Cloning and Expression of Phytase
(PhyA) Gene for supplementation of
Poultry
By :
Dalia Abu Issa
Supervisor:
Dr.Fawzi Razem
Outlines:
•
•
•
•
•
•
•
Introduction
Statement of problem
Aim of study
Material and Methods
Results and Discussion
Conclusion
Future work
Introduction
Poultry
• Because poultry products
are in demand around the
world;
• and because chickens and
other poultry can be reared
in almost any part of the
world,
• a renewed interest in
poultry projects in all fields.
Poultry in Palestine
• There is a large commercial
chicken industry in palestine
• We depend on chicken that
provides us as a first supply
with eggs and meat.
Poultry Food
•
Feed for poultry mostly
consists of grain.
• Which consist of P , Ca , zinc
,magnesium and iron ,
What is the problem?
Statement of problem
• plant especially bran and seeds store 80% of
P as Phytic acid
• The problem is poultry have not the
enzyme phytase that can librate P from
its storage as phytic acid.
Statement of problem
• So farmers add inorganic
P to the poultry feed in
order to utilize it
• result in execration of all
Inorganic P in their
manure to cause
environment P pollution
especially in water
resources at animal
production areas
Aim of study
• to provide phytase gene (phyA) suitable for
protein expression into phytase enzyme to
supplement poultry feed in Palestine
Materials and Methods
• Aspergillus niger strain 103 isolation
• RNA Extraction from Aspergillus niger cell
Collection and
• cDNA Synthesis from mRNA that Extracted
from Aspergillus niger
• Amplification and Visualization of a phytA Gene
from Aspergillus niger cDNA
• To amplify the cDNA phytA gene, DNAMAN
software was used to design primers based on
the phytA sequence NCBI accession number
AB022700 as follows:
• Phytase F 5`- ATGGGTGTCTCTGCCGTTCTAC -3`
• phytase R 5`- CTAAGCGAAACACTCCCCCC -3`
• Cloning of phytA Gene in pGEM® -T Easy
vector
• Transformation into DH5α
• Screening and Verification of Positive Clones
• Sequencing of purified plasmid
• Subsequent Cloning of phytA Gene into p
PROEXH-Tb
Expression Vector
• Induction and Purification of phytase
Results and Discussion
• Aspergillus niger Growth and RNA Extraction
• Cloning of PhytA Gene Aspergillus niger
1500 bp
1000 bp
900 bp
• Successful cloning of phytA gene in p GEM-TEasy cloning vector ,
• Cloning was verified by PCR
1500 bp
• Sequence information and homologies of the
cloned phytA gene
Conclusion
• We have now a clone of phyA gene which is
98% homology to aspergillus niger phytase
gene at NCBI
Future work
• We work now on the expression of phytase
enzyme in order to supplement it to poultry