslag). De kwetsbaarheid van het
dunnedarmtranplantaat (de graft) voor donorfactoren, aspecten die gerelateerd zijn aan de
transplantatie-procedure zelf en het sterke immunogene (op afweer gerichte) karakter van de
darm dragen bij aan dit beperkte succes. Hersendood van de donor, bloedtekort en vervolgens
weer her-doorbloeding (ischemie-reperfusie) en tekortschietende reparatie mechanismen
veroorzaken een duidelijke ontstekingsreactie en weefselbeschadiging. Dit alles verhoogt het
risico op infectie en afstoting na DDTx.
Het is bekend dat de kwaliteit (levensvatbaarheid) van een orgaantransplantaat (graft) een
sleutelrol speelt bij een goede afloop na DDTx. Desondanks ontbreekt er eenduidigheid over
welke criteria te hanteren voor selectie van grafts die wat betreft kwaliteit acceptabel zijn voor
DDTx. De exacte waarde van verschillende criteria is nog niet goed aangetoond en we weten
dus nog niet zo goed welke darmgrafts we wel en niet kunnen gebruiken voor DDTx. Daarom
maken artsen zelf nu maar een zo goed mogelijke inschatting op basis van verschillende factoren
waarvan ze denken dat deze de kwaliteit van een graft beïnvloeden, en hanteert men op verschillende plekken verschillende ‘eigen bepaalde criteria’ waarvan ze denken dat ze hiermee goede
grafts selecteren. De donatie criteria die gedefinieerd zijn door het Amerikaanse Orgaan Uitname Transplantatie Netwerk (OPTN) zijn een voorbeeld van zo’n empirische ‘set van criteria’.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
167
Het darmslijmvlies is kwetsbaar en gevoelig voor schade als gevolg van een verminderde
doorbloeding (ischemie). 24,25. Helaas is vermindering van de doorbloeding onvermijdbaar
tijdens het ‘bewaar-stadium’ (preservatie proces), de overbrugging tussen orgaan-uitname
bij de donor en orgaan-implantatie bij de ontvanger. Het is gebruikelijk om een donororgaan
in dit stadium gekoeld te bewaren, de zogenaamde koude preservatie. Het orgaan wordt
in dit stadium echter niet doorbloed en lijdt onder koude ischemie. Ondanks de specifieke
gevoeligheid van de darm voor dergelijke ischemie is er geen speciale bewaarmethode
(preservatie techniek) ontwikkeld voor de darm apart. De darm wordt bewaard met de
zogenaamde University of Wisconsin (UW) bewaar vloeistof (preservatie vloeistof). Deze
vloeistof werd van origine ontwikkeld voor het preserveren van pancreas, lever en nier.
Dit gebrek aan een adequate methode voor het bewaren van de dunnedarmgraft beperkt
de preservatie tijd van de darmgraft tot 6-10 uur en resulteert desondanks toch nog in
een wisselende mate van weefselschade 26. Dit gegeven limiteert het klinische succes van
DDTx. Een beter inzicht in de behoeften van de dunnedarm graft tijdens preservatie en de
ontwikkeling van een specifieke preservatie vloeistof welke precies is aangepast aan deze
behoeften zal de resultaten van DDTx ten goede komen.
DDTx is een typisch voorbeeld van innovatie als gevolg van verbeterd medischtechnisch inzicht. Het is van belang dat artsen dergelijke vernieuwingen kritisch evalueren.
De resultaten van nieuwe behandelingen door medische vooruitgang moeten idealiter
onderzocht en beoordeeld worden op levenswinst, verbetering van kwaliteit van leven en een
combinatie van deze twee aspecten, zogenaamde QUALY’s (quality adjusted life years). Bij
QUALY’s wordt er rekening gehouden met de kwaliteit van de gewonnen levensjaren door een
bepaalde behandeling. Socio-economische overwegingen spelen tegenwoordig ook een rol bij
medische kwesties. Als we kijken naar de Nederlandse situatie, met een kleine populatie van
patiënten met chronisch darmfalen en een nog kleinere groep die in aanmerking komt voor
DDTx, moeten we ons afvragen welke inspanningen en uitgaven er gemaakt worden om dit
uiterst specialistische darmfalen-DDTx programma in stand te houden. Dit is een bijzonder
lastig vraagstuk; want wie bepaalt de monetaire waarde (het financieel equivalent) van een
levensjaar en hoe kan kwaliteit van leven objectief beoordeeld worden? Echter, vandaag de
dag zijn bewustwording en openheid van medische kosten onvermijdelijk geworden voor
noodzakelijke onderhandelingen en afspraken tussen ziekenhuizen en zorgverzekeraars. De
economische last (medische kosten) van chronisch darmfalen is groot. Jaarlijkse geschatte
uitgaven aan TPV variëren maar worden wereldwijd geschat tussen $75.000 and $300.000
per patiënt 27,28. De exacte kosten van TPV en DDTx zijn niet bekend en de vergoeding voor
DDTx is vaak (onder andere hierdoor) niet toereikend.
168 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
Figuur 1 geeft het verloop met de tijd weer van de situatie van de patiënt met chronisch darmfalen. De gele
nummers staan voor de verschillende aspecten van chronisch darmfalen die werden geïntroduceerd. Deze
aspecten zijn focus van de studies die het proefschrift vormen.
Darmfalen
2
Legenda
3
Parenterale voeding
4
Overlijden
TPV
falen
5
DDTx
donor en
transplantaat
DDTx
falen
6 7
DDTx
transplantaat
preservatie
DDTx
2
Hoofdstuk 2
Nederlandse registratie
van darmfalen en
darmtransplantatie
(DRIFT)
3
Hoofdstuk 3
Kwaliteit van leven
met TPV
4
Hoofdstuk 4
Kosten van TPV en DDTx
5
Hoofdstuk 5
Darmdonorselectie en
kwaliteit van het
transplantaat
6 7 Hoofdstuk 6/7 Transplantaat
preservatie
Afkortingen
TPV - Parenterale Voeding
DDTx - DunneDarmtransplantatie
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
169
SAMENVATTING INCLUSIEF TOEKOMSTPERSPECTIEVEN
In Nederland bestaat er een Nationaal programma voor de behandeling van chronisch
darmfalen en DDTx vanuit de stichting darmfalen. Deze stichting is een samenwerking tussen
de twee grootste, primaire thuis-TPV centra in Nederland (UMC Nijmegen en Amsterdam
MC) en het Nederlandse DDTx centrum (UMC Groningen). De stichting ontwikkelde en
introduceerde een nieuw, online registratie systeem met de naam DRIFT (the Dutch Registry
of Intestinal Failure and Transplantation, ofwel de Nederlandse Registratie van Darmfalen en
Darmtransplantatie). In Hoofdstuk 2 staat DRIFT centraal. Het doel van DRIFT was meerledig:
a)Het monitoren van afzonderlijke patiënten met chronisch darmfalen op landelijk niveau
tijdens de thuis-TPV behandeling
b)Het bevorderen van adequate identificatie van darmtransplantatie-kandidaten en het
stimuleren van tijdige screening en DDTx.
c)Het ondersteunen van geprotocolleerde zorg (vaststaande behandelplannen in de
verschillende ziekenhuizen) en wetenschappelijk onderzoek.
