DNA based markers to characterize insect pest damage: diagnostic trials
on Leptoglossus occidentalis (Hemiptera: Coreidae)
Matteo Bracalini, Matteo Cerboneschi , Francesco Croci,
Tiziana Panzavolta , Riziero Tiberi , Stefania Tegli
Department of Agri-Food Production and Environmental Sciences (DISPAA) University of Florence, Italy
INTRODUCTION
The western conifer seed bug (WCSB) Leptoglossus occidentalis Heidemann (Hemiptera:
Coreidae) was accidentally introduced in Italy in 1999 then it spread to most of Europe
within a decade (Figure 1). Known as a pest of coniferous tree seed orchards in North
America, it may also play a role in stone pine conelet abortion and abscission for North
American conifers [1]. For this reason it is also considered to be a major factor in the
losses of stone pine (Pinus pinea L.) nut production in the Mediterranean region [2],
however more research is needed regarding the WCSB impact on stone pine fructification
in Europe, since all known WCSB diagnostic tools refer to North American conifers and may
be ineffective on stone pine.
End point PCR
The primer pair LeptoF/LeptoR was designed according to the WSCB COI sequence
available on GenBank (Accession N° JQ996145.2), using Beacon Designer 7.5 software
(Table 2). First, the primers were tested on PCR assays carried out using as template
genomic DNA from WCSB specimens from all four sites (A, B, C, D). The primer specificity
was assessed using as putative negative controls the genomic DNA of the 5 abovementioned insect control species, as well as stone pine DNA. The sensitivity of this PCRbased protocol was also evaluated, using as template (2 µl/25 µl reaction) different
amounts of WCSB DNA (from 100 pg to 10 fg/µl). The presence of WCSB DNA inside its
saliva was also verified by this PCR assay.
HRM analysis
The primer pair LeptoRTF/LeptoRTR was also designed on a WCSB COI sequence
(Accession N° JQ996145.2), expected to produce a shorter amplicon (171 bp), and to be
used in Real Time PCR. Melting curves of PCR amplicons were obtained with temperatures
ranging from 60°C to 95°C. Data acquisition was performed for every 0.2°C increase in
temperature, with a 10 s step. Each sample was tested in three independent experiments,
and analyzed by High-Resolution Melting (HRM) analysis software (Bio-Rad Laboratories,
Inc.), which automatically clusters the samples according to their melting profiles and
assigns a confidence score to each sample. The confidence level threshold for a sample to
be included in a cluster was 99.5%. Amplicon specificity was evaluated on WCSB DNA as
template, on DNA from the 5 control species, and from stone pine. Sensitivity was assessed
by Real Time PCR, using as template (2 µl/25 µl reaction) different amounts of WCSB DNA
(from 100 pg to 1 fg/µl), in presence or not of spiked stone pine DNA. As cycle threshold
we referred to water (negative control), taking into account its 35 cycles above which
amplification was not considered as reliable.
Staining, radiographic and biochemichal techniques
have been used to assess WCSB damage to seeds of North
American conifers [3-5]. However, the specificity of these
techniques is questionable. For instance, a polyclonal
antibody raised against salivary glands extracted from
the WCSB detects the presence of residual salivary
proteins in attacked seeds of several American conifers
[6-8], but it gave positive results also with seeds fed on
by another hemipteran (Leptoglossus corculus Say) [9].
These techniques have never been tested on stone pine
seeds, nor have found application for the stone pine in
Europe yet. Hence, a specific diagnostic tool to assess
WCSB damage on stone pine fructification is still to be
implemented, in the efforts of monitoring this pest as
well as evaluating future control programs.
Figure 1 – Adult of the Western
Conifer Seed Bug (WCSB),
Leptoglossus occidentalis Heidemann.
OBJECTIVES
Based on the assumption that WCSB DNA may be present in salivary residues inside
attacked tissues, a PCR-based approach was set up having as a target the available
WCSB COI nucleotid sequences. The WCSB molecular detection is essential to
specifically ascertain the damage occurring on stone pine cones and seeds, and caused
by this pest. This study would thus contribute to widen the spectrum of DNA barcoding
applications in entomology.
