Pattern Formation in Synthetic Bacterial Colonies (slides)

advertisement
Pattern Formation in
Synthetic Bacterial Colonies
Fran Romero and Karima Righetti
Research Fellow
School of Computer Science
University of Nottingham
Nottingham 18th of March 2010
Outline
A modelling language for the incremental and parsimonious design
of synthetic gene circuits in multicellular systems.
Design of a gene circuit producing the emergence of pattern
formation in synthetic bacterial colonies.
Implementation of our synthetic gene circuit in bacterial colonies of
Escherichia coli.
APattern
P SystemFormation
Modelling Framework
for Systems
and Synthetic
Biology
in Synthetic
Bacterial
Colonies
2
Outline
A modelling language for the incremental and parsimonious
design of synthetic gene circuits in multicellular systems.
Design of a gene circuit producing the emergence of pattern
formation in synthetic bacterial colonies.
Implementation of our synthetic gene circuit in bacterial colonies of
Escherichia coli.
APattern
P SystemFormation
Modelling Framework
for Systems
and Synthetic
Biology
in Synthetic
Bacterial
Colonies
3
Top-Down Synthetic Biology:
An Approach to Engineering Biology
Discosoma sp.
 Cells are information
processors. DNA is their
programming language.
Pseudomonas
aeruginosa
Aequorea
victoria
Vibrio fischeri
 DNA sequencing and PCR:
Identification and isolation of
cellular parts.
 Recombinant DNA and
DNA synthesis : Combination
of DNA and construction of
new systems.
E. coli
plasmids
Chassis
DNA synthesis
Circuit Blueprint
 Tools to make biology easier
to engineer: Standardisation,
encapsulation and abstraction
(blueprints).
APattern
P SystemFormation
Modelling Framework
for Systems
and Synthetic
Biology
in Synthetic
Bacterial
Colonies
4
Characterisation/Encapsulation of
Cellular Parts: Gene Promoters
AHL
LuxR
 A modeling language for
CI
the design of synthetic
bacterial colonies.
01101110100001010100011110001011101010100011010100
PluxOR1({X},{c1,
c2, c3, c4, c5, c6, c7, c8, c9},{l}) = {
 A module, set of rules
describing the molecular
interactions involving a
cellular part, provides
encapsulation and
abstraction.
type: promoter
sequence: ACCTGTAGGATCGTACAGGTTTACGCAAGAA
ATGGTTTGTATAGTCGAATACCTCTGGCGGTGATA
rules:
r1: [ LuxR2 + PluxPR.X ]_l -c1-> [ PluxPR.LuxR2.X ]_l
r2: [ PluxPR.LuxR2.X ]_l -c2-> [ LuxR2 + PluxPR.X ]_l
...
r5: [ CI2 + PluxPR.X ]_l -c5-> [ PluxPR.CI2.X ]_l
r6: [ PluxPR.CI2.X ]_l -c6-> [ CI2 + PluxPR.X ]_l
...
r9: [ PluxPR.LuxR2.X ]_l -c9-> [ PluxPR.LuxR2.X + RNAP.X ]_l
 Collection or libraries of
reusable cellular parts and
reusable models.
}
APattern
P SystemFormation
Modelling Framework
for Systems
and Synthetic
Biology
in Synthetic
Bacterial
Colonies
5
Module Variables: Recombinant DNA,
Directed Evolution, Chassis selection
 Recombinant DNA: Objects variables can be instantiated with the name of specific
genes.
PluxOR1({X=GFP})
PluxOR1({X=tetR})
 Directed evolution: Variables for stochastic constants can be instantiated with specific
values.
A
PluxOR1({X=GFP},{...,c4=10,...})
 Chassis Selection: The variable for the label can be instantiated with the name of a
chassis.
PluxOR1({X=GFP},{...,c4=10,...},{l=DH5α })
APattern
P SystemFormation
Modelling Framework
for Systems
