Making
DNA Molecules
Chapter 13
Learning Outcomes





Describe the process of semiconservative DNA replication in cells
and compare and contrast this method with DNA synthesis in the
laboratory
Discuss the uses of synthesized oligonucleotides and identify the
attributes of good primers
Explain the steps of PCT and discuss the components and
optimization of the process
Discuss the function of a thermal cycler and how PCR results are
visualized
Describe applications of PCR technology, including uses in the
field of forensics
13.1 Making DNA Molecules – DNA Synthesis
A DNA molecule, at any given moment, could be involved in:
• DNA replication
• Transcription
DNA and Chromosomes
DNA molecules directly code for all the RNA and protein
molecules that a cell synthesizes.
The 44 chromosomes in human cells are actually 22
homologous pairs, plus 2 sex chromosomes.
DNA Replication
A human body is estimated to have over 20 trillion cells. These cells all
originate from a single fertilized egg cell by means of DNA replication.
DNA Template
A template DNA is the strand from which a new strand is synthesized.
Primer
A primer is a short piece of DNA or RNA that is complementary to a
section of template strand.
Nucleotides
Nucleotide triphosphates are the reactants used as the sources of A, C,
G, and T for the new strand.
DNA Polymerase
Polymerase builds large molecules (polymers) from smaller molecules
(monomers).
Reaction Buffer
Reaction buffer is used to maintain the pH of the synthesis reaction.
Vocabulary
•
Homologous pairs – two “matching” chromosomes that have the same genes in the same order
•
DNA replication – process by which DNA molecules are duplicated
•
in vivo – referring to an experiment conducted in a living organism or cell; literally “in living”
•
Helicase – enzyme that functions to unwind and unzip complementary DNA strands during in vivo
DNA replication
•
Topoisomerase – enzyme that acts to relieve tension in DNA strands as they unwind during in
vivo DNA replication
•
RNA primase – enzyme that adds primers to template strands during in vivo DNA replication
•
Primer – a short piece of DNA or RNA (15 – 35 bases) that is complementary to a section of
template strand and acts as an attachment and starting point for the synthesis strand during DNA
replication
•
DNA polymerase – enzyme that, during DNA replication, creates a new strand of DNA nucleotides
complementary to a template strand
•
RHase H – enzyme that functions to degrade RNA primers, during in vivo replication, that are
bound to DNA template strands
Vocabulary
•
•
•
•
•
•
•
•
•
•
in vitro synthesis – any synthesis that is done wholly or partially outside of a living organism
(eg, PCR); literally, “in glass”
Probes – fluorescently labeled DNA or RNA sequences (oligonucleotides) that are used for gene
identification
DTT – abbreviation for dithiothreitol, a reducing agent that helps stabilize the DNA polymerase in
DNA synthesis, PCR, and DNA sequencing reactions
Template – strand of DNA from which a new complementary strand is synthesized
dNTP – abbreviation for nucleotide triphosphates, which are the reactants used as the sources of
A, C, G, and Ts for a new strand of DNA
dATP – abbreviation for deoxyadenosine triphosphate, the cell’s source of adenine (A) for DNA
molecules
dCTP – abbreviation for deoxycytidine triphosphate, the cell’s source of cytosine (C) for DNA
molecules
dGTP – abbreviation for deoxyguanosine triphosphate, the cell’s source of guanine (G) for DNA
molecules
dTTP – abbreviation for deoxythymidine triphosphate, the cell’s source of thymine (T) for DNA
molecules
Reaction buffer – buffer in PCR that is used to maintain the pH of the synthesis reaction
13.1 Review Questions
1.
How many chromosomes does an E. coli cell contain? How many
chromosomes does a human body cell contain?
2.
What are homologous pairs, and where do they come from?
3.
Name six enzymes involved in in vivo DNA replication.
4.
How is in vitro DNA synthesis in a test tube different than in vitro DNA
synthesis in an automated synthesis?
13.2 DNA Synthesis Products
DNA is commonly synthesized for these applications
• Probes
• Primers
• PCR amplification
Probes
Probes are relatively short pieces of DNA (or RNA) with a nucleotide
sequence complementary to another sequence being searched for.
Blotting
Samples are transferred from the gel to a membrane or specially
treated paper.
Microarrays
Microarrays are assemblies of large numbers of samples of DNA, or
even RNA samples.
Constructing Primers
Primers are constructed to recognized a particular section of DNA.
This is called primer design.
PCR Amplification
Primers are used when trying to mark, identify, or amplify a piece of
DNA.
Vocabulary
•
Amplification – increase in the number of copies of a particular segment of DNA,
usually as a result of PCR
•
Cross-linker – instrument that uses UV light to irreversibly bind DNA or RNA to
membrane or paper
•
Microarry scanner – instrument that assesses the amount of fluorescence in a
feature of a microarray
•
Primer design – process by which a primer sequence is proposed and constructed
13.2 Review Questions
1.
What is it called when DNA samples are transferred to a membrane for
staining or probing?
2.
How are probes used in microarrays?
3.
Design a primer that would be good for recognizing the beginning of
the following “sequence of interest.” Describe why your primer is a
good one.