Na de ontwikkeling van DRIFT tussen 2008-2012, werd de patiënten informatie (data)
ingevoerd in januari 2013 en konden we de Nederlandse populatie met chronisch darmfalen
en thuis-TPV bestuderen en de kandidaten voor DDTx identificeren. In totaal werden er in
Nederland 173 patiënten behandeld met thuis-TPV voor chronisch darmfalen, dit impliceert
een prevalentie van 11.39/miljoen voor volwassenen en 6.72/miljoen voor kinderen. De
onderliggende ziekten van deze patiënten waren het korte darmsyndroom (n=85, 49%),
darmbeweging(=motiliteit)-stoornis (n=73, 42%) of een darmslijmvlies probleem (n=15, 9%).
De meest gevreesde complicaties van TPV (dicht gaan zitten van de toedieningsweg -het
infuus-, infectie van het infuus, leverfunctieproblemen) kwamen minder vaak voor dan we
hadden verwacht. In 2012, had 12.1% van de patiënten één of meer keer een dicht infuus en
26.6% minimaal één keer een bloedvergiftiging door infectie van het infuus. Een verminderde
botdichtheid kwam bij 46.8% van de patiënten voor, dit was een verassend hoog percentage.
Het aantal patiënten dat aan alle criteria voor DDTx voldeed en dus in aanmerking kwam voor
DDTx bleek een stuk hoger (48 patiënten, 27.7%) dan het aantal patiënten dat daadwerkelijk
werd getransplanteerd (12 patiënten sinds 2001). Dit suggereert dat de indicaties voor DDTx
aanpassing verdienen. Op 1 januari 2013 waren 9 van de 12 getransplanteerde patiënten
(75%) in leven, 6 (50%) met een werkende graft. Bij vier patiënten (33.3%) was afstoting
opgetreden met verwijdering van de graft tot gevolg.
We denken dat de introductie van DRIFT zal bijdragen aan de kwaliteit van zorg voor
patiënten met chronisch darmfalen. Naast een verbetering door gedetailleerde documentatie
van ziektegeschiedenis en complicaties van individuele patiënten zal DRIFT de evaluatie van de
behandeling verbeteren en tijdige multidisciplinaire besluitvoering rondom DDTx bevorderen.
170 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
Hoofdstuk 3 gaat in op de kwaliteit van leven en het ervaren van stress door patiënten met
chronisch darmfalen en thuis-TPV behandeling. We onderzochten de waarde van een nieuw
meetinstrument: de thuis-TPV versie van de ‘stress thermometer’(DT) en probleem lijst (PL).
De DT en PL werden oorspronkelijk ontwikkeld om stress te bestuderen bij patiënten met
kanker. De originele versie van dit instrument werd door ons aangepast en geschikt gemaakt
voor het ondervragen en bestuderen van patiënten met chronisch darmfalen. Behalve het
onderzoeken van de geschiktheid van de DT en PL werden de wens voor doorverwijzing voor
extra ondersteuning, de mening van patiënten over dit meetinstrument en risicofactoren
voor stress bestudeerd.
Uit onze studie bleek dat de thuis-TPV versie van de DT en de PL valide (van goede waarde)
en voldoende betrouwbaar is. Vijfenveertig procent van de patiënten met thuis-TPV bleek een
klinisch relevante mate van stress te ervaren en 53% had de wens om hiervoor doorverwezen te
worden. Emotionele en lichamelijke problemen waren het meest geassocieerd met stress. Niet
in staat zijn te werken was gerelateerd aan een hoge mate van stress en zowel het vrouwelijke
geslacht als co-morbiditeit waren gerelateerd aan de wens voor doorverwijzing. De meningen
over de DT waren over het algemeen positief. We concludeerden dat een aanzienlijke mate
van stress en een additionele zorgwens hiervoor frequent voorkwam bij patiënten met thuisTPV. De DT met PL zou een goed meetinstrument zijn voor regelmatige screening van deze
problematiek en om extra psychosociale steun in te schakelen voor patiënten die dit nodig
hebben en willen. Op deze manier kan de DT/PL kwaliteit van zowel de zorg als kwaliteit van
leven verbeteren. De DT met PL kan in de toekomst eenvoudig worden geïmplementeerd
in de online DRIFT registratie. Een speciale beveiligde online toegang voor patiënten kan
worden gecreëerd zodat patiënten hun zorgverleners periodiek kunnen informeren over hun
psychosociaal welbevinden en een eventuele wens voor extra zorg hiervoor kunnen uiten.
Hoofdstuk 4 bestudeert het economische aspect van thuis TPV en DDTx. Om hier inzicht
in te krijgen werd het ziekteverloop van chronisch darmfalen bij volwassenen nagebootst in
een studiemodel. Dit model gaat ervan uit dat het beloop van een patiënt met chronisch
darmfalen bestaat uit een reeks van overgangen tussen verschillende ziekte-specifieke
toestanden/situaties. Met dit model berekenden we de effectiviteit en de kosten van de beide
behandelmogelijkheden thuis-TPV en DDTx en bestudeerden we de kosteneffectiviteit van
DDTx. Dit laatste betekent dat we wilden bepalen of het effect van DDTx opweegt tegen de
gemaakte kosten van de behandeling.
De informatie die we in het model stopten was gebaseerd op data uit DRIFT, de
wereldwijde Intestinal Transplant Registry (ITR), ziekenhuis dossiers, literatuur en de meningen
van experts uit de thuis-TPV centra en het DDTx centrum. Het model werd gevuld met een
fictief aantal nieuwe patiënten van 40 per maand voor een periode van 10 jaar met een
maximale fictieve follow-up van 40 jaar. DDTx werd aangeboden aan 10% van de patiënten
met een levensverwachting van <12 maanden door falen van de thuis-TPV behandeling. De
kosten werden berekend volgens Nederlandse medische standaarden. Kosteneffectiviteit
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
171
werd geanalyseerd door de modelsimulaties met en zonder DDTx als behandelmogelijkheid
te vergelijken. Tevens werd de zogenaamde ‘incremental cost-effectiveness ratio (ICER)’,
ofwel de kosten per gewonnen levensjaar, berekend. Het model beschreef een gemiddelde
overleving van 14.6 jaar in de situatie zonder DDTx als behandeloptie en 14.9 jaar met deze
optie. De kosten van thuis-TPV waren €9.006 voor het starten van de behandeling, gevolgd
door een jaarlijks terugkerend bedrag van €63.000. De kosten van DDTx werden geschat op
€73.000 voor het eerste jaar van DDTx, gevolgd door een jaarlijks bedrag van €13.000. De
kosten per gewonnen levensjaar met DDTx (vergeleken met de situatie zonder de mogelijkheid
van DDTx) waren €20.654. Dit is betrekkelijk laag voor orgaan transplantatie. De absolute
overlevingswinst van 3 maanden zoals berekend met dit model lijkt wellicht marginaal,
echter deze winst geldt voor 10% getransplanteerde patiënten over het totaal aantal
patiënten waarvan 90% niet werd getransplanteerd. Daarom is de werkelijke ‘te waarderen’
overlevingswinst in feite langer dan 3 maanden.
De meest recente overlevingsdata vanuit de grote, meest ervaren DDTx centra
(gepresenteerd tijdens de 2-jaarlijkse ITR rapportage 2013) worden steeds gunstiger in
vergelijking met de overleving van patiënten met thuis- TPV. Daarnaast lijken we steeds beter
in staat te zijn om tijdig de patiënten te kunnen identificeren waarvan we verwachten dat ze
een slechte prognose hebben als ze langer doorbehandeld zouden worden met thuis-TPV.
