DNA Replication and Protein Synthesis

advertisement
Chromosomes
• Chromosomes
 Strands of DNA that contain all of
the genes an organism needs to
survive and reproduce
• Genes
 Segments of DNA that specify
how to build a protein
• genes may specify more
than one protein in
eukaryotes
 Chromosome maps are used
to show the locus (location)
of genes on a chromosome
The E. Coli genome includes
approximately 4,000 genes
Chromosomes
• Genetic Variation
 Phenotypic variation among organisms is due to genotypic variation
(differences in the sequence of their DNA bases)
 Differences exist between species and within a species
• Different genes (genomes)  different proteins (proteomes)
• Different versions of the same
gene (alleles)
• Differences in gene expression
(epigenetics)
DNA Replication
• Cell Division (mitosis)
 Cells must copy their chromosomes
(DNA synthesis) before they divide so
that each daughter cell will have a copy
 A region of the chromosome remains
uncopied (centromere) in order to hold
the sister chromatids together
– Keeps chromatids organized to help
make sure each daughter cell gets
exactly one copy
– Nondisjunction is when sister
chromatids do not assort correctly
and one cell ends up with both
copies while the other cell ends up
with none
DNA Replication
• DNA Synthesis
 The DNA bases on each
strand act as a template to
synthesize a complementary
strand
• Recall that Adenine (A)
pairs with thymine (T)
and guanine (G) pairs
with cytosine (C)
 The process is
semiconservative because
each new double-stranded
DNA contains one old
strand (template) and one
newly-synthesized
complementary strand
AT
GC
CG
TA
GC
AT
GC
AT
CG
TA
CG
GC
GC
TA
GC
DNA Replication
• DNA Polymerase
 Enzyme that catalyzes the covalent bond between the phosphate of one
nucleotide and the deoxyribose (sugar) of the next nucleotide
DNA Polymerization
DNA Replication
3’ end has a free deoxyribose
5’ end has a free phosphate
DNA polymerase:
 can only build the new strand in
the 5’ to 3’ direction
 Thus scans the template strand in
3’ to 5’ direction
DNA Replication
Initiation
• Primase (a type of RNA polymerase) builds an RNA primer
(5-10 ribonucleotides long)
• DNA polymerase attaches onto the 3’ end of the RNA primer
DNA polymerase
DNA Replication
Elongation
• DNA polymerase uses each strand as a template in the 3’ to 5’ direction
to build a complementary strand in the 5’ to 3’ direction
DNA polymerase
DNA Replication
Elongation
• DNA polymerase uses each strand as a template in the 3’ to 5’ direction
to build a complementary strand in the 5’ to 3’ direction
 results in a leading strand and a lagging strand
DNA Replication
Leading Strand
1. Topisomerase unwinds DNA and then Helicase breaks H-bonds
2. DNA primase creates a single RNA primer to start the replication
3. DNA polymerase slides along the leading strand in the 3’ to 5’ direction
synthesizing the matching strand in the 5’ to 3’ direction
4. The RNA primer is degraded by RNase H and replaced with DNA nucleotides by
DNA polymerase, and then DNA ligase connects the fragment at the start of the
new strand to the end of the new strand (in circular chromosomes)
DNA Replication
Lagging Strand
1. Topisomerase unwinds DNA and then Helicase breaks H-bonds
2. DNA primase creates RNA primers in spaced intervals
3. DNA polymerase slides along the leading strand in the 3’ to 5’ direction
synthesizing the matching Okazaki fragments in the 5’ to 3’ direction
4. The RNA primers are degraded by RNase H and replaced with DNA nucleotides
by DNA polymerase
5. DNA ligase connects the Okazaki fragments to one another (covalently bonds the
phosphate in one nucleotide to the deoxyribose of the adjacent nucleotide)