The aim of this study was to develop highly specific PCR-based methods for the
sensitive detection of WCSB DNA, whose efficacy as a diagnostic on WCSB attacked
stone pine seeds was here assessed as well.
In planta assays
Diagnostic trials were carried out using both WCSB specific primer pairs to detect traces
of WCSB DNA in attacked stone pine seeds. PCR samples included the DNA extracted from
seeds fed on by the WCSB during force-feeding sessions. As control DNA extracted from
sound seeds was used. Moreover, DNA samples were also extracted from seeds externally
contaminated with WCSB excrements.
RESULTS AND DISCUSSION
MATERIAL AND METHODS
Specimens
DNA from several WCSB specimens, as well as that from other control species, was
extracted. WCSB adult specimens were collected in four areas as reported in Table 1.
WCSB laboratory rearings were established to provide constant availability of specimens to
be used during force feeding sessions. Five other insect species were used as negative
control: Palomena prasina (L.) (Hemiptera, Pentatomidae, Pentatominae), Ernobius
impressithorax Pic, Ernobius parens (Mulsant and Rey) (Coleoptera, Ptinidae, Ernobinae),
Pissodes validirostris (Sahlberg) (Coleoptera, Curculionidae, Molytinae), and Dioryctria
mendacella (Staudinger) (Lepidoptera, Pyralidae, Phycitinae).
Force feeding
Stone pine seed samples (10 mg each) were supplied to WCSB adults, during forcefeeding sessions in the laboratory. At the end of each session, seed samples were
collected, distinguished in two categories (sound and pierced), and finally stored
separately at –20°C. In addition, seed samples contaminated by WCSB excrements were
also separately collected and stored.
Molecular biology techniques
Genomic DNA was obtained from insect and seed tissues using the Puregene® Solid
Tissue protocol (Gentra Systems Inc., Minneapolis, Minn.). Hind femora and/or thorax were
used to extract DNA from larger adult insects (WCSB, P. validirostris, P. prasina), while
whole specimens were used for adults of Ernobius and D. mendacella. Liquid saliva was
extracted from WCSB live specimens, using a parasympathomimetic drug [10].
PCR amplicons were purified from agarose gel using NucleoSpin® Gel and PCR Clean-up
kit (Macherey-Nagel GmbH & Co, Düren, Germany), and cloned with InsTAclone® PCR
Cloning Kit (Thermo Fisher Scientific, Inc.). Sequencing was performed by Eurofins MWG
Biotech, Ebersberg, Germany.
Sampling area
A
B
C
D
Coordinates
N 43°47'15", E 11°44'33"
N 44°03'32", E 10°54'59"
N 45°50'17", E 11°49'46"
N 47°33'30", E 21°38'22"
Region
Country
Tuscany
Tuscany
Veneto
Hajdú-Bihar
Italy
Italy
Italy
Hungary
1000 bp
500 bp
Figure 2 – Specificity test using COI PCR primers. Lanes: R)
Ruler; 1) Sound stone pine seed; 2-6) control insect species;
7-10) WCSB from site A, B, C, D; 11) Water; 12) Laboratory
reared WCSB.
Figure 3 – Sensitivity test on COI PCR
primers, using as template (2 µl/25 µl
reaction) different amounts/µl of WCSB
DNA. Lanes: R) Ruler; 1) 100 pg; 2) 10 pg;
3) 1 pg; 4) 100 fg; 5) 10 fg; 6) Water.
The primer pair LeptoF-LeptoR proved to be a specific molecular marker for WCSB DNA.
Amplicons of the expected length (658 bp) were obtained only when WCSB DNA was used as
template in PCR tests. In no case DNA from other species, from both stone pine and the
five control insects, interfered with the primers (Figure 2). Concerning sensitivity, the
theoretical threshold was verified to be as low as 100 fg/µl WCSB DNA (Figure 3). The
presence of WCSB DNA in its saliva was confirmed by positive results in PCR reactions
(Figure 4), although WSCB genomic DNA extracted from its saliva and used as template
could not be observed on electrophoretic gel images.