Vanuit dit perspectief is er een discussie gaande over de mogelijkheid tot een grotere rol van
DDTx in de toekomst. Er zijn suggesties om de huidige rol van DDTx - als een laatste redmiddel
voor een klein aantal patiënten met falen van TPV - uit te breiden in meer preventieve
(rehabilitatieve) zin (DDTx in een vroegere toestand, voordat ernstige TPV complicaties
optreden), en de procedure aan te bieden aan alle patiënten met chronisch darmfalen. In
aansluiting op deze discussie zijn de beschreven resultaten van onze kosteneffectiviteit-studie
uiterst relevant. De volgende stap zou een kosten-utiliteit studie zijn. Een dergelijke studie
beschouwt medische kosten in het licht van QUALY’s (‘quality adjusted life years’) – hierbij
wordt rekening gehouden met de kwaliteit van de gezondheid van de gewonnen levensjaren.
Levenswinst wordt uitgedrukt in een getal wat hoger/lager is naarmate de gezondheidstoestand
gedurende die tijd beter/slechter is. Op basis van een dergelijke studie zouden we nog beter
in staat zijn de indicaties voor (rehabilitatieve) DDTx in een vroege toestand te definiëren.
In de nabije toekomst voorzien we een uitbreiding van de indicaties voor DDTx en een rol
voor de mening en perspectieven van de betrokken patiënten bij de besluitvorming. De Britse
getransplanteerde Michael Seres heeft hierin een indrukwekkend voortouw genomen en een
online blog-platform opgericht voor medepatiënten met darmfalen om hun mening te geven,
en te pleiten voor een rol van de individuele patiënt bij het bepalen van de indicatie voor DDTx
(http://www.michaelseres.com/).
Hoofdstuk 5 behandelt de noodzaak tot beter inzicht in de kwaliteit van het dunnedarm­
transplantaat (dunnedarmgraft) van een donor en de invloed van verschillende donor
factoren op deze kwaliteit voor de transplantatie. Het doel van de studie was om eenduidige
172 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
donorcriteria op te stellen ter selectie van de beste donoren met kwalitatief de beste grafts.
We analyseerden hiervoor de structuur en moleculaire kenmerken van darmweefsel en
onderzochten de relatie tussen de conditie van de donor en de schade aan de dunnedarmgraft.
We keken specifiek naar de waarde van een empirische set donorcriteria die nu in Amerika
wordt gebruikt om grafts te selecteren, de ‘Organ Procurement Transplant Network criteria’.
We namen 97 samples van dunnedarmweefsel (52 van het jejunum – bovenste deel van
de dunnedarm – en 45 van het ileum –laatste deel van de dunnedarm) bij 59 donoren (46
heart-beating donor/ 13 non-heart-beating).
Koude ischemie (een van de OPTN criteria) was positief gecorreleerd met structurele
weefselschade (uitgedrukt in de Park score). Het jejunum bleek gevoeliger voor deze
weefselschade dan het ileum. In het weefsel van de donoren die voldeden aan de OPTN
criteria was kleuring van het claudine-eiwit (dit zegt iets over de darmintegriteit) hoger en de
expressie van het weefsel stress-eiwit Heat Shock Protein 70 (HSP70) lager vergeleken met
donoren die niet aan de criteria voldeden. Deze uitkomsten suggereren een betere conditie
van het weefsel en golden ook voor het weefsel van heart-beating donoren vergeleken met
non-heart-beating donoren. Daarnaast was de expressie van de ontstekingsstof IL-6 hoger
bij heart-beating donoren en was dit tegengesteld gerelateerd met de gangbare, bekende
ontstekingsstof CRP.
Onze resultaten verdedigen dat de OPTN criteria onderscheid kunnen maken wat betreft
weefselkwaliteit. Tevens wijzen de resultaten aan dat het darmgraftweefsel van non-heartbeating donoren van mindere kwaliteit is en dat het jejunum gevoeliger is voor ischemie dan
het verderop in de dunnedarm gelegen ileum.
Deze resultaten geven inzicht in de transplantatie- en donor gerelateerde schade­
mechanismen die van invloed zijn op het dunnedarmtransplantaat voorafgaand aan transplan­
tatie. Het is echter wel zo dat het gebrek aan uitkomsten na daadwerkelijke transplantatie een
onomstreden tekortkoming is van onze studie. Het is daarom dan ook nodig om als volgende
stap een klinische studie met een transplantatiefase uit te voeren om onze resultaten te
bevestigen. Uiteindelijk zou er idealiter een praktisch scoresysteem opgesteld kunnen worden
voor het voorspellen van de kwaliteit van de dunnedarmgraft voor transplantatie.
Hoofdstuk 6 gaat over het preserveren van een dunnedarmgraft gedurende de tijd tussen
uitname in de donor en implantatie in de ontvanger. Het onderwerp preservatie wordt
uitgebreid toegelicht en er wordt een overzicht gegeven van resultaten van de belangrijkste
studies naar preservatie vloeistoffen en technieken die door andere onderzoekers eerder
werden uitgevoerd. Dit overzicht was bedoeld als uitgangspunt voor nieuwe gezichtspunten
en suggestie(s) ter verbetering van de huidige preservatie van de dunnedarm graft.
Op basis van wat eerdere onderzoekers hebben geschreven pleiten we voor een optimale
preservatie-strategie die het gevolg is van een synergistisch (elkaar versterkend) effect
van verschillende vitale aspecten. De sleutelrol is weggelegd voor de samenstelling van de
preservatievloeistof. Deze vloeistof zou een lage viscositeit (stroperigheid) moeten hebben ter
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
173
bevordering van het uitspoelen van bloed. Tevens moet de vloeistof aminozuren (bouwstenen
voor eiwitten) bevatten, zogenaamde impermeanten en colloiden welke zwelling van het
weefsel tegengaan en tenslotte een buffer die ervoor kan zorgen dat de PH-waarde van de
vloeistof constant blijft. Andere omstandigheden die het behoud van de darmgraft ten goede
kunnen komen zijn het uitspoelen van de bloedvaten voor de koude bewaarperiode en een
manier van preservatie van de binnenkant (het lumen) van de darm. Aan dit zogenaamde lumen
zou bv. ook een vloeistof toegevoegd kunnen worden. Ook zou kortdurende doorspoeling met
zuurstofrijke vloeistof door de bloedvaten of het lumen overwogen kunnen worden. Ondanks
deze suggesties moet de meest effectieve preservatievloeistof, +/- een luminale vloeistof en
een praktisch toepasbare optimale techniek nog ontwikkeld worden. Een op-maat-gemaakte
benadering van dunnedarmpreservatie verdient verder onderzoek.
Hoofdstuk 7 borduurt voort op hoofdstuk 6 en beschrijft de uitkomsten van onderzoek met
een door ons voorgestelde en ontwikkelde alternatieve preservatievloeistof en techniek. Met
dit alternatief beoogden we zo goed mogelijk aan te sluiten bij de veronderstelde behoeften
van de dunnedarm om de kwaliteit van de dunnedarmgraft, en vervolgens het resultaat van
DDTx te verbeteren.