and Synthetic
Biology
in Synthetic
Bacterial
Colonies
6
Characterisation/Encapsulation of
Cellular Parts: Riboswitches
 A riboswitch is a piece of RNA that folds in different ways depending on the
presence of absence of specific molecules regulating translation.
ToppRibo({X},{c1, c2, c3, c4, c5, c6},{l}) = {
type: riboswitch
sequence:GGTGATACCAGCATCGTCTTGATGCCCTTGG
CAGCACCCCGCTGCAAGACAACAAGATG
rules:
r1: [ RNAP.ToppRibo.X ]_l -c1-> [ ToppRibo.X ]_l
r2: [ ToppRibo.X ]_l -c2-> [ ]_l
r3: [ ToppRibo.X + theop ]_l –c3-> [ ToppRibo*.X ]_l
r4: [ ToppRibo*.X ]_l –c4-> [ ToppRibo.X + theop ]_l
r5: [ ToppRibo*.X ]_l –c5-> [ ]_l
r6: [ ToppRibo*.X ]_l –c6-> [ToppRibo*.X + Rib.X ]_l
}
APattern
P SystemFormation
Modelling Framework
for Systems
and Synthetic
Biology
in Synthetic
Bacterial
Colonies
7
Characterisation/Encapsulation of
Cellular Parts: Degradation Tags
 Degradation tags are amino acid sequences recognised by proteases. Once the
corresponding DNA sequence is fused to a gene the half life of the protein is
reduced considerably.
degLVA({X},{c1, c2},{l}) = {
type: degradation tag
sequence: CAGCAAACGACGAAAACTACGCTTTAGTAGCT
rules:
r1: [ Rib.X.degLVA ]_l -c1-> [ X.degLVA ]_l
r2: [ X.degLVA ]_l -c2-> [ ]_l
}
A P System Modelling Framework for Systems and Synthetic Biology
8
Higher Order Modules: Building
Synthetic Gene Circuits
PluxOR1
ToppRibo
geneX
3OC6_repressible_sensor({X}) = {
PluxOR1({X=ToppRibo.geneX.degLVA},{...},{l=DH5α})
X=GFP
ToppRibo({X=geneX.degLVA},{...},{l=DH5α})
degLVA({X},{...},{l=DH5α})
}
Plux({X=ToppRibo.geneCI.degLVA},{...},{l=DH5α})
ToppRibo({X=geneCI.degLVA},{...},{l=DH5α})
degLVA({CI},{...},{l=DH5α})
PtetR({X=ToppRibo.geneLuxR.degLVA},{...},{l=DH5α})
Weiss_RBS({X=LuxR},{...},{l=DH5α})
Deg({X=LuxR},{...},{l=DH5α})
A P System Modelling Framework for Systems and Synthetic Biology
9
degLVA
Specification of Single Cells:
P systems
Abstraction of the structure and
functioning a single cell.
Objects
o Compartmental models
o Rule-based modelling approach
o Discrete and stochastic semantics
Membranes
Rewriting Rules
APattern
P SystemFormation
Modelling Framework
for Systems
and Synthetic
Biology
in Synthetic
Bacterial
Colonies
10
Specification of Multi-cellular
Systems: LPP systems
AHL
AHL
LuxR
Pconst
AHL
GFP
PluxOR1
gfp
luxR
CI
LuxI
Pconst
luxI
Plux
cI
APattern
P SystemFormation
Modelling Framework
for Systems
and Synthetic
Biology
in Synthetic
Bacterial
Colonies
AHL
Specification of Multi-cellular
Systems: LPP systems
AHL
AHL
LuxR
Pconst
AHL
GFP
PluxOR1
gfp
luxR
CI
LuxI
Pconst
luxI
Plux
cI
APattern
P SystemFormation
Modelling Framework
for Systems
and Synthetic
Biology
in Synthetic
Bacterial
Colonies
AHL
Infobiotics: An Integrated Framework
http://www.infobiotics.org/infobiotics-workbench/
Cellular
Parts
Synthetic
Circuits
Single
Cells
Synthetic Multicellular Systems
Libraries of
Modules
Module
Combinations
P systems
LPP systems
A compiler based on
a BNF grammar
Multi Compartmental
Stochastic Simulations
based on Gillespie’s
algorithm
Spatio-temporal
Dynamics Analysis
using Model Checking
with PRISM and MC2
Automatic Design of
Synthetic Gene
Regulatory Circuits using
Evolutionary Algorithms
APattern
P SystemFormation
Modelling Framework
for Systems
and Synthetic
Biology
