Jinsong Pang
Tel. 85099367
E-mail: pangjs542@nenu.edu.cn
Key laboratory of molecular biology epigenetics of MOE

Watson and Crick: DNA double helix (1953)
Eukaryotic chromosome SV40 minichromosome

Nucleosides
•The bases are covalently attached to the 1’ position of a pentose sugar ring, to form a nucleoside
Glycosidic (glycoside, glycosylic) bond
•R
•Ribose or •2’-deoxyribose
•Adenosine, guanosine, cytidine, thymidine, uridine

•Bases in DNA
•purines
•adenine
•guanine • N9
•pyrimidines
•cytosine
•thymine
• N1

BASES NUCLEOSIDES
Adenine ( A ) Adenosine
NUCLEOTIDES
Adenosine 5’-triphosphate ( ATP )
Deoxyadenosine Deoxyadenosine 5’-triphosphate ( dATP )
Guanine ( G ) Guanosine Guanosine 5’-triphosphate ( GTP )
Deoxyguanosine Deoxy-guanosine 5’-triphosphate ( dGTP )
Cytosine ( C ) Cytidine
Deoxycytidine
Thymine ( T ) Thymidine/
Deoxythymidie
Uracil ( U ) Uridine
Cytidine 5’-triphosphate ( CTP )
Deoxy-cytidine 5’-triphosphate ( dCTP )
Thymidine/deoxythymidie
5’-triphosphate ( dTTP )
Uridine 5’-triphosphate ( UTP )

Gene
Gene : A molecular unit of heredity of a living organism.
The segment of DNA specifying production of a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments
(exons).

A brief history of genetics
Gene is a "particulate factor" that passes unchanged from parent to progeny. (Mendel 1865)

The central dogma : Crick 1958
A gene codes for an RNA, which may code for protein.

Exon is any segment of an interrupted gene that is represented in the mature
RNA product.
Intron is a segment of DNA that is transcribed, but removed from within the transcript by splicing together the sequences (exons) on either side of it.
RNA splicing is the process of excising the sequences in RNA that correspond to introns, so that the sequences corresponding to exons are connected into a continuous mRNA.
Structural gene codes for any RNA or protein product other than a regulator.
Transcript is the RNA product produced by copying one strand of DNA. It may require processing to generate mature RNAs.

2.5 Organization of interrupted genes may be conserved
Comparison of the cDNA and genomic DNA for mouse b
-globin shows that the gene has two introns that are not present in the cDNA. The exons can be aligned exactly between cDNA and gene.

Alternative splicing generates the a and b variants of troponin T.
Alternative splicing uses the same pre-mRNA to generate mRNAs that have different combinations of exons.

Most genes are uninterrupted in yeast, but most genes are interrupted in flies and mammals.
Yeast genes are small, but genes in flies and mammals have a dispersed distribution extending to very large sizes.

Exons coding for proteins are usually short. Introns range from very short to very long.

• Polymorphism (more fully genetic polymorphism): The simultaneous occurrence in the population of genomes showing variations at a given position.
• Single nucleotide polymorphism (SNP): The polymorphism (variation in sequence between individuals) caused by a change in a single nucleotide.

An exon surrounded by flanking sequences that is translocated into an intron may be spliced into the RNA product.

The contrast between interphase chromatin and mitotic chromosomes
Heterochromatin describes regions of the genome that are permanently in a highly condensed condition are not transcribed, and are late-replicating. May be constitutive or facultative.
Euchromatin comprises all of the genome in the interphase nucleus except for the heterochromatin.

 Chromosome is a compact form of the DNA that readily fits inside the cell
 To protect DNA from damage
 DNA in a chromosome can be transmitted efficiently to both daughter cells during cell division
 Chromosome confers an overall organization to each molecule of DNA, which facilitates gene expression as well as recombination

Chromosomes
 Shape: circular or linear
 Number in an organism is characteristic
 Copy: haploid, diploid, polyploid
•3/15/05

Genome : The complete set of sequences in the genetic material of an organism.
Transcriptome : The complete set of RNAs present in a cell, tissue, or organism.
Proteome : The complete set of proteins that is expressed by the entire genome.

