Chapter 12
The Structure of DNA
DNA the Genetic Carrier!
• Now, thanks to Griffith, Avery, Hershey
and Chase’s experiment Biologists are
equipped with the knowledge that DNA
carries genetic information.
• Biologist hoped to understand genetics
better if they understood the structure of
DNA.
• There was a new race against time and
other Biologist to discover the structure of
DNA
Watson & Crick
• Watson & Crick were credited with
discovering the structure of DNA.
• They determined that DNA was a
molecule in the shape of a double helix.
• Double helix – Two strands wrapped
around each other like a winding staircase.
• DNA is a Nucleic acid which means that it
is made of…
Nucleotides!
Watson & Crick’s “Helpers”
• Watson & Crick were in a race with other
biologists to come up with the structure of DNA.
It was kind of like finding a cure for a deadly
disease.
• But Watson and Crick were “helped” by two
people. Maurice Wilkins and Rosalind Franklin.
“Photo 51”
Nucleotides
• The Nucleotides of DNA are made of three
parts.
Phosphate Group
Sugar (deoxyribose)
One of four Nitrogen Bases
Adenine
Guanine
Cytosine
Thymine
The Structure of DNA
• The backbone of DNA is made of alternating
Phosphate groups and Pentose Sugars.
• The “rungs” of the ladder are made of one of the
four different Nitrogenous bases.
Erwin Chargaff
• The number of Adenine molecules was
always equal to the number of Thymine
molecules
• The number of Guanine molecules was
always equal to the number of Cytosine
molecules.
• However The numbers of Guanine &
Thymine and the numbers of Cytosine &
Adenine were independent of each other.
Chargaff continued
• 1345 Adenine = 1345 Thymine
• 14 Cytosine = ? Adenine
• This lead the scientific community to believe
that Adenine & Thymine pair up with each
other as well as Cytosine & Guanine. This
became known as the base-pairing rule.
• The two strands are complementary to each
other. That means the sequence of bases on
one strand determines the sequence on the
other.
Notice that Thymine & Adenine form two Hydrogen
bonds whereas Guanine & Cytosine make three.
The Nitrogenous Bases
• Guanine and Adenine are known as
Purines. Purines are made of 2 rings.
• Thymine and Cytosine are known as
Pyrimidines. Pyrimidines are made of 1
ring.
Write the complimentary base
pairs for the following template.
AGCTATTGGCACCGGGCTATTAATTCCG
Class Size DNA Project!
• Create two nucleotides of your own
• As a class, make a DNA strand with the
following code:
• AAGTGCCTAGCTCAGGTACTGA
• Hint: Figure out the complementary strand
first!