Momenteel is het gebruikelijk om – net als bij andere organen - de bloedvaten van de
dunnedarm uit te spoelen met de bekende gekoelde University of Wisconsin (UW) preservatie
vloeistof en vervolgens het transplantaat koud te bewaren in deze vloeistof. Deze techniek
besteedt geen aandacht aan de binnenkant (het lumen) van de darm en de voortgang van
de stofwisseling (metabolisme) van het binnenste darmslijmvlies ondanks het koelen. In de
beschreven studie wilden we de effecten van luminale preservatie met een alternatieve ‘op
maat gemaakte’ vloeistof bestuderen na het gebruikelijke uitspoelen van de darmbloedvaten
met UW vloeistof. We hebben gekeken naar de kwaliteit van het transplantaat na preservatie
en her-toediening van zuurstof in een onderzoeksopstelling. De dunnedarm van ratten werd
6 uur gepreserveerd in ijskoude UW vloeistof of in de alternatieve vloeistof die we Williams
Medium E plus (WMEplus) hebben genoemd. De samenstelling van deze vloeistof is gebaseerd
op de ideeën die we in H6 hebben beschreven. De WMEplus vloeistof is een gangbaar
kweekmedium (WME) waaraan we o.a. buffers, impermeanten en colloiden (zie samenvatting
H6) hebben toegevoegd. De dunnedarm van ratten werd gepreserveerd in de 2 verschillende
vloeistoffen en op 2 verschillende manieren: nadat het lumen was dichtgemaakt (gesloten
preservatie) of na het spoelen en vervolgens opvullen van het lumen met de respectievelijke
vloeistof waar ook op gepreserveerd werd (luminale preservatie). Er werden kleine plakjes
gemaakt van ‘verse’ (controle) en gepreserveerde darm en deze werden vervolgens nog 6 uur
bestudeerd terwijl er zuurstof aan toegediend werd (re-oxygenatie) bij een temperatuur van
37°C. Op deze manier probeerden we de situatie na transplantatie na te bootsen. De studie
liet zien dat de structurele schade aan het darmweefsel direct na preservatie gering was en
niet werd bepaald door de manier van preservatie. Het gesloten bewaren resulteerde in een
aanzienlijk lager niveau van energie (ATP) vergeleken met een verse controle darm; deze
174 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
drastische energie daling zagen we niet na luminale preservatie. Re-oxygenatie beschadigde
de darm en openbaarde verschillen tussen de preservatie strategieën. Het energie-niveau en
de darmstructuur werden beter behouden met luminale preservatie; dit gold voor de beide
vloeistoffen. De darmstructuur was superieur na preservatie met WMEplus. Weefselstress
was het minst opgetreden in het darmweefsel dat luminaal gepreserveerd was met WMEplus.
We concluderen dat de weefselschade aan het darmtransplantaat door preservatie en reoxygenatie beperkt kan worden door luminale preservatie met WMEplus. Hiermee werden
onze ideeën zoals beschreven in H6 bevestigd. Deze voorgestelde ‘op maat gemaakte’
preservatie strategie verdient verder onderzoek in een werkelijk transplantatie model en
vervolgens in de menselijke situatie om de uiteindelijke ultieme preservatie techniek voor de
darm te ontwikkelen.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
175
REFERENTIES
1. O’Keefe SJ, Buchman AL, Fishbein TM, Jeejeebhoy KN, Jeppesen PB, Shaffer J. Short bowel syndrome and
intestinal failure: consensus definitions and overview. Clin Gastroenterol Hepatol 2006 Jan;41:6-10.
2. Scott NA, Leinhardt DJ, O’Hanrahan T, Finnegan S, Shaffer JL, Irving MH. Spectrum of intestinal failure in a
specialised unit. Lancet 1991 Feb 23;337(8739):471-473.
3. Lal S, Teubner A, Shaffer JL. Review article: intestinal failure. Aliment Pharmacol Ther 2006 Jul 1;241:19-31.
4. Wanten G, Calder PC, Forbes A. Managing adult patients who need home parenteral nutrition. BMJ 2011 Mar
18;342:d1447.
5. Pironi L, Joly F, Forbes A, Colomb V, Lyszkowska M, Baxter J, et al. Long-term follow-up of patients on home
parenteral nutrition in Europe: implications for intestinal transplantation. Gut 2011 Jan;60 1:17-25.
6. Pironi L, Goulet O, Buchman A, Messing B, Gabe S, Candusso M, et al. Outcome on home parenteral nutrition
for benign intestinal failure: A review of the literature and benchmarking with the European prospective
survey of ESPEN. Clin Nutr 2012 Jun 1.
7. Lloyd DA, Vega R, Bassett P, Forbes A, Gabe SM. Survival and dependence on home parenteral nutrition:
experience over a 25-year period in a UK referral centre. Aliment Pharmacol Ther 2006 Oct 15;24 8:1231-1240.
8. Scolapio JS, Fleming CR, Kelly DG, Wick DM, Zinsmeister AR. Survival of home parenteral nutrition-treated
patients: 20 years of experience at the Mayo Clinic. Mayo Clin Proc 1999 Mar;743:217-222.
9. Messing B, Lemann M, Landais P, Gouttebel MC, Gerard-Boncompain M, Saudin F, et al. Prognosis of patients
with nonmalignant chronic intestinal failure receiving long-term home parenteral nutrition. Gastroenterology
1995 Apr;1084:1005-1010.
10. Jeppesen PB, Staun M, Mortensen PB. Adult patients receiving home parenteral nutrition in Denmark from
1991 to 1996: who will benefit from intestinal transplantation? Scand J Gastroenterol 1998 Aug;338:839-846.
11. Jones BJ. Recent developments in the delivery of home parenteral nutrition in the UK. Proc Nutr Soc 2003
Aug;623:719-725.
12. Pironi L, Paganelli F, Labate AM, Merli C, Guidetti C, Spinucci G, et al. Safety and efficacy of home
parenteral nutrition for chronic intestinal failure: a 16-year experience at a single centre. Dig Liver Dis 2003
May;355:314-324.
13. Vantini I, Benini L, Bonfante F, Talamini G, Sembenini C, Chiarioni G, et al. Survival rate and prognostic factors
in patients with intestinal failure. Dig Liver Dis 2004 Jan;361:46-55.
14. Bonifacio R, Alfonsi L, Santarpia L, Orban A, Celona A, Negro G, et al. Clinical outcome of long-term home
parenteral nutrition in non-oncological patients: a report from two specialised centres. Intern Emerg Med
2007 Oct;23:188-195.
15. Ugur A, Marashdeh BH, Gottschalck I, Brobech Mortensen P, Staun M, Bekker Jeppesen P. Home parenteral
nutrition in Denmark in the period from 1996 to 2001. Scand J Gastroenterol 2006 Apr;414:401-407.
16. Jeppesen PB, Langholz E, Mortensen PB. Quality of life in patients receiving home parenteral nutrition. Gut
1999 06;44(0017-5749; 6):844-852.
17. Huisman-de WG, Schoonhoven L, Jansen J, Wanten G, van AT. The impact of home parenteral nutrition on
daily life-a review. Clin Nutr 2007 06;26(0261-5614; 3):275-288.
18. Buchman AL, Scolapio J, Fryer J. AGA technical review on short bowel syndrome and intestinal
transplantation. Gastroenterology 2003 04;124(0016-5085; 4):1111-1134.
19. Dijkstra G, Rings EH, van Dullemen HM, Bijleveld CM, Meessen NE, Karrenbeld A, et al. [Small bowel
transplantation as a treatment option for intestinal failure in children and adults]. Ned Tijdschr Geneeskd
2005 02/19;149(0028-2162; 8):391-398.
20. Dijkstra G, Rings EH, van Dullemen HM, Bijleveld CM, Meessen NE, Karrenbeld A, et al. Small bowel
transplantation as a treatment option for intestinal failure in children and adults. Ned Tijdschr Geneeskd 2005
Feb 19;149 8:391-398.
