Presentation
advertisement
Human myeloproliferative neoplasms: molecular mechanisms, diagnosis and classification Tony Green Cambridge Institute for Medical Research University of Cambridge and Addenbrookes Hospital 1. Normal mammary epithelial development 5. Completion of last total selective sweep 3. Further driver mutations and clonal expansions 2. First driver mutation 6. Final rate-limiting driver mutation 7. Diagnosis 4. Appearance of most recent common ancestor Nik-Zainal et al Cell 2012 Myeloproliferative neoplasms Blood stem cell Red cells Progenitors • Arise in blood stem cell Platelets • Increased production of mature cells • Window on earliest stage of tumorigenesis • Tractable – accessible tissue, chronic diseases, clonal analysis The BCR-ABL negative myeloproliferative neoplasms Essential thrombocythaemia (ET) Polycythaemia Vera (PV) JAK2 V617F mutation 60% 95% Acute myeloid leukaemia The JAK2 V617F mutation Exon 12 V617F neg JAK2 FERM SH2 Exon 12 mutations AT G T N T C T Grans AT G T G T C T T cells JH2 V617F mutation Kinase Exon 16 mutations AT G TTT C T Homozygous James et al Nature 2005; Baxter et al Lancet 2005 Levine et al Cancer Cell 2005; Kralovics et al NEJM 2005 Scott et al NEJM 2007; Bercovich et al Lancet et al 2008 Mitotic recombination “It all starts to make sense” EPOR TPOR JAK2 P P P P P P P MAPK pSTAT5 PI3K P MAPK pSTAT5 PI3K Diagnosis Appearance of most recent common ancestor Rapid direct clinical impact 2005 2010 Identification of JAK2 mutation PT-1 trials Recognition of new disease subtypes Molecular testing in regional diagnostic service Therapeutic JAK2 inhibitors Specialist MPN clinic Selected Green lab translational papers since 2005 Harrison et al NEJM 2005 Baxter et al Lancet 2005 Campbell et al Lancet 2005 Scott et al Blood 2006 Campbell et al Blood 2006a Zhao et al NEJM 2008 Campbell and Green NEJM 2006 Campbell et al JCO 2009 Campbell et al Blood 2006b Beer et al Blood 2010 Scott et al NEJM 2007 Chen et al Cancer Cell 2010 Wilkins et al Blood 2008 Godfrey et al Blood 2012 Beer et al Blood 2008 Old criteria for diagnosis of PV A1 Red cell mass >25% above predicted or Hct >60% male, >56% female 2 No cause for 2o erythrocytosis 3 Palpable splenomegaly 4 Clonality marker B1 Platelet count >400 x109/l 2 Neutrophils >10 x109/L (>12.5 in smokers) 3 Splenomegaly on imaging 4 Endogenous erythroid colonies or reduced serum epo A1 + A2 + any other A establishes diagnosis A1 + A2 + two of B establish diagnosis Diagnostic criteria 20012 1 Raised Hb 2 JAK2 mutation 3 No cause for 20 erythrocytosis - normal art O2 - serum epo not high McMullin et al BCSH guidelines BJH 2005, 2007 Idiopathic erythrocytosis or PV? erythroid colony granulocytes wt ATGGTGTTTCACAAAATCAGAAAT M V F H K I R N mut ATGGTGTTTCAATTAATCAGAAAT M V F Q L I R N Scott et al NEJM 2007 Exon 12 FERM SH2 V617F JH2 Kinase PV variant with JAK2 exon 12 mutations Isolated erythrocytosis H&E Can be low level in blood Glycophorin A granulocytes erythroid colony Multiple mutations High Resolution Melt Analysis Scott et al NEJM 2007; Percy et al Haematologica 2007; Boyd et al BJH 2010 Diagnosis of ET: JAK2 or MPL mutation-positive WHO 2008 BCSH guidelines 2009 Sustained platelet count >450 Sustained platelet count >450 Acquired mutation (JAK2 or MPL) Acquired mutation (JAK2 or MPL) No other myeloid malignancy No other myeloid malignancy Typical bone marrow appearances (reticulin ≤ grade 2) BUT in absence of mutation still need to exclude reactive causes Distinguishing different MPNs ET diagnose and Beer et al Blood 2011 PV PMF Distinguishing different MPNs ET diagnose and Beer et al Blood 2011 PV PMF ET is heterogeneous Key issue – can Cologne/WHO histological criteria identify distinct disease entities WHO book is