•3/15/05
 Genome size: the length of DNA associated with one haploid complement of chromosomes
 Gene number: the number of genes included in a genome
 Gene density: the average number of genes per
Mb of genomic DNA

•Genome : all DNA sequences in a cell
•Genes: a stretch of continuous DNA sequence encoding a protein or RNA
•
is the quantity of DNA in the genome
(per haploid set of chromosomes).
•
refers to the lack of a correlation between genome size and genetic complexity (ie. Lungfish 139Gb vs. human 3Gb)

• DNA sequence that does not code for protein or RNA, including
1.
Introns (unique sequence) in genes
2.
DNA consisting of multiple repeats, can be tandemly repeated sequences
(e.g. satellite DNA) or interspersed repeats (e.g. Alu element) etc.
•Tandem gene clusters :
1. moderately repetitive DNA consists of a number of types of repeated sequence.
2. genes whose products are required in unusually large quantities, e.g. there are 10-10000 copies of rDNA encoding 45S precursor and X100 copies of histone genes.

•The proportions of different sequence components vary in different genomes.

•The largest component of the human genome consists of transposons. Other repetitive sequences include large duplications and simple repeats.

•Satellite DNA
(simple sequence) :
- Highly repetitive DNA (>10 6 ).
- very short (2 to 20-30bp, mini- or micro-), in tandem arrays
- concentrated near the centromeres and forms a large part of heterochromatin.
- as separate band in buoyant density gradient
- no function found, except a possible role in kinetochore binding
- Minisatellite repeats are the basis of the DNA fingerprinting techniques

• 5’ – ATAAACTATAAACTATAAACT – 3’
• 3’ – TATTTGATATTTGATATTTGA – 5’
•ACAAACT, 1.1x10
7 bp, 25% genome
•ATAAACT, 3.6x10
6 bp, 8% genome
•ACAAATT, 3.6x10
6 bp, 8% genome
•AATATAG, cryptic
•Satellites comprise more than 40% of the genome

•Human mitochondrial DNA has 22 tRNA genes, 2 rRNA genes, and 13 protein-coding regions. 14 of the 15 protein-coding or rRNA-coding regions are transcribed in the same direction. 14 of the tRNA genes are expressed in the clockwise direction and 8 are read counter clockwise.

CpG islands and the promoters of housekeeping genes

• Half of the molecular mass of eukaryotic chromosome is protein
 In eukaryotic cells a given region of DNA with its associated proteins is called chromatin
 The majority of the associated proteins are small, basic proteins called histones .
 Other proteins associated with the chromosome are referred to as non-histone proteins , including numerous DNA binding proteins that regulate the transcription, replication, repair and recombination of DNA.
 Nucleosomes : regular association of DNA with histones to form a structure effectively compacting DNA

Centromeres, origin of replication and telomere are required for eukaryotic chromosome maintenance
Eukaryotic chromosome duplication & segregation occur in separate phases of the cell cycle
Cell cycle : a single round of cell division
Mitotic cell division : the chromosome number is maintained during cell division

Required for the correct segregation of the chromosomes after replication
 Direct the formation of kinetochore (an elaborate protein complex) essential for chromosome segregation
 One chromosome, one centromere
 The size varies (200 bp- >40 kb)
 Composed of largely repetitive DNA sequences

•AT-rich (88bp)

•Mitotic spindle

•Yeast centromere
Mammalian cells: much longer, flanked by satellite DNA

1. Specialized DNA sequences which form the ends of the linear DNA of the eukaryotic chromosome
2. Contains up to hundreds copies of a short repeated sequence (5’-TTAGGG-3’ in human)
3. Synthesized by the enzyme telomerase (a ribonucleoprotein) independent of normal DNA replication.
4. The telomeric DNA forms a special secondary structure to protect the chromosomal ends from degradation

