Issues in Biotechnology: The Way We Work With Life Dr. Albert P. Kausch life edu.us The Mechanics of DNA Lecture 6 Some More Techniques in Biotechnology © life_edu Issues in Biotechnology: The Way We Work With Life Dr. Albert P. Kausch Kimberly Nelson OnCampus Live BCH 190, MIC 190, AFS 190, NRS 190, PLS 190 OnLine BCH 190 A Sweeping General Survey on Life and Biotechnology A Public Access College Course The University of Rhode Island Issues in Biotechnology: Biotechnology, Our Society and Our Future life edu.us Issues in Biotechnology: The Way We Work With Life Dr. Albert P. Kausch Kimberly Nelson BCH 190 Section I. The Mechanics of Life and General Biotechnology Section II. The Applications of Biotechnology A Sweeping General Survey on Life and Biotechnology A Public Access College Course © life_edu The University of Rhode Island life edu.us Issues in Biotechnology: The Way We Work With Life Dr. Albert P. Kausch life edu.us The Mechanics of DNA 5. Trends, Patterns and Relationships in Biology 6. Some More Techniques in Biotechnology A Sweeping General Survey on Life and Biotechnology A Public Access College Course © life_edu The University of Rhode Island Issues in Biotechnology: The Way We Work With Life Dr. Albert P. Kausch life edu.us The Mechanics of DNA Lecture 6 Some More Techniques in Biotechnology © life_edu Are there any foods or ingredients that you have avoided or eaten less of? (A) (B) (C) (D) yes no do know refuse to answer 50 40 30 20 © life_edu 10 0 1 2 3 4 Half of consumers are avoiding some food/ingredient… Are there any foods or ingredients that you have avoided or eaten less of? 100% 80% 60% Don't know / refused No Yes 40% 20% A pr -0 3 Ja n04 M ar -0 5 2 ug -0 A -0 1 Se p Ja n- 01 0% © life_edu If yes, what foods or ingredients did you avoid or eat less of? Foods/ingredients avoided (A) (B) (C) (D) (E) sugar / carbohydrates fats / cholesterol animal products salt / spices biotechnology products 30 25 20 15 10 © life_edu 5 0 1 2 3 4 5 …it’s not biotech! If yes, what foods or ingredients did you avoid or eat less of? (Open-ended; Multiple responses allowed, n = 478) Foods/ingredients avoided 3/05 Sugar/Carbohydrates 58% Fats/Cholesterol 37% Animal Products 34% Salt/Spices 14% Snack Foods 11% Biotechnology <½% © life_edu IFIC 2005 FDA requires special labeling when a food is produced under certain conditions: when biotechnology’s use introduces an allergen or when it substantially changes the food’s nutritional content... Otherwise special labeling is not required. Would you say that you support or oppose this policy of FDA? (A) (B) (C) (D) (E) support oppose neither support or oppose don’t know refuse to answer 40 30 20 © life_edu 10 0 1 2 3 4 5 Current FDA labeling policy supported by majority FDA requires special labeling when a food is produced under certain conditions: when biotechnology’s use introduces an allergen or when it substantially changes the food’s nutritional content... Otherwise special labeling is not required. Would you say that you support or oppose this policy of FDA? 80% 70% 60% Don't know/refused 50% Neither support nor oppose 40% Total oppose 30% 20% 10% 19 9 Fe 7 b9 O 9 ct M 99 ay -0 Ja 0 n0 Se 1 p0 A 1 ug -0 A 2 pr -0 Ja 3 n0 M 4 ar -0 5 0% Total support It is now possible to clone any gene from any organism and move it into plants © life_edu Plasmids are circular pieces of DNA found in some bacteria Many copies per cell Antibiotic resistance gene Plasmids can be cut and pasted back together Foreign genes can be inserted © life_edu How is a gene cloned? Boyer, Cohen, and Berg, 1972 Enzymes were discovered that cut DNA at specific sequences And subsequently, enzymes were discovered that paste DNA together The ability to cut and paste DNA allowed gene cloning How is a gene cloned? Foreign DNA (gene) is inserted into a plasmid that has a gene for antibiotic resistance The plasmid is introduced into a bacterial cell and grown on the