in Synthetic
Bacterial
Colonies
13
Outline
A modelling language for the incremental and parsimonious design
of synthetic gene circuits in multicellular systems.
Design of a gene circuit producing the emergence of pattern
formation in synthetic bacterial colonies.
Implementation of our synthetic gene circuit in bacterial colonies of
Escherichia coli.
APattern
P SystemFormation
Modelling Framework
for Systems
and Synthetic
Biology
in Synthetic
Bacterial
Colonies
14
Synthetic Biology:
Learning by building
 Validation of hypothesis about the functioning of cellular systems by
implementing them in vivo.
 Specific pattern formation in several organisms is produced by transcriptional
networks with a double negative feedback loop at their core.
APattern
P SystemFormation
Modelling Framework
for Systems
and Synthetic
Biology
in Synthetic
Bacterial
Colonies
15
Synthetic Double Negative Feedback Loop
AmeR
3OC6
LuxR
PLtet01
luxR
ameR
Plux,R
lacI
cherry
PameABC
luxI
LacI
C4
TetR
Ptac
rhlR
arpR
PrhlA
tetR
gfp
ParpABC
rhlI
RhlR
ArpR
APattern
P SystemFormation
Modelling Framework
for Systems
and Synthetic
Biology
in Synthetic
Bacterial
Colonies
16
AmeR
LuxR
PLtet01
luxR
ameR
Plux,R
lacI
cherry
PameABC
luxI
LacI
C4
Ptac
rhlR
arpR
PrhlA
tetR
gfp
ParpABC
rhlI
RhlR
ArpR
3OC6
C4
C4
APattern
P SystemFormation
Modelling Framework
for Systems
and Synthetic
Biology
in Synthetic
Bacterial
Colonies
17
AmeR
3OC6
LuxR
PLtet01
luxR
ameR
Plux,R
lacI
cherry
PameABC
luxI
gfp
ParpABC
rhlI
TetR
Ptac
rhlR
arpR
PrhlA
tetR
RhlR
ArpR
3OC6
C4
3OC6
C4
3OC6
3OC6
C4
C4
3OC6
APattern
P SystemFormation
Modelling Framework
for Systems
and Synthetic
Biology
in Synthetic
Bacterial
Colonies
18
Pattern Formation in
synthetic bacterial colonies
APattern
P SystemFormation
Modelling Framework
for Systems
and Synthetic
Biology
in Synthetic
Bacterial
Colonies
Pattern Formation in
synthetic bacterial colonies
APattern
P SystemFormation
Modelling Framework
for Systems
and Synthetic
Biology
in Synthetic
Bacterial
Colonies
Potential Issues
o Leakiness in some genes.
o Unintended interactions.
APattern
P SystemFormation
Modelling Framework
for Systems
and Synthetic
Biology
in Synthetic
Bacterial
Colonies
21
Outline
A modelling language for the incremental and parsimonious design
of synthetic gene circuits in multicellular systems.
Design of a gene circuit producing the emergence of pattern
formation in synthetic bacterial colonies.
Implementation of our synthetic gene circuit in bacterial
colonies of Escherichia coli.
APattern
P SystemFormation
Modelling Framework
for Systems
and Synthetic
Biology
in Synthetic
Bacterial
Colonies
22
TAKE HOME MESSAGE
 Development of a synergy between gene circuit
design/modelling and wet lab implementation.
Development of a modelling language close to the lab protocols.
Development of wide library of molecular parts/modules from
different organisms.
Application of novel techniques for controlling synthetically
gene networks.
APattern
P SystemFormation
Modelling Framework
for Systems
and Synthetic
Biology
in Synthetic
Bacterial
Colonies
Download
Related flashcards

Bacteriology

13 cards

Bacteria

13 cards

Bacteria

27 cards

Cyanobacteria

72 cards

Phototrophic bacteria

15 cards

Create Flashcards