21. Fishbein TM. Intestinal transplantation. N Engl J Med 2009 09/03;361(1533-4406; 0028-4793; 10):9981008.
176 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
22. Pironi L, Staun M, Van Gossum A. Intestinal transplantation. N Engl J Med 2009 Dec 10;36124:2388-9; author
reply 2389.
23. Beath S, Pironi L, Gabe S, Horslen S, Sudan D, Mazeriegos G, et al. Collaborative strategies to reduce
mortality and morbidity in patients with chronic intestinal failure including those who are referred for small
bowel transplantation. Transplantation 2008 05/27;85(0041-1337; 10):1378-1384.
24. Chiu CJ, McArdle AH, Brown R, Scott HJ, Gurd FN. Intestinal mucosal lesion in low-flow states. I. A
morphological, hemodynamic, and metabolic reappraisal. Arch Surg 1970 10;101(0004-0010; 4):478-483.
25. Park PO, Haglund U, Bulkley GB, Falt K. The sequence of development of intestinal tissue injury after
strangulation ischemia and reperfusion. Surgery 1990 05;1075:574-580.
26. Bigam DL, Grant D. Small bowel transplantation. In: Morris PJ, Wood WC, editors. Oxford Textbook of Surgery
Oxford: Oxford University Press; 199.
27. Evans RW. Chapter 42 Financial, economic and Insurance Issues Pertaining to Intestinal Transplantation:
When Is Too Much Not Enough? In: Langnas, A., Goulet, O., Eamonn, M., editor. Intestinal Failure: Diagnosis,
Management and Transplantation. Oxford: Blackwell Publishing; 2008. p. 363-364-377.
28. Sudan D. Cost and quality of life after intestinal transplantation. Gastroenterology 2006 02;130(0016-5085;
2):S158-S162.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
177
DANKWOORD
‘Ik ontdekte dat ik me het meest tevreden voelde toen ik niets had en
tegelijkertijd alles: het bewegende water in het meer,
de ontelbare sterren in de lucht, het orkest van de vogels en de krekels,
de banen zonlicht die door het bladerdak vielen’
Jane Goodall, 2008
WIE VERDWAALT ZIET MEER…
De bestemming en de planning
‘Er gaat niets boven Groningen…’- dacht ik toen de ideeën ontstonden om een tocht te gaan
maken in het uitdagende, welbekende (alom gevreesde) wetenschappelijke gebied. Tijdens
de inventarisatie van bestemmingen werd ik direct geboeid door de juist opengestelde regio
dunnedarmtransplantatie in Groningen. Mij werd verteld dat ik bij de beheerders/gidsen van
het gebied Ploeg en Nieuwenhuijs moest zijn in het Universitair trekkersinstituut Groningen
(UMCG). Zo gezegd, zo gedaan.
Na zo’n 30 min kennismaken aan de ronde tafel bij Rutger waar ook Vincent bij was
bleken er volop routes en paden en wist Rutger mij te overtuigen van ‘de dakpanconstructie’,
waar hij veel succes mee had in de bergen. Op het goede moment op de juiste plek; er lag een
leuke route vanuit de Landelijk werkgroep darmfalen met een watervoorraad van de Maag,
lever, darmstichting’ en ondertussen zou ik kunnen ‘snuffelen’ in de uitgebreid geassorteerde
bergsport winkel van Henri Leuvenink met hulp van Jacco Zwaagstra (het COL). Het werd
hoog tijd om een pad op het gebied van darmtransplantatie uit te zetten naast de bestaande
veel belopen paden voor nier en lever in het Noordelijke gebied. Ik voelde mij een koningin te
rijk met dit aanbod en heb geen moment getwijfeld. Ik pakte mijn uitrusting…..
De voorbereiding
Een dikke map van Rutger met notulen van de afgelopen jaren van de Landelijke vergaderingen
van de werkgroep (later stichting) darmfalen met de TPV-centra in Nijmegen en Amsterdam. Een
rondleiding in het gebied door Henri en een kennismaking met de ‘manager’ van de bergsportzaak
Jacco Zwaagstra, die ook mij uiteraard aan de nodige verplichte trekking-permits hielp (pipetteren
etc….). Via Jacco kreeg ik ook toegang tot extreme temperaturen in afgesloten gebieden (koele
kamer, min-80 en soms vloeibare stikstof zelfs!). Vervolgens was mijn eindbestemming van dit
onderdeel de ‘trekkershut’ Triade. Soms verlaten, maar in het hoogseizoen druk en er heerste
soms schaarste van materialen/voorraad afhankelijk van het weer en de gasten. Dikwijls extreme
omstandigheden; ijzig koud of tropisch warm. Hier bivakkeerden ook Cyril Moers, Carlijn Buis,
Lyan Koudstaal, Mijntje Nijboer, Hugo Maathuis – voor een- of meerdere nachten. Ook waren er
wel buitenlandse, zelfs Chinese gasten, op zijn tijd. Henri was vaak voor hulp in- en om de hut te
vinden. Ik herinner me nog goed de eerste (het werden er vele) lessen en tips van Cyril; ‘meld je
direct aan bij de wandelsportverenigingen (o.a. PhD school van de Guide)’, Lyan; ‘een epje is een
plastic bakje waar je onderzoeksmateriaal in stopt’, Mijntje; ‘reken er maar op dat er een heleboel
misgaat’, Carlijn; ‘je moet maar eens mee komen trainen met mijn hockeyteam’, Hugo; ‘het
belangrijkste is dat je snel de digitale handtekening van Rutger krijgt…’. Vele trekkers wisselden
elkaar af; Jeffrey, Annelien, Ilona, Astrid, Lucy, Michael, Sanna, Greg, Speijers, Steijn. Er was zelfs
een tweede verdieping waar Wijnand Helfrich en zijn wandelgezelschap, maar ook Liesbeth
Schreurs, Bastiaan Pultrum, Jan Kootstra, Schelto, Justin en andere wandelaars logeerden - en ik
vergeet vast een heleboel gasten van de Triade trekkershut.
180 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
De reis: warmlopen
Korte dagtochten om mee te beginnen naar de eerste Landelijke vergaderingen van de
werkgroep darmfalen waar ik kennismaakte met Gerard Dijksta, Edmond Rings, Geert Wanten,
Hans Sauerwein, Mireille Serlie, Angelika Kinderman (later Merit Tabbers), Cora Jonkers en
Tirzah Tas, Jan Niesing, Frans Albersnagel en anderen. Een korte trek naar Madrid waar ze
ervaring hadden met het registreren van patiënten met darmfalen en tevens aanzienlijke
aantallen darmtransplantaties verrichten. Inderdaad, mijn ‘permit’ van de Guide met een
digitale handtekening van Rutger, bracht de wereld aan mijn voeten. Wat een feest om mee
te kijken op de ok met een volledige damtransplantatie procedure bij een kind in Madrid. Met
dank aan Han Moshage, Riekje Banus, Mathilde Pekelaar en Maaike Bansema (die ik tot op de
dag van vandaag nog altijd door elkaar haal) die mijn verzoeken voor ‘extra (buitenlandse)
dagtochten’ altijd zonder problemen honoreerden. Het genoegen van meekijken met
een DDTx procedure herhaalde zich later in het UMCG toen ik zag hoe Rutger, Vincent,
Sijbrand, Robert Porte, Ries de Langen, Edmond, Gerard e.a. de eerste DDTx bij een kind in
Nederland uitvoerden; wat een mooi teamwerk! Geweldig dat ik tijdens mijn onderzoek ook
ten alle tijden bij het klinische programma werd betrokken. De eerste hoge klim naar het
wereld darmtransplantatie congres in Bologna met o.a. Gerard, Edmond, Ries de Langen
en Vincent, waar ik diverse top-trekkers (waaronder Debra Sudan en Jaques Pirenne) voor
het eerst ontmoette. Ries heeft mij geamuseerd met verhalen ‘uit de oude doos’; ‘vroeger
bracht je de stukken die je met de typemachine had getikt op de fiets naar het huisadres
van je promotor waar je ze deponeerde in de brievenbus aan de deur, alles was dus nog veel
tijdrovender en lastiger etc. etc., tegenwoordig is het allemaal veel eenvoudiger…’ Een cursus
in wandeltechnieken in Birmingham via ESOT, uiteraard met een beetje hulp van Rutger die
altijd waar dan ook zijn wandel-vrienden had. Uit gebrek aan resultaat en ervaring schreef
ik maar een voorstel voor een tocht om zo toch deel te kunnen nemen aan het Symposium
Experimenteel Onderzoek Heelkundige Specialismen (SEOHS). Wie had ooit gedacht dat ik
daar met dit voorstel een kleine watervoorraad kreeg om deze tocht ook daadwerkelijk te
lopen.