like a country – with good aspects… ….. but some aspects less good ….. but some aspects less good Three questions • Is prefibrotic PMF really distinct • Can WHO criteria be applied reproducibly • Is prefibrotic MF a useful concept Distinguishing ET from PMF Role of histology ET ? “True ET” “Prefibrotic PMF” • 3 experienced haematopathologists, large prospective cohort (PT1 study) , blinded analysis of WHO diagnosis and 16 morphological criteria Campbell et al Lancet 2005 Wilkins et al Blood 2008 Scott et al Blood 2006 Campbell et al JCO 2009 Conclusions Even experienced haematopathologists don’t agree on what to call “true ET” & “prefibrotic PMF” Two alternative explanations: - ‘Prefibrotic PMF’ not a distinct entity - ‘Prefibrotic PMF’ exists but special training required - even if true, questionable utility of criteria the application of which is so difficult even for highly experienced pathologists Utility of prefibrotic PMF criteria (WHO 2008) YES: Thiele et al Blood 2011 Barbui, Thiele et al JCO 2011 NO: Concordance 73-88% Brousseau et al Histopathology 2010 “Distinction between ET and prefibrotic PMF is of questionable clinical relevance” Buhr, Kreipe et al Haematologica 2012 > 50% no agreement or unclassifiable - “WHO criteria for discriminating ET from prefibrotic PMF are poorly to only moderately reproducible” Barbui, Thiele et al JCO 2011 • Limitation of consensus approach to histology • MF progression at 15 yrs: 10% vs 17% true ET vs prefib MF • Leuk progression at 15 yrs 2% vs 11% - but no mention of therapy • Even if real difference – prefibrotic PMF likely to represent later stage of same disease process Three questions • Is prefibrotic PMF really distinct • Can WHO criteria be applied reproducibly • Is prefibrotic PMF a useful concept ? later stage disease NO Nomenclature of “prefibrotic PMF” is flawed Prefibrotic PMF? “True ET” PV PMF Nomenclature of “prefibrotic PMF” is flawed Prefibrotic PMF? ET PV PMF Nomenclature of “prefibrotic PMF” is flawed 5-30% ET PV PMF Nomenclature of “prefibrotic PMF” is flawed Prepolycythaemic PV? ET PV PMF Concept of “prefibrotic PMF” is also potentially dangerous For individual patient management - inappropriate therapy (eg BMT) for low risk patients For the MPN field - patient cohorts will not be comparable Three questions • Is prefibrotic PMF really distinct • Can WHO criteria be applied reproducibly • Is prefibrotic PMF a useful concept ? later stage disease NO Flawed Dangerous Distinguishing ET from PMF Thrombocytosis with isolated increased reticulin • Relatively common – 15-20% • Unclassifiable under WHO • Benign prognosis Implications – patient predisposed to robust fibrosis but lacks 2nd hits needed for evolution of clinical disease Distinguishing ET from PMF PMF as presentation in accelerated phase of pre-existing MPN • PMF and MF transformation indistinguishable • PMF patients may have prior thrombocytosis • PMF exhibits features of late stage disease - high clonal burden – more cytogenetic abnormalities - increased progression to AML Molecular classification of ET and PMF Chronic phase MPL JAK2 Heterogeneous (mostly Pl) Mutation load retic Accel phase WBC dysplasia Includes MF transformn + some PMF and atypical CML Leuk phase Campbell and Green NEJM 2006 Beer et al Blood 2011 Distinguishing different MPNs ET diagnose and Beer et al Blood 2011 PV PMF Distinguishing ET from PV 809 ET patients in PT-1 trial JAK2 mut neg JAK2 mut pos Higher Hb and WBC Increased e’poiesis and g’poiesis More venous thrombosis More transformation to PV JAK2-positive ET is forme fruste of PV Campbell al al Lancet 20052005 Campbelletet Lancet Scott etetal alBlood 2006 Harrison NEJM 2005 Suppression of Epo in JAK2-pos ET Serum Epo (mU/mL) 40 JAK2 WT JAK2 V617F 35 