DNA Replication
Topoisomerase - unwinds DNA
Helicase – enzyme that breaks H-bonds
DNA Polymerase – enzyme that catalyzes connection of nucleotides to form complementary
DNA strand in 5’ to 3’ direction (reads template in 3’ to 5’ direction)
Leading Strand – transcribed continuously in 5’ to 3’ direction
Lagging Strand – transcribed in segments in 5’ to 3’ direction (Okazaki fragments)
DNA Primase – enzyme that catalyzes formation of RNA starting segment (RNA primer)
DNA Ligase – enzyme that catalyzes connection of two Okazaki fragments
Web Resources
DNA Replication (synthesis)
• http://highered.mcgraw-hill.com/sites/0072556781/student_view0/chapter11/animation_quiz_2.html
• http://www.wiley.com/college/pratt/0471393878/student/animations/dna_replication/index.html
• http://www.biostudio.com/d_%20DNA%20Replication%20Coordination%20Leading%20Laggin
g%20Strand%20Synthesis.htm
• http://www.biostudio.com/d_%20DNA%20Replication%20Nucleotide%20Polymerization.htm
• http://www.dnalc.org/resources/3d/DNAReplicationBasic_w_FX.html
(download this video file from the website to view it without interruptions)
• http://www.stolaf.edu/people/giannini/flashanimat/molgenetics/dna-rna2.swf
• http://www.bioteach.ubc.ca/TeachingResources/MolecularBiology/DNAReplication.swf
Protein Synthesis
• DNA provides the instructions for how to build proteins
• Each gene dictates how to build a single protein in prokaryotes
• The sequence of nucleotides (AGCT) in DNA dictate the order
of amino acids that make up a protein
Nucleotide sequence of His gene
Protein Synthesis
• DNA provides the instructions for how to build proteins
• Each gene dictates how to build a single protein in prokaryotes
• The sequence of nucleotides (AGCT) in DNA dictate the order
of amino acids that make up a protein
Nucleotide sequence of His gene
Amino acid sequence of His protein
Protein Synthesis
• Protein synthesis occurs in two primary steps
1
2
mRNA (messenger RNA)
copy of a gene is
synthesized
mRNA is used by ribosome to
build protein
Cytoplasm of prokaryotes
Nucleus of eukaryotes
(Ribosomes attach to the
mRNA and use its sequence of
nucleotides to determine the order
of amino acids in the protein)
Cytoplasm of prokaryotes
and eukaryotes
Some proteins feed directly into
rough ER in eukaryotes
Protein Synthesis
• Transcription
Initiation
1) INITIATION
 RNA polymerase binds to a
region on DNA known as the
promoter, which signals the
start of a gene
 Promoters are specific to genes
 RNA polymerase does not need
a primer
 Transcription factors assemble
at the promoter forming a
transcription initiation complex
– activator proteins help stabilize
the complex
 Gene expression can be regulated (turned
on/off or up/down) by controlling the amount
of each transcription factor
(eukaryotes)
Protein Synthesis
• Transcription
Elongation
1) INITIATION
 RNA polymerase unwinds
the DNA and breaks the
H-bonds between the bases
of the two strands, separating
them from one another
 Base pairing occurs between
incoming RNA nucleotides
and the DNA nucleotides of
the gene (template)
• recall RNA uses uracil
instead of thymine
AGTCAT
UCAGUA
Protein Synthesis
• Transcription
Elongation
5’
 RNA polymerase unwinds
the DNA and breaks the
H-bonds between the bases
of the two strands, separating
them from one another.
 Base pairing occurs between
incoming RNA nucleotides
and the DNA nucleotides of
the gene (template)
• recall RNA uses uracil
instead of thymine
3’
+ ATP
5’
 RNA polymerase catalyzes bond to
form between ribose of 3’ nucleotide
of mRNA and phosphate of incoming
RNA nucleotide
3’
+ ADP
Protein Synthesis
• Transcription
Elongation