antibiotic Only bacteria with the plasmid grow…the inserted gene is copied many times Anatomy of a Transgene Promoter Coding Sequence Protein coding sequence Cell specificity Developmental specificity Start transcription Terminator Stop transcription Message stability Gene constructs can be moved into plants and the gene is expressed driven by the promoter sequence © life_edu Agricultural Biotechnology Genetically Modified Foods: Panacea Or Pandora’s Box? © life_edu Agricultural Biotechnology Genetically Modified Organisms GMO How is it done? It is now possible to clone any gene from any organism and move it into plants © life_edu A Success Story: Genetically Modified Salmon Constitutive expression of rainbow trout growth factor hormone All salmon shown are fourteen months old, those at the bottom are the controls Transgenic Atlantic salmon produced by Aqua Bounty Inc. Growth rate, not ultimate size is enhanced. Commercial production of Aqua Bounty salmon is being reviewed by FDA. First transgenic meat product. Would you order genetically modified salmon at a restaurant if you also had a choice of wild salmon? (A) (B) (C) (D) yes no doesn’t matter undecided 40 30 20 10 0 1 2 3 4 Tools and Techniques used in Biotechnology Gene transfer from one organism to another is not new Image of two species of bacteria transferring viral phage particles Bacteria transfer genes to other bacteria and plants Now in nature there is another organism capable of Transferring DNA: we call that organism a human being Gel Electrophoresis: the separation of molecules, DNA, RNA and proteins by charge and size Electro refers to the energy of electricity. Phoresis, from the Greek verb phoros, means “to carry across.” Thus, gel electrophoresis refers to the technique in which molecules are forced across a span of gel, motivated by an electrical current. Applications of Gel Electrophoresis • DNA Fingerprinting • DNA Recombinant Technology • Forensics • The Human Genome Project DNA carries a net negative charge; it is negatively charged because the phosphates (red circles) that form the sugar-phosphate backbone of a DNA molecule have a negative charge. As the separation process continues, the separation between the larger and smaller fragments increases. • Molecular weight markers are often electrophoresed with DNA. • Molecular weight markers are usually a mixture of DNAs with known molecular weights. • Molecular weight markers are used to estimate the sizes of DNA fragments in a DNA sample. The Techniques of Molecular Biotechnology Technology has created new Fields DNA detection DNA synthesis DNA sequencing DNA cloning Genomics Bioinformatics Pharmacogenomics Transgenics Expression cassette construction Computational Biology RNA detection Population Genetics Protein detection Proteomics Techniques of Molecular Biotechnology • Polymerase Chain Reaction • Southern Blot Analysis • Northern Blot Analysis • Western Blot Analysis • cDNA Library Construction • DNA Sequencing • Gene Isolation • Gene Vector Construction PCR PCR The Polymerase Chain Reaction PCR The Polymerase Chain Reaction You Leave a Piece of You Behind PCR was used on the “BLUE DRESS” and showed President Clinton's association with Monica Lewinsky. Polymerase Chain Reaction Nobel laureate in Chemistry, 1994 PCR is Amplification THERE ARE MILLIONS OF DIFFERENT GENES OR SEQUENCES WITHIN ANY DNA SAMPLE (BLOOD, TISSUE, PLANT, ETC.). A SPECIFIC SEQUENCE IS SELECTED TO BE AMPLIFIED (RED ABOVE). THIS SEQUENCE CAN BE ANY GENE OF INTEREST OR A NON-CODING MARKER REGION OF DNA. IN ORDER TO COPY THE SEQUENCE OR GENE, A SHORT SEQUENCE ON EITHER SIDE OF THE SECTION MUST BE KNOWN. THIS REGION (BLUE ABOVE) WILL SERVE AS A PRIMER ATTACHMENT SITE TO COPY THE DNA TARGET SEGMENT. IN ORDER TO AMPLIFY A SPECIFIC FRAGMENT OF DNA, SEVERAL THINGS ARE NEEDED, INCLUDING PRIMERS AND DNA POLYMERASE. AN ENZYME WHICH COPIES DNA, PRIMERS ARE SHORT PIECES OF DNA OR RNA DESIGNED TO