The primer pair LeptoRTF-LeptoRTR also proved to be a specific molecular marker for
WCSB DNA, and no aspecific signals were obtained using the other five insect species and
stone pine DNA. Real Time PCR resulted ten times more sensitive in amplifying WCSB DNA
(threshold of 10 fg/µl) (data not shown). Moreover, sensitivity did not vary whether or not
stone pine DNA was added as a spike to WCSB DNA. Furthermore, HRM analysis underlined
some differences among WCSB DNA samples. More specifically, WCSB samples from all but
one site (Site B) clustered during HRMA melting profiling (Figure 6). Sequencing verified
these results, showing three SNPs differing among obtained clusters (data not shown).
1000 bp
1000 bp
Table 1 – Details of sampling areas for WCSB specimens.
500 bp
Primer name
LeptoF
LeptoR
LeptoRTF
LeptoRTR
Sequence (5’-3’)
TACCCTTTACTTTATTTTTG
AAATAAATGCTGATATAAAATAG
AGAAGAAGTAGAAGTGCTGTAATACC
AGCCTCTGTTGATTTAGCCATT
Amplicon Lenght (bp)
Accession N°
658
JQ996145.2
171
JQ996145.2
Table 2 – Primers designed and used in this study.
RESEARCH POSTER PRESENTATION DESIGN © 2012
www.PosterPresentations.com
Figure 6 – Difference plot obtained in
HRM assay, performed in three
replicates using the LeptoRTF/LeptoRTR
primer pair on WCSB DNA samples from
all sites. Green cluster: Site A, C, and D;
red cluster: Site B.
RFU: Relative Fluorescence Units.
500 bp
Figure 4 – WCSB DNA detected inside
the insect’s liquid saliva. Lanes: R)
Ruler; 1) WCSB saliva; 2) Water; 3)
WCSB specimen.
Figure 5 – Diagnostic test on Stone pine seeds using
COI PCR primers. Lanes: R) Ruler; 1) Sound seed; 2)
WCSB Attacked seed; 3) Seed contaminated by WCSB
excrements; 4) WCSB DNA; 5) Water.
Figure 7 – Melting temperature
analysis performed using the
LeptoRTF/LeptoRTR primer pair on
genomic WCSB DNA (green curve)
and seed samples: seed
contaminated with WCSB excrements
(red), seed fed upon by the WCSB
(blue), sound seed (pink).
End Point PCR failed to detect WCSB DNA in attacked seed samples (Figure 5). However,
this protocol allowed to identify all seed samples which were contaminated with WCSB
excrements. Similarly, Real Time PCR could not unequivocally detect WCSB DNA in attacked
seed samples. In fact, DNA from both sound and WSCB attacked seeds gave amplification
signals over the 35th cycle, though the sound seed showed a different melting temperature
when compared with the other samples (Figure 7). This difference in melting temperatures
needs to be more deeply investigated in order to definitely assess its diagnostic value.
Once again, seeds stained with WCSB excrements showed enough WCSB DNA content to
give significant and specific Real Time PCR signals (Figure 7).
CONCLUSIONS
An effective diagnostic tool is still needed to help assessing the role of the WCSB in
the loss of stone pine nut production. Since some conelet mortality as well as loss of
seed set can also be due to natural causes an effective diagnostic marker is necessary
to discern the real percentage of fructification specifically damaged by the WCSB.
Both primer pairs implemented during this study showed high specificity. In fact, only
WCSB COI DNA was targeted by the primers, never interfering with other DNAs
extracted from pine cone-associated insects. No interference occurred even when the
DNA from P. prasina was used to test marker specificity (i.e. the species most closely
related to the WCSB among those we used as controls, and occasionally observed
feeding on pine cones during our field samplings).