Op pad
Op basis van de notulen van de werkgroep probeerde ik de DRIFT ideeën te destilleren en
stippelde ik met Vincent de DRIFT route uit. Uiteraard werd ik betrokken bij ‘de bergsportwinkel
het COL’: wekelijkse vergaderingen, en Jacco zorgde ervoor dat de koffie- en lunchpauzes
dagelijks stipt op hetzelfde tijd plaatsvonden en dat ondanks deze zich herhalende structuur
iedereen op deze momenten zijn/haar persoonlijke telefonische uitnodiging kreeg. De
winkel was dan ook altijd even gesloten. Vele medewerkers van de COL winkel hebben mij
geadviseerd en geholpen met het aanschaffen en opslaan van de juiste ‘gear’ (altijd te weinig
bergruimte in ‘de rugzak’), het wijzen van de route, en sommigen liepen hele stukken met me
mee of droegen zelfs mijn bagage! (Petra Ottens, Janneke Wiersema-Buist, Jelle en uiteraard
‘de altijd goedlachse, onuitputtelijke’ sherpa Tjasso Blokzijl). Elke ochtend ging ik naar de
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
181
dagelijkse praktische briefings op de 4e verdieping in de Eerlandzaal van het ‘Universitair
Trekkersinstituut’. Hier leerde ik Liesbeth Schreurs kennen en kreeg ik het een en ander mee
vanuit de praktische trekkerswereld. Nog steeds heb ik goede herinneringen aan de 2 weken
op de bank naast de konijnen in de comfortabele ‘lodge’ van Liesbeth en Jorrit.
Mijn eerste ideeën over het terrein van darmpreservatie ontstonden en ik deed een
poging tot het schrijven van een review hierover in een wandeltijdschrift, dit werd nog een
lange geschiedenis. Ik keek mee met de fantastische ECOPS wandel-excursies van Hugo naar
de overkant in een gebied met veel onbekende diersoorten. Waar ook Rutger, Vincent, Cristina
en Sijbrand in actie kwamen en natuurlijk waren Edwin Dierselhuis en Arjan altijd van de
partij. Er ontstonden met hulp van mijn ervaren gids Henri ideeën over een dierexperiment in
het gebied van darmpreservatie en we richtten de UMCG Gut-club op voor inspiratie tussen
wandelaars uit alle hoeken van het UMCG met een voorliefde voor het darmgebied. Zo leerde
ik Margot Fijlstra, Jeroen Visser en uiteraard Inge de Graaf en Geny Groothuis kennen.
Al snel werd ik geconfronteerd met het grootste probleem van de wandelaar: watertekort
op hoogte. Mijn gids Vincent zou op zoek gaan naar een bron en vond een tijdelijke bron
in het klinische chirurgische trekkersinstituut. Ik maakte een korte tocht als AGNIO in het
UMCG toen het water op was. Met dank aan iedereen van de heelkunde UMCG voor deze
mogelijkheid en de flexibiliteit – staf, planners, secretaresses (Ingrid, Mariska, Natascha)
en met name de andere AGNIO’s (o.a. Joé, Arvid, Sander, Lucas, Henk-Jan, Ellen, Ruben,
Anton, Bas, Patrick, Mijntje, Ilona, Karin, Liesbeth (2x), Charlotte, Linda) en in het bijzonder
Robert Lindt. Fantastisch dat ik mocht meelopen ‘tot mijn watervoorraad was bijgevuld’ en
desondanks betrokken werd bij alle uitjes zoals ski-reis, chirurgencup, zeilen etc. Zelfs toen
het uitkwam dat ik met mijn rode, vieze wandel-klompen het ‘niet betreden’ op het bordje
bij de natte, vers gegoten vloer had genegeerd kon hierom worden gelachen! Who’s done it?
Om zelf ook op zoek te gaan naar water reageerde ik op een advertentie in de welbekende
Groninger Gezinsbode over het Innovatief Actieprogramma Groningen (IAG) wat neerkwam
op een grote ‘bron’ voor innovatieve samenwerkingsprojecten o.a. op het gebied van zorg.
182 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
De afzonderlijke etappes
DRIFT
De DRIFT etappe liep ik met Floris en Jelle van Aceso en de Werkgroep –later stichtingdarmfalen Nederland.
Het bleek een lange en zware tocht, het weer viel tegen en de bergen leken steiler dan
verwacht. Soms was het lastig om alle wandelaars van de DRIFT groep –de medisch klinische
en de ICT lopers– door te laten lopen of bij elkaar te houden. Eindeloze uren van DRIFT sessies
vooral met Vincent en Rutger en later Gerard en Edmond volgden. Gezamenlijke motivatie,
onverwachte zonnestralen en ook veel plezier hielden ons op de been en gemotiveerd. De
bruisende ‘IAG bron’ leste onze dorst en maakte veel goed. Het is natuurlijk geweldig dat DRIFT
werkelijkheid werd en dat het nu gebruikt kan gaan worden. Esther, wat ben jij een geweldige
‘dakpan’, super dat het eerste DRIFT artikel er is gekomen en dat jij het ‘wandelstokje’ met ziel
en zaligheid overneemt. Jij en Edmond= succes verzekerd!
Hans Sauerwein, Geert Wanten, Edmond Rings, Merit Tabbers, Angelika Kinderman,
Frans Albersnagel, Floris- jullie ontbreken op de foto maar horen er natuurlijk volop bij!
Floris en Jelle, super dat jullie met Daan Jansen een doorstart van het bedrijf hebben kunnen
realiseren.
Prometheus-pad
Met behulp van het opgezette hoofd pad van Mijntje Nijboer op de Prometheus-route
konden we hier ook een darm-Prometheus-pad aan plakken. Mijntje had al heel wat lastige
klussen aangepakt en onderhoud uitgevoerd. Samen met Rutger, Vincent, Henri en de jonge
enthousiaste wandelaars van het Prometheus studenten ‘trekking team’ – waaronder Joost,
Paul, Rosa, Thijs en vele anderen begonnen we. Dit werd aangevuld met de medewerking van
iedereen in het COL (met name Jacco, Petra en Janneke), vele tips van Lyan en de bereidheid
van Harry van Goor voor het beoordelen van het beeldmateriaal van de route. Tenslotte,
zonder de inspanningen van o.a. Ernst, Danielle, Eldrid en natuurlijk de darmdonoren had
ik deze bijzondere etappe niet succesvol af kunnen leggen. Een terugkerend hoogtepunt
was uiteraard de jaarlijkse boottocht waarbij niet alleen wandelaars op de darmroute in het
Noorden maar ook vanaf alle andere routes mee kwamen varen. Hier werden veel verhalen
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
183
en ervaringen uitgewisseld en er werd zelfs gezwommen/gedoken (met duikuitrusting door
een enkeling). Tobias, geweldig dat jij ook bent aangehaakt en met de ‘laatste loodjes’
meewandelt….