The gene occurs on only one of the DNA
strands; each strand possesses a separate
set of genes
Protein Synthesis
• Transcription
Termination
 A region on DNA known as
the terminator signals the
stop of a gene
 RNA polymerase disengages
the mRNA and the DNA
1) INITIATION
Protein Synthesis
• Alternative Splicing (eukaryotes only)
 Exons are
“coding” regions
 Introns are removed
 different combinations
of exons form
different mRNA
resulting in multiple
proteins from the
same gene
 Humans have 30,000
genes but are capable
of producing 100,000
proteins
Web Resources
Transcription
• http://www.biostudio.com/d_%20Transcription.htm
• http://www.youtube.com/watch?v=WsofH466lqk
• http://www.dnalc.org/resources/3d/TranscriptionBasic_withFX.html
Alternative Splicing
• http://www.youtube.com/watch?v=FVuAwBGw_pQ&feature=related
Protein Synthesis
Transcription
tRNA
synthesis
1
2
mRNA
mRNAmRNA copy of a gene
is synthesized
Cytoplasm of prokaryotes
Nucleus of eukaryotes
mRNA is used by ribosome to
build protein
(Ribosomes attach to the
mRNA and use its sequence of
nucleotides to determine the order
of amino acids in the protein)
Cytoplasm of prokaryotes
and eukaryotes
Some proteins feed directly into
rough ER in eukaryotes
Translation
Protein Synthesis
Transcription
• Translation
tRNA
synthesis
 Every three mRNA nucleotides (codon) specify an amino acid
mRNA
Translation
Protein Synthesis
• Translation
 tRNA have an anticodon region that specifically binds to its codon
Protein Synthesis
Transcription
• Translation
tRNA
synthesis
 Each tRNA carries a
specific amino acid
mRNA
Translation
Protein Synthesis
Transcription
tRNA
synthesis
mRNA
Translation
Aminoacyl tRNA synthetases attach
amino acids to their specific tRNA
Protein Synthesis
mRNA
• Translation
Initiation
 Start codon signals where the gene
begins (at 5’ end of mRNA)
Translation
5’
3’
AUGGACAUUGAACCG…
start codon
Protein Synthesis
Small ribosomal subunit
• Translation
Initiation
 Start codon signals where the gene
begins (at 5’ end of mRNA)
 Ribosome binding site (Shine
Dalgarno sequence) upstream from
the start codon binds to small
ribosomal subunit
– then this complex recruits the
large ribosomal subunit
Small ribosomal subunit
Large ribosomal subunit
Ribosome
Protein Synthesis
• Translation
Scanning
 The ribosome moves in 5’ to 3’ direction “reading” the mRNA and
assembling amino acids into the correct protein
large ribosome subunit
small
ribosome
subunit
Protein Synthesis
• Translation
Scanning
 The ribosome moves in 5’ to 3’ direction “reading” the mRNA and
assembling amino acids into the correct protein
Protein Synthesis
• Translation
Termination
 Ribosome disengages from the mRNA
when it encounters a stop codon
Web Resources
Translation
• Eukaryotic: http://www.youtube.com/watch?v=5bLEDd-PSTQ&feature=related
• Prokaryotic: http://www.biostudio.com/d_%20Protein%20Synthesis%20Prokaryotic.htm
• http://www.biostudio.com/d_%20Peptide%20Bond%20Formation.htm
• http://www.johnkyrk.com/DNAtranslation.html
• http://www.dnalc.org/resources/3d/TranslationBasic_withFX0.html
• http://www.dnalc.org/resources/3d/TranslationAdvanced.html
Practice Question
Translate the following mRNA sequence
AGCUACCAUACGCACCCGAGUUCUUCAAGC
Practice Question
Translate the following mRNA sequence
AGCUACCAUACGCACCCGAGUUCUUCAAGC
Serine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine
Practice Question
Translate the following mRNA sequence
AGCUACCAUACGCACCCGAGUUCUUCAAGC
Serine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine
Ser – Tyr – His – Thr – His – Pro – Ser – Ser – Ser - Ser
Practice Question
Translate the following mRNA sequence
AGCUACCAUACGCACCCGAGUUCUUCAAGC