PAIR WITH GENOMIC DNA AT A SPECIFIC ATTACHMENT SITE FOR THE MAIN PURPOSE OF HELPING THE DNA POLYMERASE BIND AT THE DESIRED SECTION. NUCLEOSIDE TRIPHOSPHATES, THE BUILDING BLOCKS OF DNA ARE ALSO NEEDED. EACH NUCLEOSIDE TRIPHOSPHATE CONSISTS OF: A BASE (ADENINE, THYMINE, CYTOSINE OR GUANINE). A SUGAR AND THREE PHOSPHATES. WITHOUT A SHORT PIECE OF DNA(OR RNA) TO ATTACH TO, DNA POLYMERASE CAN NOT COPY A DNA STRAND. PCR REQUIRES SEVERAL CYCLES OF AMPLIFICATION. EACH CYCLE CONSISTS OF THREE TEMPERATURE CHANGES. THE STARTING TEMPERATURE (95 C) SEPARATES THE DNA STRANDS. A LOWERED TEMPERATURE (50-60 C) ALLOWS PRIMERS TO BIND TO COMPLEMENTARY SEQUENCES IN THE DNA. A SLIGHTLY HIGHER TEMPERATURE (72 C) ALLOWS DNA POLYMERASE TO ATTACH TO THE PRIMERS AND COPY THE DNA STRANDS (EXTENSION). DNA STRANDS ARE SEPARATED BY HEATING @ 94o C. THE TEMPERATURE IS LOWERED TO 54oC TO ALLOW PRIMERS TO PAIR WITH COMPLEMENTARY DNA SEQUENCES. MAKING NEW DNA MOLECULES: DNA POLYMERASE ATTACHES TO THE PRIMERS @ 72 C. DNA POLYMERASE ADDS NUCLEOSIDE TRIPHOSPHATES TO THE PRIMERS TO COPY THE DNA STRANDS. COPYING IS COMPLETED FOR EACH STRAND. THE PROCESS IS REPEATED IN THE NEXT CYCLE. THE TEMPERATURE IS RAISED AGAIN TO SEPARATE THE DNA STRANDS. THE TEMPERATURE IS LOWERED TO ALLOW PRIMERS TO ANNEAL. DNA POLYMERASE ATTACHES TO THE PRIMERS AND DNA IS COPIED TO MAKE 4 STRANDS OF DNA. The stability of TAQ Polymerase allows for this amplification process through the three temperature changes. THE PROCESS OF COPYING DNA STRANDS IS REPEATED 32-35 TIMES. WITH EACH AMPLIFICATION CYCLE, THE NUMBER OF COPIES OF THE DNA SEQUENCE IS DOUBLED UNTIL MILLIONS OF COPIES HAVE BEEN MADE. Issues in Biotechnology A method used to copy small amounts of DNA many times over was invented by Dr. Kary Mullis in the 1980s and is called PCR. PCR stands for: (A) (B) (C) (D) (E) Protein Chromosomal Replication Polymerase Chain Reaction Pipetman California Reaction Peptide Catalytic Reactors Polysaccharide Catalyst Repair 70 60 50 40 30 20 10 0 1 2 3 4 5 Forensic applications of DNA based technologies • Fingerprinting OJ Simpson • Identification • Paternity • Crime Solving • World wide data base Forensic Identification: Basic Principles Each of us is genetically unique If enough genetic variation is tested, each of us can be uniquely identified DNA is found in nearly all cells (blood, semen, hair, etc.) DNA from an evidentiary sample can be matched with DNA from a suspect to implicate or exonerate STRs Are Used in Identity Testing “Short Tandem Repeat sequence” ...atatatacaacttactaccatata ccgattacgatcgaattataccgcgga cgtagtaatgacgatgaagtaactata tatatatatatatatatatatatatat atatatatatatatatatatatatata tatatatatatatatatatatatatat atatatatatatatatatatatatata tatatatatatatatatatatatatat atatatatatatatatatatatatata tatatatatatatatatatatatatat atactacctaccagggaggagata... Laboratory PCR Instrument INPUT: Sample DNA, PCR enzymes, primers, individual nucleotide building blocks (and maybe fluorescent labels) OUTPUT: Specific DNA fragments amplified millions of times for easy visualization With sizes that vary between individuals After PCR, DNA Fragments are Separated on a Gel PCR products for each sample DNA fragments move through gel based on their size - TIME 45 180 40 170 35 160 30 150 25 140 20 130 15 120 10 110 5 + Minutes 100 Fragment Size Identity Testing Using PCR Analysis of four different sections of the DNA Possible conclusions: S = size standards V = victim’s DNA 1 = suspect #1 blood 2 = suspect #2 blood 3 = suspect #3 blood E = evidence #1 S = size standards A. Suspect 1 DNA was at the scene B. Suspect 2 DNA was at the scene C. Suspect 3 DNA was at the scene D. None were at the scene E. Multiple suspects were at the scene F. Data is inconclusive S V 1 S = size standards V = victim’s DNA 1 = suspect #1 blood 2 = suspect #2 blood 3 = suspect #3 blood E = evidence #1 S = size standards 2 3 E S 450 400 350 300 250 200 150 100 50 A complete match! PCR was