“Het afgelegen terrein over de brug genaamd FTT”
Via de gut-club en de contacten van Henri en Rutger hoorden we over het FTT gebied van
Geny Groothuis en Inge de Graaf waar volop darmpaden zouden zijn. Geny en Inge hadden
exact dezelfde eindbestemming dus al snel werd er besloten een stuk samen te lopen. Ik
plande de route, Inge zorgde dat alles aanwezig was en betrok zelfs de jonge wandelaar
Carianne en Marina bij de tocht. Welmoed en later Guido sloten zich bij mij aan en hielpen
me, en Henri en Geny checkten af en toe of de tocht nog goed verliep. Jacco leverde soms
proviand uit de bergsportwinkel COL. Ook hadden we speciale ‘maatwerk’ spullen nodig maar
gelukkig was Reinout Schellekens van de apotheek van het Bergsportinstituut bereid mee te
werken. Het was een bijzondere maatwerk vloeistof, volgens Jacco leek het op een banaansinaasappel smoothie, hij had het spul dan ook liever niet in de COL-winkel! Het was een
ingewikkeld gebied maar ondanks dat liep deze reis gesmeerd. We kenden weinig tegenslagen
en de etappes waren goed te doen. Het was een gezellige trip en zelfs de verslaglegging van
de reis verscheen bijzonder vlot in een goed wandelsportblad.
Tijdens deze fase van de reis kwam er ook nog voor een korte periode een Braziliaanse gast
via Henri om in de winter een stuk mee te lopen. Nadat we Mattheus hadden geleerd dat het
niet mogelijk is om in zwembroek een trektocht te maken hielpen we hem aan goede gear en
toonden we hem Nederlandse sneeuw!
De kwaliteit van leven (QoL) route
Deze route werd gelopen met Josette Hoekstra, die zojuist haar eigen wandelkaart had
bestudeerd voor een ander gebied. We kregen informatie van Geert, Cora, Mireille en zelfs
van Janet Baxter uit de UK. Geert vulde het team aan met Getty, zeer ervaren op dit terrein.
Josette en ik hadden het altijd gezellig tijdens het wandelden en hadden eigenlijk nooit
onenigheid; tijdens het lopen leerde ik veel wandel-technisch nieuws maar hadden we het ook
vaak over wat ons nog meer bezighield; Josette vertelde graag over familie en golf. We liepen
flink door maar Josette was ook bereid een stuk alleen door te lopen toen ik het niet kon
laten om in te gaan op de uitnodiging van Robert Pierik om even langs het Zwolle ‘massief’ te
lopen. Deze uitnodiging nam ik aan, het bleek een mooie reisperiode. Op deze weg waren de
wandelaars opvallend goed gehumeurd (Paul Houben, Dick van Geldere, de Vries, Gijs Patijn,
Sven van Helden, Fritchy, Burghard, Oskam, Annette van Dalsen). Ik liep veel samen met
andere jonge trekkers waaronder Wijnand, Hamid, Anne-Brecht, Kevin, Matthijs, Myriam, Jan,
Speijers, Frederiek, Annemarie, Mark, Wendy, Andrew en ook Mijntje kwam ik hier weer tegen.
Bij Wijnand in de ‘bosrijke’ Kuyerhuislaan vond ik een private trekkershut midden in de natuur
die ik tijdelijk huurde. Er was veel lol en vrijdagmiddag was altijd een bijzonder dagdeel in dit
184 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
gebergte. Inge Terpstra coördineerde het team en was altijd behulpzaam en Robert Pierik
gaf frequent de hem-kenmerkende motiverende peptalk. Robert, dank voor je buitengewone
vertrouwen en je eerlijke adviezen in de familiekamer!
Natuurlijk sloot ik de route met Josette succesvol af en hadden we mooi uitzicht vanaf
de top.
Dankzij Robert en Prof ten Duis kreeg ik de volgende uitnodiging om aan de eerste etappe
van de meest uitdagende, lange Heelkunde tocht te beginnen vanuit de Martini Vallei. Al
jaren wilde ik niets liever dus ik twijfelde geen moment. De weersomstandigheden in dit
gebied konden wel eens bar zijn, de etappes waren vaak lang…. Toch waren ook hier veel
gemoedelijke medeklimmers onder aanvoering van Peter Baas, waaronder Stefan Rödel, Paul
Keller, Wendy Kelder, Annette Olieman, Eelke Bosma, Beerthuizen, Breek, Julius, Glade en
Stael. En natuurlijk ook weer een fantastische jonge wandelclub met o.a. Nienke (waarmee ik
ook hockeyde via Carlijn), Iris, Geske, Lucas, Henk Jan, Merel, Bastiaan, Kirsten, Anton, Cyril,
Jinne, Liesbeth, Jenneke, Dennis, de een na de ander kwam en ging. Helaas kreeg ik tijdens
deze reis te maken met bijzonder slecht weer en zeer onverwachte tegenslagen, het pad was
niet meer zichtbaar. Gelukkig waren er Sylvia, Jan, Anouk, Gerben, Vera, GuruJi, Jurjen, Kim,
Paul en Corinne die me de weg wezen. Deze tegenslagen en het verdwalen zette mij aan
het denken en er bleken opeens nog meer interessante routes. Ik ontmoette op dit moment
ook Piet Leguit en leerde zijn bijzondere initiatieven kennen. Ik besloot weloverwogen de
Heelkunde tocht af te blazen. Alle andere paden waren te verleidelijk….
Het darmpad stond nog uit –en we waren al een eind op weg- maar mijn vertrouwde gidsen
Rutger en Vincent waren inmiddels niet meer op deze route. Er bleef goed contact maar
steeds meer werd ook Gerard een belangrijke gids. Met hem maakte ik o.a. een side-trip naar
Washington waar we bijna de vlucht misten omdat Gerard niet kon kiezen uit de luchtjes bij de
Tax Free. Het was mooi en gezellig deze trip met hem en zijn zoons mee te maken, die over de
meest onverwachte talenten bleken te beschikken (maar pas op bij harde wind). Er ontstonden
ook weer nieuwe vervolgplannen met het darmpad. We zouden de kosten gaan bestuderen en
ook kreeg ik via Gerard weer een klinische opdracht in het Universitair trekkersinstituut. Ook
hier waren de wandelaars zoals Jan Kleibeuker, Hendrik van Dullemen, Hans Blokzijl, Rinse
Weersma, Jan Jacob Koornstra, Dr Peeters, Robert Verdonk, Marleen de Vree en de jonge
lopers waaronder Hans (2x), Wouter, Joost, Rina, Hedwig, Ilona, Jasmijn, Jessie, Boudewijn,
Lieke e.a. bijzonder goed gezelschap! Samen met Henk Groen en Paul Krabbe en met hulp van
onder andere Robert Borgers, Sijbrand Hofker en Jan Willem Haveman - en uiteraard Geert en
Mireille - brachten we de kosten in zicht. Ook deze etappe werd onlangs voltooid.