30 25 20 p<0.0001 15 10 5 0 11 12 13 14 Haemoglobin (g/dL) 15 16 Distinguishing ET from PV Normal ET 14 16 PV N 18 20 Hb Inherent problem in using continuous variable (eg Hct or RCM) to make a binary distinction One mutation but two diseases Essential thrombocythaemia Polycythaemia vera Rare Common Mitotic recombination Hypothesis – homozygosity for JAK2 mutation causes PV phenotype JAK2V617F knockin mouse – homozygosity causes phenotypic switch from ET to PV Platelets Platelets (x103)/µl Haematocrit (%) Haematocrit WT Het Hom Li et al Blood 2010 WT Het Juan Li, David Kent unpublished Hom ET Heterozygous JAK2V617F 9p LOH PV Homozygous mutant BFU-E present in many patients with ET PV 80% ET 52% Higher number of homozygous colonies in PV patients compared to ET - homozygous clone has selective advantage in PV but not ET - recurrent acquisition of homozygosity Godfrey et al Blood 2012 Recurrent acquisition of 9p LOH in patient with PV Mb from telomere 4.0 4.8 6.2 A Tel D9S288 D9S1810 D9S1852 B C Heterozygous LOH JAK2 A 14.8 D9S235 170 18.3 D9S925 19.7 D9S162 27.6 125 130 B 180 135 170 125 D9S161 30.9 D9S43 33.9 D9S1817 36.4 D9S1791 38.3 D9S2148 Cen 102.1 D9S176 44 5 4 Number of colonies 130 C 170 180 135 125 180 130 135 Summary • Recurrent acquisition of homozygosity - in 5/8 PV patients and 2/2 ET patients tested - resolution limited (2.3 to 14.2 Mb) so number of distinct clones may be underestimate • PV distinguished from ET by presence of dominant homozygous clone ~10 fold larger than minor clones - ? additional lesions • Multiple clones arise in HSPC compartment - persist over time - detectable in sorted CMPs Heterozygous JAK2V617F Recurrent 9p LOH ET PV Differential STAT1 signaling in heterozygous colonies from patients with ET and PV Arrays Pathway IFNG up-regulated genes NES: -2.156 q val: <0.002 PV Key regulator ET WT MUT PV Chen et al Cancer Cell 2010 pSTAT1 DAPI pSTAT1 ET Actin Essential thrombocythaemia Polycythaemia vera JAK2 V617F JAK2 V617F STAT1 defect JAK2 homozyg Clonal expansion Conclusions and questions • Unexpected complexity in early phase of “simple” malignancy • Questions - how does clone expand given HSC defect - what drives recurrent mitotic recombination - what drives expansion of dominant homozygous clone in PV - cause and effects of pSTAT1 defect in heterozygous PV cells • Exomes coming Acknowledgements Green lab Maria Ahn Athar Aziz Philip Beer Edwin Chen Jyoti Evans Anna Godfrey Tina Hamilton David Kent Juan Li Steve Loughran Charlie Massie June Park Dean Pask Yvonne Silber Rachel Sneade Sanger Institute Peter Campbell, Mike Stratton Andy Futreal, Elli Papaemmanuil Cambridge University Anne Ferguson-Smith Carol Edwards Nick Cross Amy Jones Claire Harrison Mary-Frances McMullin Adam Mead Sten-Eirik Jacobsen Addenbrookes/BRC Mike Scott Joanna Baxter/Anthony Bench MPD clinic, TRL team Alessandro Vannucchi NCRI MPN Study Group PT-1 trial team Ghulam Mufti Eva Hellstom Jean Jacques Kiladjian The myeloproliferative neoplasms Essential thrombocythaemia (ET) Thrombosis Polycythaemia Vera (PV) Primary Myelofibrosis Acute myeloid leukaemia JAK2 mutations neg FERM SH2 JH2 exon 12 mutations exon 14 V617F V617F-neg PV variant 95% PV 50% ET 50% IMF Kinase exon 16 R683 Acute Lymphoblastic Leukaemia Difference between mutation pos ET and PV Gender Genetic modifiers Acquired mutations Depleted iron stores Erythrocytosis Normal Hb Campbell et al Lancet 2005 JAK2 Mutation Scott et al NEJM 2007 Nuclear JAK2 signaling directly regulates chromatin structure JAK2 is a histone H3 kinase H3Y41 H3Y54 Dawson et al Nature 2009 Collab with Kouzarides lab H3Y99 JAK2 signaling to chromatin mediates ES cell self-renewal P H3 Y41 P H3 Y41 Nanog Griffiths et al Nat Cell Biol 2011 Collab with Gottgens lab