Serine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine
Ser – Tyr – His – Thr – His – Pro – Ser – Ser – Ser - Ser
S – Y –H– T – H – P – S – S – S - S
Protein Synthesis
• Multiple RNA polymerases can
engage a gene at one time
• Multiple ribosomes can engage
a single mRNA at one time
Transcription
DNA
mRNAs
Translation
Protein Synthesis
• Eukaryotes:
transcription occurs
in the nucleus and
translation occurs in
the cytoplasm
• Prokaryotes:
Transcription and
translation occur
simultaneously in
the cytoplasm
RNA
•
There are four main types of RNA:
1. mRNA
- RNA copy of a gene used as a template for protein synthesis
2. rRNA
- part of structure of ribosomes
3. tRNA
- amino acid carrier that matches to mRNA codon
4. snRNA
- found in nucleus where they have several important jobs
Practice Questions
1.
Why is DNA synthesis said to be “semiconservative”?
2.
What role do DNA polymerase, DNA primase (a type of RNA polymerase),
helicase, topoisomerase, RNase H, and ligase play in DNA replication?
3.
What is the difference between how the leading strand and lagging strand are
copied during DNA replication? Why do they have to be synthesized
differently in this fashion?
4.
What would happen if insufficient RNase H were produced by a cell? What if
insufficient ligase were produced by a cell?
5.
What are four key differences between DNA polymerase and RNA
polymerase? (“they are difference molecules” doesn’t count as one!)
6.
Compare and contrast codons and anticodons?
7.
What is alternative splicing? Why is it necessary in eukaryotes?
8.
During translation, what amino acid sequence would the following mRNA
segment be converted into: AUGGACAUUGAACCG?
9.
How come there are only 20 amino acids when there are 64 different codons?
10. How come prokaryotes can both transcribe and translate a gene at the same
time, but eukaryotes cannot?
Web Resources
Transcription
• http://www.biostudio.com/d_%20Transcription.htm
• http://www.youtube.com/watch?v=WsofH466lqk
• http://www.dnalc.org/resources/3d/TranscriptionBasic_withFX.html
Alternative Splicing
• http://www.youtube.com/watch?v=FVuAwBGw_pQ&feature=related
Translation
• Eukaryotic: http://www.youtube.com/watch?v=5bLEDd-PSTQ&feature=related
• Prokaryotic: http://www.biostudio.com/d_%20Protein%20Synthesis%20Prokaryotic.htm
• http://www.biostudio.com/d_%20Peptide%20Bond%20Formation.htm
• http://www.johnkyrk.com/DNAtranslation.html
• http://www.dnalc.org/resources/3d/TranslationBasic_withFX0.html
• http://www.dnalc.org/resources/3d/TranslationAdvanced.html
Web Resources
Insulin Example of Protein Synthesis
http://www.biotopics.co.uk/as/insulinproteinstructure.html
Hemoglobin Example of Protein Synthesis
http://www.biotopics.co.uk/as/insulinproteinstructure.html
Collagen Example of Protein Synthesis
http://www.biotopics.co.uk/JmolApplet/collagen.html
Images
•
http://www.kscience.co.uk/as/module1/pictures/bacteria.jpg
•
http://www.biologie.uni-hamburg.de/b-online/library/onlinebio/14_1.jpg
•
http://pharmamotion.com.ar/wp-content/uploads/2009/12/nrti_mechanism_action_antiretrovirals.jpg
•
http://biology200.gsu.edu/houghton/4564%20%2704/figures/lecture%204/AAAreverse.jpg
•
http://www.ebi.ac.uk/thornton-srv/databases/pdbsum/2d8x/traces.jpg
•
http://www.ncbi.nlm.nih.gov
•
http://xarquon.jcu.cz/edu/uvod/09nucleus/092function/images/activation3.jpg
•
http://www.ncbi.nlm.nih.gov
•
http://bass.bio.uci.edu/~hudel/bs99a/lecture23/lecture4_4.html
•
http://selfhpvdna.diagcorlab.com/images/images/CervicalCancer.jpg
Download
Related flashcards

Biomolecules

48 cards

Signal transduction

44 cards

Metabolic disorders

39 cards

Glycoproteins

24 cards

Metabolic disorders

38 cards

Create Flashcards