Ongekende paden
Ondertussen had ik gehoord over een goed toegankelijke, betrekkelijk korte route naar een
prachtig gevarieerd en aangenaam gebied. Inmiddels heb ik er al een deel van deze tocht op.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
185
Het is een sprookjesachtig gebied, een beetje afgelegen, maar inderdaad prachtig. Aan Dennis
en Nicole heb ik 2 geweldige gidsen, ondersteuning is er van Alice en Jannie. De sfeer en het
klimaat in dit gebied is uitstekend, het aanbod aan ‘flora en fauna’ inderdaad zeer gevarieerd
en uitdagend en mijn gidsen delen zonder moeite ‘huis en haard’ en betrekken mij bij het
familieleven in deze regio en in hun ‘lodges’. Tijdens de tocht heb ik frequente bijeenkomsten
in het trekkersinstituut om te bespreken wat we allemaal tegenkomen in de wildernis. Met
dank aan mijn groepsgenoten en begeleiders voor het begrip voor het feit dat er de laatste
tijd door mij soms 2 routes tegelijk gelopen worden om de darmroute ook daadwerkelijk af
te kunnen maken.
Iedereen, genoemd en niet genoemd, die heeft meegelopen of op welke manier dan ook heeft
bijgedragen aan de tocht -inclusief de Beoordelingscommissie- bedankt!
Rutger, Vincent, Gerard, Henri, Edmond…. Ik kan hier een heleboel woorden van dankbaarheid,
bewondering etc.…. schrijven, maar dat spreekt natuurlijk allemaal voor zich. Wie had dit ooit
gedacht – ONZE tocht is afgesloten! Dit gaan we vieren!
Tussen de etappes door stond mijn reisbegeleiding altijd klaar; Sylvia en Jan met de Fauthjes
en ‘het huisje’, Kimmie, Jur, Corinne (hopelijk snel weer meer contact), Els (de beste soep-kok
van Groningen), Marike (al is het veel te weinig en te ver…), ‘mijn’ hoftuin als de zon schijnt,
hockey - in het begin bij Haren (met o.a Carlijn) en later bij GHBS (met Nienke)-,lunch om
12.30 stipt met Petra en anderen, Bo’s dinner, mijn moestuin (en de meest milieuvriendelijke
award!), tuin in stad, Frans, Vivian, the Art of Living (Francesca, Ingrid, Robert, Ankie), de
Euro-a-day concerten bij Ineke in de Bloemerstee met Mireille, de Ayurveda (Dr. Lokesh, Dr.
Lita), Holisan met Harry, Wim en Wim Knoppert), hardlopen, opnieuw leren vioolspelen met
Joanne, Paul Rompa, Jenneke en de BK, Iris, mijn reizen waaronder de laatste klapper met
Arne in Nepal. Mam, fijn dat ik je weer zie. En nu, Marssum, Nicole, Dennis, Alice, Jannie,
Wouter, Wisse, Stijn, Fransje, Jeroen, Evelien, Roeland, wat tref ik het! Wat mij betreft is het
nog lang geen November….
186 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
De Afrikaanse Kili, de Tibetaanse Himalaya, de Marokkaanse Toubkal, de Nepalese
Gosainkund….. Er gaat niets boven Groningen!
CURRICULUM VITAE
CURRICULUM VITAE
Anne Margot Roskott werd geboren in Zwolle op 18 april 1980. Tijdens haar jeugd was ze
veel op- en om het hockeyveld. Nadat ze haar Gymnasium diploma behaalde aan het Johan
van Oldenbarnevelt Gymnasium Amersfoort (1992-1997) vertrok ze voor een jaar naar
Amerika. Ze was counselor bij zomerkampen en ze hockeyde en studeerde een jaar aan de
Old Dominion University in Virginia (USA). Dat jaar werd ze met haar team US National
Champion. Hierna startte ze de studie geneeskunde aan de Universiteit van Utrecht en
werd ze lid van de UVSV. Uiteraard bleef ze hockeyen bij Kampong in Utrecht. Ze behaalde
haar artsexamen op 22 december 2005. Tijdens haar medische studie bleek haar interesse
in (kinder)chirurgie en reizen (naar ontwikkelingslanden). Ze volgde een semi-arts stage in
het Wilhelmina Kinderziekenhuis, en klinische keuzestages in ziekenhuizen in Berekum en
Techiman, Ghana.
Ze had al snel wetenschappelijke interesse. In 2002 onderzocht ze het resistentiepatroon van urineweginfecties in Nicaragua i.s.m. dr Hoepelman vanuit het UMCU, in 2004
het risicoprofiel van anemie bij kinderen (in Ghana) en in 2005 de langetermijn gevolgen van
twee wijzen van thoracotomie ter correctie van oesophagusatresie (WKZ Utrecht prof. dr Bax).
Haar zoektocht naar een (kinder)chirurgische opleiding bracht haar op verschillende
plekken, waar zij klinische bezigheden vaak combineerde met wetenschappelijk onderzoek:
tussen 2005-2006 als ANIOS kinderheelkunde op de ICU kinderchirurgie in het Erasmus
MC/Sophia Rotterdam; 2006-2007 als ANIOS heelkunde in het Meander Medisch Centrum
Amersfoort, 2008-2011 als ANIOS heelkunde in het UMC Groningen (start van haar
promotieonderzoek) en de Isala Klinieken Zwolle. Tussendoor liep ze nog een stage tropische
orthopedie in het St Anthony Hospital Dzodze Ghana (2009 dr P.Rompa), en deed ze haar
Advanced Trauma Life Support (ATLS training ) in het Harlem Hospital in New York (2010). In
september 2011 werd ze aangenomen voor de Heelkunde opleiding en begon ze als AIOS in
het Martini Ziekenhuis Groningen. Hier werkte ze tot tot juli 2012.
Haar medisch-wetenschappelijk activiteiten staan vanaf 2008 praktisch geheel in het
teken van het darmonderzoek. Ze verwierf enkele (proefdier-)onderzoek vaardigheden en
werd Projectmanager van de Dutch Registry of Intestinal Failure and Transplantation (DRIFT)
binnen de Stichting Darmfalen Nederland (UMC Radboud, AMC,UMCG). Ze was secretaris
van de ‘Gut-club’ van het UMCG (2008-10) en ze organiseerde met anderen de Dunnedarm
Biobank Multi-orgaandonoren (m.b.v. het Prometheus Studenten Team UMCG). Haar
proefschrift tenslotte werd een combinatie van klinische studie op het gebied van darmfalen
in Nederland en experimentele studie naar de mogelijkheden om de viabiliteit van de dunne
darm voor transplantatie te optimaliseren.
190 intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
Ze kreeg een subsidie vanuit het ‘Innovatief Actie Programma Groningen’ mogelijk gemaakt
door door de EU en de Provincie Groningen. In 2008 ontving ze de prof.dr Klopperprijs voor
“Novel strategies for maintenance and measurement of intestinal integrity in the scope of
intestinal transplantation”, en een subsidie van de J.K.de Cock Stichting. In 2010 werd haar de
Astellas Transplantationele Research Prijs van de Ned. Transplantatievereniging toegekend,
en in 2011 de ‘best abstract award’ tijdens het International Small Bowel Transplant Congress
in Washington.
In september 2013 begon Anne Margot aan de huisartsenopleiding in Marssum, Friesland.
Ze hoopt de komende tijd weer volop tijd voor vrienden, sport, natuur (en nog meer reizen),
de viool, en haar ‘zweverige’ hobby’s te hebben.
intestinal failure and tr anspl antation ‘penny wise - pound foolish?’
191