Germplasm collection and characterization in tomatillo (Physalis philadelphica Lam.) Todd Vision Department of Biology University of North Carolina at Chapel Hill, USA Solanaceae in North Carolina Tomatillo (Physalis philadelphica Lam.) • Annual • Self-incompatible • Fruit enclosed by a papery calyx • Native to Mexico • Diploid (n=12) from Hernández Bermejo and León 1994 Ethnobotany of tomatillo • Culinary uses • Salsa verde (usually with Capsicum) • Infusion of calyx to make tamale dough • Medicinal uses • Leaves and fruits for headaches and stomachaches • Juice for sore throats • Cooked calyx for diabetes Economic importance • Cultivation mostly in Mexico and Guatemala • In Mexico • Fifth most important vegetable • > 25,000 Ha cultivated/yr • Elsewhere • Equal importance in Guatemala • Used by growing Mexican population in U.S.A. (esp. California) • Used internationally in haute cuisine Phylogeny of Solanaceae Petunia, Brunfelsia Nicotianeae (Nicotiana) Anthocercideae Jaboroseae Nolanea Lycieae Hyoscyameae Nicandreae Datureae Solaneae (Solanum) Capsiceae (Capsicum) Physaleae (Physalis) Solandreae Mandragoreae From Olmstead et al. 1999 Solanaceae IV M. Whitson (2002) Two-gene phylogeny of the Physalinae rbcL and ITS Leucophysalis viscosa Brachistus spp., Witheringia spp. Tzetalia spp P. alkekengi (Chinese lantern) Ocryctes spp, Leucophysalis nana, L. grandiflora P. microphysa P. arborescens Quincula lobata Chamaesaracha spp. P. crassifolia, P. acutifolia Margaranthus New World clade P. philadelphica (tomatillo) P. microcarpa, P. ignota, P. cordata, P. lagascae, P. pruinosa, P. angulata, P. pubescens P. nicandroides, P. peruviana (uchua), P. chenopodifolia, P. coztomatl, P. sordida, P. hederifolia, P. glutinosa, P. longifolia, P. greenmanii, P. caudella U.S. perennials P. minima, P. lanceolata, P. hetrophylla, P. virginina, P. arenic P. pumila, P. mollis, P. viscosa, P. cinerascens, P. angus P. walteri Nomenclature • Physalis philadelphica Lam. (= P. ixocarpa Brot.) • tomate from Nahuatl ayacach tomatl meaning berry • Local names: • • • • • miltomate (Oaxaca) tomate verde (Jalisco) tomatillo (Jalisco, Oaxaca, Puebla) tomate de cascara (Jalisco, Puebla, Oaxaca, Chiapas) tomate de hoja (Jalisco, Puebla) • tomate de milpa, or miltomate, from its association with maize fields Domestication • Cultivation is ancient • Remains in the Valley of Tehuacán in Puebla • Gradient of cultivation still visible • But few modern cultivars • Primitive features of landraces • • • • Self-incompatibility Indeterminate growth Nonsynchronous ripening Fruit drop • Lack of clear wild relative Fruit size variation Classification of varieties • Work of Santaguillo Hernández and Peña Lomelí (Universidad Autónoma Chapingo) • Mostly morphological • Some molecular (AFLP) evidence • Three most important varieties • Rendidora (central and southern Mexico) • Salamanca (Guatemala) • Tamazula (in western Mexico) variety habit fruiting yield fruit fruit color calyx color Rendidora crawling early high medium lemon green green Salamanca erect late mediu m large deep green clear green Tamazula erect early mediu m medium purple green to purple Puebla verde crawling to semierect early mediu m large green green with purple veins Manzano crawling to semierect late mediu m large orange green Arandas erect early low small to medium green to purple green to purple Milpero cultivado crawling to erect late very low very small green to purple green purple Milpero no cultivatado crawling to erect late very low very small green, yellow, purple green to purple SF1 Chapingo crawling to semierect very early very high medium lemon green green Summary of Hudson work • Self-incompatibility and crossability • Model of domestication Germplasm conservation 2002 Collecting Expedition Sponsored by USDA Plant Exchange Office Maria Chacon and Todd Vision University of North Carolina Ofelia Vargas Ponce Universidad de Guadalajara Larry Robertson USDA-ARS Aureliano Peña Lomelí Universidad Autónoma