used on the “BLUE DRESS” and showed President Clinton's association with Monica Lewinsky. Issues in Biotechnology DNA tests exclude Martin from gun grip in Zimmerman case September 19, 2012 Another round of evidence was released Wednesday in the second-degree murder case against George Zimmerman, including forensic tests that show Zimmerman’s DNA was the only one that could be identified on the grip of the gun used to shoot 17-year-old Trayvon Martin. Zimmerman’s DNA also was identified on the gun’s holster. The tests were inconclusive as to whether Martin’s DNA was on the gun’s holster. Congratulations!!!!! $100,000.00!!!!!!! You have To Invest in Biotech. Issues in Biotechnology Stock Project The idea is to select five biotechnology companies and invest $100,000 (fictitiously, of course) Issues in Biotechnology Stock Project You can spread your money evenly across five companies (i.e. $20,000 each) or not. For example, if a company is trading at $20/share you can purchase 1,000 shares for $20, 000. Look up companies on Google (e.g.: type Monsanto stock) and record their stock ticker designation (e.g.. MON of the New York Stock Exchange, NYSE). Observe their performance over the past year. Record current trading price per share and calculate how many shares you can buy. You must choose your companies and the number of shares. Submit a single page summary on these results. Toward the end of the course you will look up these same companies and determine the cost per share at that time. Calculate your losses or gains for each company and your total losses and gains. This project will be summarized at the end of the course in a one page summary of losses and gains. Biotechnology Stocks Project Congratulations!!!!! $100,000.00!!!!!!! You have To Invest in Biotech. 1. Select and Research five Biotech companies. 2. Print and submit the current stock quote and for each company. 3. Invest chosen amounts in each. Calculate the number of shares in each (Submit a One page summary). 4. Contact company to receive investors information (Optional). 5. Monitor Stock during the course. 6. Calculate gains and losses. Submit report with final exam. Biotechnology and Industry “In retrospect, recombinant-DNA may rank as the safest revolutionary technology ever developed.” - James D. Watson, Nobel Prize Winner, 1953 The Development of Biotechnology is directly linked with Industry The application of the biological sciences has moved from academia to the private sector Driven by profits and the promise of profits The distinction between Basic and Applied Science is blurred Basic science is immediately applied in today’s biotech Biotech Industry Red vs Green companies pharmaceuticals vs agriculture (blood vs chlorophyll) Information Sciences Genomics Proteomics Phenomics Bioinformatics Population Genetics Clinical trials The Role of Companies in the Development of Biotechnology Technology Development Patents Markets and Products Market-driven Innovation Genomics Companies Celera Incyte Genome Therapeutics Corp Millenium Paradigm Genetics DuPont Genaissance Monsanto Technology Companies Invitrogen Stratagene Qiagen Packard PE Biosystems Kairos BioRobotics Biotechnology Industry Advertisement of services in international journals NATURE Science Nature Biotechnology “Picks and shovels for the Gold Rush” Innovative technologies become biotech products Big money in licenses Commercialization of biotech products requires Freedom to Operate (FTO) with all the technologies used And look at the ads! BioBelt Home Corporate Responsibility Who We Are Our Pledge Our Pledge Business Conduct Our Locations Corporate Governance Company Leadership Stewardship Company History Corporate Giving Contact Us Youth and Education Our Products Diversity Leading Brands Investors Seeds & Traits Corporate Profile Agricultural Productivity Stock Performance Product Pipeline Presentations & Financial Reports Benefits of Our Products