End Point PCR sensitivity of 100 fg/µl was enough to confirm our hypothesis that
WCSB DNA could be detected inside the insect saliva. However, End Point PCR was not
able to identify seed samples fed on by the WCSB. Even the higher sensitivity granted
by the Real Time PCR (10 fg/µl) was not enough to unambiguously detect WCSB DNA
into attacked seed samples. However, our markers granted the identification of all
seed samples contaminated with WCSB excrements. Thus, the sensitivity of our DNA
based markers may find other applications in identifying, surveying, and monitoring of
the WCSB. For example, these diagnostic tools could be applied in seed storages to
verify the presence of the WCSB by detecting small insect traces on harvest samples,
thus assessing also its abundance. Moreover, this study showed for the first time how
DNA barcoding knowledge can be useful in pest diagnostics, even when only insect
excrements are available.
Finally, our study revealed how HRMA can be a promising tool for detecting
intraspecific differences among insect populations. In fact, our methodology may find
applications in phylogenetics, allowing preliminary screening of DNA samples from
different populations, even before sequencing.
REFERENCES
[1] Bates S. L., Strong W. B., Borden J. H., 2002b. Abortion and seed set in lodgepole and western white pine
conelets following feeding by Leptoglossus occidentalis (Heteroptera: Coreidae). Environmental Entomology, 31:
1023-1029.
[2] Bracalini M., Benedettelli S., Croci F., Terreni P., Tiberi R., Panzavolta P., 2013. Cone and Seed Pests of Pinus
pinea: Assessment and Characterization of Damage. Journal of Economic Entomology, 106: 229-234.
[3] Campbell B. C., Shea P. J., 1990. A simple technique for assessing feeding damage by Leptoglossus occidentalis
Heidemann (Hemiptera: Coreidae) on cones. The Canadian Entomologist, 122: 963-968.
[4] Schowalter T. D., Sexton J. M., 1990. Effect of Leptoglossus occidentalis Heidemann (Hemiptera: Coreidae) on
seed development of Douglas-fir at different times during the growing season in western Oregon. Journal of
Economic Entomology, 83: 1485-1486.
[5] Bates S. L., Borden J. H., Kermode A. R., Bennet R. G., 2000. Impact of Leptoglossus occidentalis Heidemann
(Hemiptera: Coreidae) on Douglas-fir seed production. Journal of Economic Entomology, 93: 1444-1451.
[6] Lait C. G., Bates S. L., Kermode A. R., Morrisette K. K., Borden J. H., 2001. Specific biochemical marker-based
techniques for the identification of damage to Douglas-fir seed resulting from feeding by the western conifer seed
bug, Leptoglossus occidentalis Heidemann (Hemiptera: Coreidae). Insect Biochemistry and Molecular Biology, 31:
739-746
[7] Lait C. G., Bates S. L., Morrissette K. K., Kermode A. R., Borden J. H., 2001. Biochemical assays for identifying
seeds of lodgepole pine and other conifers, that were fed on by Leptoglossus occidentalis Heidemann (Hemiptera:
Coreidae). Canadian Journal of Botany, 79: 1349-1357.
[8] Bates S. L., Lait C. G., Borden J. H., Kermode A. R., 2002. Measuring the impact of Leptoglossus occidentalis
(Heteroptera: Coreidae) on seed production in lodgepole pine using an antibody-based assay. Journal of Economic
Entomology, 95: 770-777.
[9] Lait C. G., Miller D. R:, Bates S. L., Borden J. H., Kermode A. R., 2003. Biochemical assay detects feeding
damage to loblolly pine seeds by the Leaffooted pine seed bug (Hemiptera: Coreidae). Journal of Entomological
Science, 38: 644-653.
[10] Madhusadhan V. V., Taylor G. S., Miles P. W., 1994. The detection of salivary enzymes of ohytophagous
Hemiptera: a compilation of methods. Annals of Applied Biology, 124: 405-412.
Ward R. D., Zemlak T. S., Innes B. H., Last P. R., Hebert, P. D. N., 2005. DNA barcoding Australia's fish species.
Philosophical Transactions of the Royal Society B: Biological Sciences, 360: 1847-1857.
CONTACT
matteo.bracalini@unifi.it