Chapingo Andrew Jarvis CIAT Existing collections MEXICO seedbank herbarium both Jalisco Michoacan Puebla Guerrero Oaxaca Chiapas Predicted priorities from FloraMap Sources of collection • • • • • • Undisturbed vegetation (none) Disturbed vegetation Tomatillo fields Other fields (maize) Traditional markets Farmer’s seed stock Classification of collections • Uncultivated • From undisturbed or disturbed habitat, or a weed in a field occupied by other crops (maize) • Incipient domesticate • Casually but intentionally cultivated in fields devoted to other crops (maize) • Landrace • Cultivated for self-consumption or sale at a local market • Escape • Resembling a landrace but not found in a cultivated field 2002 collections Jalisco Puebla Michoacán Guerrero Oaxaca uncultivated incipient domesticate escape landrace Chiapas 2002 collections State Chiapas Guerrero Hidalgo Jalisco Michoacán Oaxaca Puebla Uncult. 6 8 3 4 - Incip. 1 9 - Escape 1 3 - Landrace Collection sites 22 6 6 12 2 1 4 12 1 3 25 12 16 8 Total 21 10 4 76 54 Comparison of Mexican collections State Baja California Chiapas Chihuahua Colima Guanajuato Guerrero Hidalgo Jalisco México Michoacán Morelos Nayarit Oaxaca Puebla San Luis Potosí Sonora Zacatecas Total BANGEV No. of No. of accessions collection sites 3 1 USDA No. of accessions - No. of collection sites - New Collections No. of No. of accessions collection sites - 1 1 7 7 4 74 26 21 9 9 100 125 1 1 1 6 4 3 45 10 14 6 7 1 16 1 8 4 - 5 4 - 22 13 2 13 3 39 11 - 18 11 1 13 2 37 8 - 1 2 391 1 2 119 12 9 105 90 P. angulata P. ampla Local preferences • • • • Jalisco: purple fruit Puebla: large, green Guerrero: yellow Chiapas: small and purple Field trials • Larry Robertson at USDA Plant Genetic Resources Unit (Geneva, New York) • Tested 99 accessions from 2002 collection • 4 plants per accession, one in a pollinatorexclusion cage • Measured a suite of agronomic and domestication traits Results of field trials • • • • • • Domestication characters Agronomic characters BRIX Selfing Yield Interest from organic farmers Uses of microsatellite markers • Genetic diversity • Phylogeography and the origin of domestication • Paternity analysis and varietal fingerprinting • Genetic mapping • Marker-assisted breeding Microsatellites Simple Sequence Repeats (SSR), Short Tandem Repeats (STR) Mono (A)11 AAAAAAAAAAA Di (AT)8 ATATATATATATATAT Tri (ATC)7 ATCATCATCATCATCATCATC Tetra (CTAG)6 CTAGCTAGCTAGCTAGCTAGCTAG Imperfect Interrupted Compound GTGTGTGTATGTGTGT GTGTGTGTCCCGTGTGTGT GTGTGTGTCTCTCTCTCTCT Microsatellites: advantages • • • • • • Abundant Codominant Highly polymorphic Highly repeatable PCR-based Can be multiplexed for amplification or scoring Development of SSR markers • Two strategies • From enriched SSR libraries • From tomato SSRs Enrichment of SSRs Digest genomic DNA & ligate adapters Hybridize to biotin-labeled SSR probes Capture with magnetic streptavidin beads Clone captured fragments Sequence inserts and design primers Screen primers for polymorphism (in 8 genotypes) Enriched library results • 11 libraries generated • 1620 positive clones isolated • 659 clones sequenced (w/ inserts 500-1500 bp). • 205 (31%) clones contained one or more SSR • SSRs represented 40 unique loci • Primers designed for 24 loci • Eight were easily scorable and highly polymorphic Enriched library results motif ACT AAT AAG/AT C AT G/T T C TTG AGT TTA AAC AC AG AT T OT AL clones isolatedclones with inserts 5001500 bp 43 25 117 60 67 28 0 0 248 32 126 69 89 20 50 11 609 249 0 0 271 165 1620 659 (41%) clones with SSR 3 4 23 0 21 31 2 10 52 0 59 205 (31%) SSR motif(rep eat Unique contigs n u mber) 9 (AC)5 -2 7 2 (AG)5 -7 17 (AAC)4 -2 5 1 (AAT 4) 2 (AT C)5 -7 1 (AAAC)4 Compound 7 Imperfect 1 T otal 40 P rimer pairs 4 2 8 1 2 1 5 1 24 Transferring tomato SSRs • Primers developed for SSRs in tomato expressed sequence tags (from SGN, http://sgn.cornell.edu) • 24/87 (27.5%) primers amplified a product in tomatillo • ~25% of di- and tri-nucleotides • One out of nine among