Calendar of Events Technical & Safety Info Contact & Shareholder Info News & Media Careers News Releases Getting Started RSS & Email Subscriptions U.S. Job Opportunities Monsanto in the News International Job Opportunities Key Contacts Benefits & Rewards Calendar of Events Career Development Press Kit & Multimedia Diversity Executive Forum Monsanto is an agricultural company. We apply innovation and technology to help farmers around the world be successful, produce healthier foods, better animal feeds and more fiber, while also reducing agriculture's impact on our environment. » View Biotechnology Videos Roundup RReady2Yield™ Soybeans — Another Step Closer to Farmers' Fields Read More 2007 Farm Progress Show — “Road to Success” — Monsanto Technology Showcase Read More » View Biotechnology Videos Roundup RReady2Yield™ Soybeans — Another Step Closer to Farmers’ Fields Read More 2007 Farm Progress Show — “Road to Success” — Monsanto Technology Showcase Read More Delta & Pine Land — Monsanto Company Begins Combining Delta & Pine Land Business Read More Featured Story $21 Million Data Center Completed High-tech center will provide global IT support for Monsanto’s growing data analysis needs Read More View All Featured Stories Recent News Mon, 17 Sep 2007 — Monsanto Increases Ongoing Earnings Per Share Guidance, Provides Free Cash Flow Guidance For Fiscal Year 2007 Fri, 14 Sep 2007 — Monsanto, Dow Agreement Paves the Way for Industry’s First-Ever, Eight-Gene Stacked Offering in Corn Thu, 13 Sep 2007 — Monsanto to Provide Information to Iowa Attorney General Concerning Seed, Trait and Chemistry Business Agricultural Biotechnology Stock Price Stock Chart | Annual Report Stock Price Monsanto 89.79 (MON) Dow Jones 13,451.41 (DJIA) -0.66 -6.14Stock Chart | Annual Report Pharmaceutical Biotechnology NYSE: PFE 0.09 24.93 Stock Quote at: Sep 26 2012 12:22PM Change 0.09 Vol 12,802,922 Day High 24.99 52 Wk. High 25.15 Day Low 24.79 52 Wk. Low 17.05 Open 24.91 Mkt. Cap(Bil)186.21 Prev Close 24.84 Stock Symbol: PFE Stock Exchange: NYSE Stock Price Stock Chart | Annual Report Biotechnology Stock Project Example Report 1 Henrietta Lack Student’s Name PLS 190 Issues in Biotechnology Professor Albert Kausch Due Date 10-03-2012 Biotechnology Company 1. Intel Corporation (INTC) $22.05 per share / 900 shares = $19,845 2. Amgen (AGN)$55.66 per share / 350 shares = $19,481 3. Pfizer (PFE) $14.78 per share / 1,500 shares = $22,170 4. Apple Inc. (AAPL) $413.81 per share / $18,621 5. General Electric (GE) $15.38 per share / 1,292 shares = $19,870.96 Total = $99,987.96 Biotechnology Stock Project Example Report 1 Student’s Name Jack Straw BCH 190 Issues in Biotechnology Professor Albert Kausch Date Due October 3, 2012 Biotechnology Company Amgem Inc. AMGN: 56.04 per share 356 shares for $20,000 Pfizer Inc PFE: 17.84 per shares 1121 shares for $20,000 Monsanto Co MON: 65.86 per share 303 shares for $20,000 Bio Rad Laboratories Inc BIO: 89.50 per share 223 shares for $20,000 Syngenta AG SVJ: 205.30 Euros per share 71 shares for 14567.49 Euro or $20,000 Total; $100,000 Biotechnology Companies: AstraZeneca Active Motif Aventis Adventa Celera PE Incyte Invitrogen Pfizer Merck Smith Kline Beecham Novartis Monsanto Qiagen Roche Paradigm Genetics Chemicon International Trevigen Avigen Metabasis Therapeutics Pintex Pharmaceuticals BioGen Garst Pioneer DuPont Pharmacia Bristol-Myers Squibb Eli Lilly Cistem Molecular Corp. Operon Technologies Biotechnology Companies: DNX Transgenic Sciences Chemdex MWGAG BIOTECH Double Twist Larova Biochemie Greiner Labortechnik Sungene Molecular Devices Corp. Evotec BioSystems AG BIACORE TIB MOLBIOL PE Biosystems Bruker Daltonics Inc. Eppendorf Scientific Curagen Cargill Dow Agri Sciences Dow Chemical Co. AmGen Bayer Dynal Noxxon Pharma Schering Boehringer Rhein Biotech Hyseq Genome Therapeutics O sweet spontaneous earth how often have the doting fingers of purient philosophers pinched