3’ACACAGGATACGTGCTGCTCAATGCCATGATAGCCGGTCACAAGCTAATCCGATTTCGCGCAAATTCCTAAATTCGCTAAAGCGAATCTTCAGGAAGGAACCCCGAAGGCCTTTT-5’, and so on.
13.3 Polymerase Chain Reaction
Polymerase chain reaction (PCR) is a method by which millions of copies of
a DNA segment can be synthesized in a test tube in just a few hours.
Performing a PCR Reaction
•
•
•
•
•
•
Reaction buffer: Maintains pH
Forward primers: Recognize one end of the fragment to be amplified
Reverse primers: Recognize the other end of the fragment to be
amplified
Taq polymerase: Special DNA polymerase that remains active at very
high temperatures
dNTPs: The four deoxynucleotides (A, C, G, T)
Magnesium chloride (MgCl2): Necessary cofactor for polymerase
activity
Cyling Program
The cycling program chosen depends on the type of sample to be
amplified.
Challenges in PCR Technology
•
DNA samples are often compromised.
•
Concentration of reagent, and the time and temperatures of the
thermal cycling program may affect the results.
Vocabulary
•
Primer annealing – phase in PCR during which a primer binds to a template
strand
•
Extension – phase in PCR during which a complementary DNA strand is
synthesized
•
Optimization – process of analyzing all the variables to find the ideal
conditions for a reaction or process
13.3 Review Questions
1.
Why is Taq polymerase used in PCR instead of some other DNA
polymerase?
2.
What are the three parts to a thermal cycling reaction, and what is the
difference in temperature between them?
3.
What is it called when a PCR technician determines the best conditions
for running a PCR protocol?
13.4 Applications of PCR Technology
•
Forensics/criminology
•
Missing children/soldiers
•
Paternity/maternity cases
•
Medical diagnostics
•
Therapeutic drug design
•
Phylogeny/evolutionary studies
•
Animal poaching/endangered species
DNA Fingerprinting
PCR technology came into public spotlight during the 1992 O.J. Simpson
murder trial.
Forensics
Forensics is the application of biology, chemistry, physics, mathematics,
and sociology to solve legal problems.
Vocabulary
•
Karyotyping – process of comparing an individual’s karyotype with a normal,
standard one to check for abnormalities
•
VNTRs – abbreviation for variable number of tandem repeats, sections of
repeated DNA sequences found at specific locations on certain chromosomes;
the number of repeats in a particular VNTR can vary from person to person;
used for DNA fingerprinting
•
Forensics – application of biology, chemistry, physics, mathematics, and
sociology to solve legal problems including crime scene analysis, child support
cases, and paternity
13.4 Review Questions
1.
Restriction fragment length polymorphism technology was formerly
used for DNA fingerprinting. What technology is currently used for DNA
fingerprinting?
2.
For a DNA fingerprint, many PCR targets are used. Each target is its
own VNTR. What is a VNTR?
3.
Why would looking for the persons responsible for sneaking
endangered species (rare birds, for example) into the United States be
considered a job for a forensic scientist?
Questions and Comments?
PCR
(Polymerase Chain Reaction)
PCR – Polymerase Chain
Reaction has many applications
• PCR is commonly used to produce many copies
of a selected gene segment or locus of DNA.
• In criminal forensics, PCR is used to amplify
DNA evidence from small samples that may
have been left at a crime scene.
•
PCR can be used to amplify DNA for genetic
disease screening
The PCR
Reaction
How does
it work?
Heat (94oC) to denature DNA
strands
Cool (56oC) to anneal primers to
template
Warm (72oC) to activate Taq
polymerase, which extends
primers and replicates DNA
Repeat 40 cycles
PCR
1) 94 C: Denature DNA
2) 56 C: Anneal Primers to Template
3) 72 C: Activates Taq Polymerase
• Repeats 31 times
What is needed for PCR?
The PCR
Reaction
• Template - the DNA to be amplified
• Primers - 2 short specific pieces of DNA
whose sequence flanks the target
sequence
Forward
Reverse
What do •
you
•
need? •
Nucleotides - dATP, dCTP, dGTP, dTTP
Magnesium chloride - enzyme cofactor
Buffer - maintains pH & contains salt
• Taq DNA polymerase – thermophillic
enzyme from hot springs (Thermus
aquaticus)
What do we use?
•
•
•
•
•
•
•
•
•
•
•
•
•
•
Reagents and supplies
Equipment
and supplies
Genomic DNA sample (5 µL)
P-20 pipette and tips
Master mix I (10 µL/reaction)
Thermal cycler
2.5 µL 10x PCR buffer w/o MgCl2
0.5 µL dNTP’s (10 mM)
2.5 µL Forward primer (4pM/ µL)
2.5 µL Reverse primer (4pM/ µL)
0.15 µL Taq polymerase
1.85 µL ddH2O
Master mix II (10 µL/reaction)
0.75 µL MgCl2 (50 mM)
9.25 µL ddH2O
Expected Results of PCR-Example
1.
2.
3.
4.
Homozygous Alu +
Homozygous Alu –
Heterozygous
Marker
Expected Results