•Repeat sequence: Tetrahymena- TTGGGG; human- TTAGGG

•A loop structure forms at the end of chromosomal DNA

The eukaryotic mitotic cell cycle

 The nucleosome is composed of a core of eight histone proteins and the DNA ( core
DNA, 147 bp ) wrapped around them. The
DNA between each nucleosome is called a linker DNA . Each eukaryote has a characteristic average linker DNA length
(20-60 bp)

The path of nucleosomes in the chromatin fiber
Histone octamer DNA
•Nucleosome core
•146 bp, 1.8 superhelical turn
Histone H1
The 10 nm fiber in partially unwound state can be seen to consist of a string of nucleosomes. Photograph kindly provided by Barbara Hamkalo.
•Chromatosome
•166 bp, 2 superhelical turn
The structure of nucleosome

Histones are small, positively charged (basic) proteins
DNA packaged into nucleosome
Six-fold DNA compaction
 Five abundant histones are H1 (linker histone, 20 kd), H2A,
H2B, H3 and H4 (core histones, 11-15 kd).
 The core histones share a common structural fold , called histone-fold domain
 The core histones each have an N-terminal “tail” , the sites of extensive modifications

The histone tails emerge from the core of the nucleosome at specific positions, serving as the grooves of a screw to direct the DNA wrapping around the histone core in a left-handed manner.

Histone H1 binds to the linker DNA between nucleosome, inducing tighter
DNA wrapping around the nucleosome

1. Stabilizes the point at which DNA enters and leaves the nucleosome core.
2. C- tail of H1: stabilizes the DNA between the nucleosome cores.
• 23 kDa, located outside of nucleosome core, binds to DNA more loosely
• Less conserved in its sequence

 There are factors acting on the nucleosome to increase or decrease the dynamic nature
 The dynamic nature of DNA-binding to the histone core is important for access of
DNA by other proteins essential genome expression etc.

• The major mechanisms for the condensing and decondensing of chromatin operate directly through the histone proteins which carry out the packaging.
• Short-term changes in chromosome packing modulated by chemical modification of histone proteins
• Actively transcribed chromatin: via acetylation of lysine residues in the Nterminal regions of the core histones.
• Condensation of chromosomes at mitosis: by the phosphorylation of histone H1.
• Longer term differences in chromatin condensation: associated with changes due to stages in development and different tissue types.
• Utilization of alternative histone variants, H5 replacing H1 in some very inactive chromatin.

Modification of the histone N-terminal tails alters the function of chromatin

Interphase chromosomes: chromatin
Heterochromatin
1. Highly condensed
2. Transcriptionally inactive
3. Can be the repeated satellite DNA close to the centromeres, and sometimes a whole chromosome (e.g. one X chromosome in mammals)
Euchromatin : chromatin other than heterochromatin.
1. More diffused and not visible
2. The region where transcription takes place
3. Not homogenous, only a portion (~10%) euchromatin is transcriptionally active where the 30nm fiber has been dissociated to “beads on a string” structure and parts of these regions may be depleted of nucleosome.
DNase I hypersensitivity

• CpG methylation
:
• Methylation of C5 in the cytosine base of 5’-CG-3’
• Occurs in mammalian cells
• Signaling the appropriate level of chromosomal packing at the sites of expressed genes
• CpG methylation is associated with transcriptionally inactive regions of chromatin
• Islands of unmethylated CpG are coincident with regions of
DNase I hypersensitivity
• “Islands”: surround the promoters of housekeeping genes .
• Responsible for epigenetic and may also to RNA silencing

•DNase I hypersensitivity

Brief summary
1. Prokaryotic chromosome : closed-circular DNA, domains/loops, negatively supercoiled, HU & H-NS
2. Eukaryotic chromatin : Histones (octamer: H2A, H2B, H3,
H4)+146bp DNA > Nucleosomes + H1 > chromatosome + Linker
DNA > beads on string > 30nm fiber > fiber loop + nuclear matrix > highly ordered chromatin > > > chromosome
3. Eukaryotic chromosome structure : centromere, kinetochore, telomere, hetero- or euchromatin, CpG island and methylation
4. Genome complexity : noncoding DNA, unique sequence, repetitive DNA, satellite DNA