and poked thee, has the naughty thumb of science prodded thy beauty how often have religions taken thee upon their scraggy knees squeezing and buffeting thee that thou mightest conceive gods (but true to the incomparable couch of death thy rhythmic lover thou answerest them only with spring) e.e. cummings 20. Of the following techniques, which would be most unlikely to be used in a biotechnology laboratory? (A) (B) (C) (D) (E) gel electrophoresis PCR DNA cloning use of the Hubble telescope antibiotic resistant bacteria 21. Many of the molecular reactions used in biotechnology occur in volumes less than a milliliter. A Pipetman is: (A) the new biomedical device made by tissue engineering and now used to treat the damaged blood vessels of heart attack victims (B) a radical group of bioengineered superheroes in the Hollywood movie GATTACCA (C) a molecular biology tool used in the lab to measure small volumes of liquid (D) a new type of bio-engineered crop plants that are drought tolerant (E) a new surgical tool used in to extract cancer cells 22. Gel Electrophoresis is used for: (A) the separation of molecules, DNA, RNA and proteins by charge and size (B) separation of various cell types in blood samples (C) viewing cells at a high magnification (D) as a home pregnancy test (E) fusing cells during the process for cloning animals 23. Every time a cell divides it copies all of its DNA. A method used commonly in many applications of biotechnology today is called PCR. PCR: (A) is used to study life on other planets (B) stands for the PolyChromal Repercussions that occur in cell division (C) is a type of digital processing used in DNA sequencing (D) uses a heat stable DNA polymerase to copy DNA (E) is a dangerous prescription drug 24. Basic Forensic principles include: (A) each of us is genetically unique (B) if enough genetic variation is tested, each of us can be uniquely identified (C) DNA is found in nearly all cells (blood, semen, hair, etc.) (D) DNA from an evidentiary sample can be matched with DNA from a suspect to implicate or exonerate (E) all of the above 25. Given DNA samples from three suspects, the victims DNA and DNA evidence from a crime scene the possible conclusions are: (A) suspect 1’s DNA was at the scene; or suspect 2’s DNA was at the scene; or suspect 3’s DNA was at the scene (B) none were at the scene (C) multiple suspects were at the scene (D) data are inconclusive (E) any of the above 26. A method used to copy small amounts of DNA many times over was invented by Dr. Kary Mullis in the 1980s and is called PCR. PCR stands for: (A) (B) (C) (D) (E) Protein Chromosomal Replication Polymerase Chain Reaction Pipetman California Reaction Peptide Catalytic Reactors Polysaccharide Catalyst Repair 27. STR stand for: (A) (B) (C) (D) (E) Separation of Trans Replicators Scientists for True Religion Short Tandem Repeats Standard Test for Recidivism Seek To Reach assay 28. The development of Biotechnology is directly linked with Industry. Which of the following is not true? (A) the application of the biological sciences has largely moved from academia to the private sector (B) the application of biotechnology is driven by profits and the promise of profits (C) the distinction between Basic and Applied Science is often blurred (D) Basic Science is nearly immediately applied in today’s biotech fields (E) Basic Science has not yet applied in any of today’s biotech fields 29. The development of Biotechnology is: (A) (B) (C) (D) (E) driven by application has been banned in Europe by governments in the EU has disproven the Theory of Evolution destroying medicine as we know it finally leveling off 30. The process of creating genetically modified organisms (GMOs): (A) has been applied to salmon (B) has been applied to crop plants (C) has not been commercialized for beef (D) has been not demonstrated in peer review journals to cause health issues (E) all of the answers shown are correct