compound SSRs • Six products were • Approximately the expected size • Yielded clean, bright bands • Two were highly polymorphic Tomatillo microsat markers Cross-amplification of primers Species P. acutifolia P. angulata P. ampla P. pruinosa P. peruviana P. alkekengi Solanum lycopersicum Solanum melongena Capsicum annuum Nicotiana tabaccum MIC3 MIC48 MIC89 X X X X X X X X X X X X X X X MIC98 MIC242 X X X X X X X X X X X X MIC269 MIC301 MIC303 X X X X X X MIC341 X X X MIC350 X X X SSR43 SSR140 X X X X X X X X X X X X X X X Tests of Mendelian segregation • Segregation tested using ~50 F2 progeny per marker • All 12 markers showed nuclear segregation • One (SSR140) showed significant distortion • No linkage detected among markers • But not all marker combinations tested Genetic diversity survey • Is there evidence for a genetic bottleneck within cultivated genotypes? • Is there evidence for restricted gene flow • Among geographic regions? • Between cultivated and uncultivated genotypes? • What is the geographic origin of cultivated genotypes? Survey sample • Includes germplasm from • USDA • BANGEV (Mexico) • CATIE (Costa Rica, samples from Guatemala) • 69 genotypes • 39 different sites • 19 sites represented by 2 or 3 genotypes • 6 Guatemalan states and 15 Mexican states • Cultivation status • 21 uncultivated and 39 cultivated (all Mexican) • 9 unknown (all Guatemalan) Diversity and cultivation status Locus MIC3 MIC48 MIC89 MIC98 MIC242 MIC269 MIC301 MIC303 MIC341 MIC350 SSR43 SSR140 0.47 Mean Cultivated A He 16 0.89 7 0.65 4 0.54 2 0.03 2 0.12 6 0.70 15 0.86 4 0.56 19 0.89 9 0.65 13 0.87 9 8.8 0.6 Uncultivated A 13 5 4 2 2 7 13 5 13 7 10 0.47 7.1 He 0.89 0.68 0.45 0.13 0.13 0.61 0.82 0.54 0.86 0.76 0.84 4 0.6 Physiographic provinces Northern states Trans-Mexican Volcanic Belt Chiapas-Guatemala Sierra Madre del Sur © 1975 Board of Regents, The University of Texas Population structure N: Northern states, T: Trans-Mexican Volcanic Belt, S: Sierra Madre del Sur C: Chiapas-Guatemala 0.1 Weedy Cultivated Analysis of Molecular Variation By geographic province source among groups within groups d.f. 3 132 SumSq 19.07 437.72 total 135 456.79 %Var 2.78 97.22 By cultivation status source among groups within groups total d.f. 1 118 119 SumSq 8.14 400.04 408.18 %Var 2.5 97.5 Population structure analysis • Bayesian statistical approach for detecting admixed populations (Pritchard et al. 2000) • Assigns individuals fractionally to K subpopulations • Optimal model is K=2 (with prob~0.98) • Six pairs of markers show significant gametic disequilibrium Diffuse domestication: a hypothesis • Domestication in multiple regions? • Extensive gene flow with uncultivated populations after domestication? Future genetic work • EST sequencing • Tod evelop molecular markers • Crosses among self-compatible accessions • To map the genetic markers • Identify QTL for key domestication and agronomic traits • Association mapping of candidate genes • Shallow population structure • High levels of diversity and recombination Prospects for improvement • Traits of importance • Determinate growth • Self-compatibility • Resistance to lodging • Fruit retention • Loose calyx Pests and diseases • • • • Viruses Powdery mildew Coleoptera Heliothis subflexa caterpillars Conclusions • Much potential for crop improvement of tomatillo • Germplasm resources are now available • Variation for some traits (self-incompatibility) but not others (indeterminate growth) • A panel of 12 microsatellites are now available • Very little population structure • Possibly diffuse domestication • Extensive gene flow • Excellent system for candidate gene association mapping Many thanks to • María Chacon and Maria Tsompana (UNCCH) • Assistants Casey Kolb, Letycia Argote Nuñez, Leah Schinasi, Lindsey Swanson • • • • • Larry Robertson (USDA) Aureliano Peña Lomelí (Chapingo) Ofélia Vargas de Ponce (Guadalajara) Andrew Jarvis (CIAT) Karen Williams (USDA Plant Exchange Office) • USDA, CATIE, and BANGEV seed banks