Presentación de PowerPoint

advertisement
MARKER ASSISTED SELECTION
PLANT GENETICS RECITATION
March 8th 2012
Why marker assisted selection?
MARKER ASSISTED SELECTION
• Individuals carrying the trait of interest
are selected based on a marker which is
linked to the trait and not on the trait
itself.
• Indirect selection.
• Useful when the trait is difficult to
measure, and/or is evident only at late
developmental stages.
Facult.
Tremois
88Ab536
Dicktoo
Igri
Strider
OSU11
Nure
Kompolti
Winter
Harrington
Morex
Triumph
Spring
ZCCT-H
HvSnf2
1R.OWB.Aglu4.T7
2R.OWB.Aglu4.T7
1OWBD.Aglu4.T7
2OWBDAglu4.T7
SNP2
SNP3
SNP4
BstUI/HhaI
Fnu4HI
AACTTATACGCGCCCAGCCGGACGCCGGTCATCGGCAAGGTGGTCTTCATGGGGCTGCAG
AACTTATACGCGCCCAGCCGGACGCCGGTCATCGGCAAGGTGGTCTTCATGGGGCTGCAG
AACTCATACGCGCCCAGTCGGACGCCGGTCATCGGCAAGGTGGTCTTCATGGGGATGCAG
AACTCATACGCGCCCAGTCGGACGCCGGTCATCGGCAAGGTGGTCTTCATGGGGATGCAG
**** ************ ************************************ *****
I
I I K I K I
I K
Kurtford iBison
1H+4H+5H
The barley stripe rust resistance story
~ 1987
BARLEY STRIPE RUST
www.barleyworld.org
BARLEY STRIPE RUST
• Caused by fungus Puccinia striiformis f.
sp. hordei
• Common in Mexico and South America
but usually not in Oregon.
• It first appeared in the US in 1991
• When infection is severe, losses of 50%
are common
BARLEY STRIPE RUST
• Resistant cultivars are available
• It is necessary to develop resistant
cultivars adapted to different barley
growing areas
• Resistance to the disease is a
quantitative trait (non-Mendelian
inheritance)
• Three Quantitative Trait Loci (QTL) for
stripe rust resistance have been mapped
and their effects validated.
• There are molecular markers located in
the target regions of the three QTL
Race characterization of BSR isolates from Huancayo, Peru. 2007
Isolate ID
Int-061
Int-062
Int-048
Origin
Peru
Peru
Peru
1
Topper
9
9
9
2
Heils
Franken
8
7
7
3
Emir
4
Astrix
5
Hiproly
6
Vanrunda
2
7
6
7
8
8
8
8
7
8
8
8
7
Abed
Binder 12
9
9
9
8
Trumpf
9
Mazurka
10
Bigo
11
I5
12
Bancroft
Virulence Formula
PSH race
9
9
9
3
6
8
8
8
7
2
2
2
9
8
4
1,2,4,5,6,7,8,10,12
1,2,3,4,5,6,7,8,9,10,12
1,2,3,4,5,6,7,8,9,10,12
New
New
New
Cali-sib x Bowman
Shyri x Galena
BSR-45
CI10587 x Galena
D1-72
Harrington
D3-6
Baronesse
Orca
BCD
BCD47
AJO
DB
BCD12
D3-6/B23
BU
OPS
D3-6/B61
iBISON and BISON
iBISON
BISON
1H
0
7
12
18
22
25
26
29
30
36
48
54
58
61
68
73
86
87
96
101
111
119
121
122
130
133
136
2H
BCD1434
DsT-66
Act8A
RbgMD
MWG837B
scind00046
ABC165C
Bmac0399
GBM1007
BCD098
GBM1042
BG367013
Bmag0211
BG369940
GBM1051
ABC160
JS10C
Bmac0144A
MWG706A
KFP170
Blp
ABC261
MWG2028
KFP257B
WMC1E8
MWG912
ABG387A
scssr04163
scssr08238
3H
0
5
7
17
DsT-1
ABG058
scind02622
ABG008
36
39
42
45
56
scssr10226
scssr07759
GBM1066
Pox
scssr03381
scssr12344
scssr02236
Ebmac0684
BCD1434.2
ABG356
GBM1023
scsnp03343
vrs1
Bmag0125
DsT-41
MWG503
GBM1062
KFP203
MWG882A
ABG1032
ABG072
Ebmc0415
cnx1
Zeo1
GBM1019
Aglu5F3R2
MWG720
GBM1012
wst7
scssr08447
MWG949A
63
65
68
71
83
88
94
97
102
103
104
108
117
124
137
139
149
161
163
165
170
173
179
180
0
4H
BCD907
26
30
33
36
39
42
58
61
66
69
73
ABC171A
GBM1074
scssr10559
MWG798B
Dst-27
BCD706
DsT-39
alm
Bmac0209
ABC325
DsT-67
87
89
98
scssr25691
ABG377
Bmag0225
121
124
125
Act8C
ABG499
GBM1043
151
155
scsnp23255
ABG004
166
172
scind02281
MWG883
181
DsT-24
190
HVM62
199
DsT-40
212
218
ABC172
scssr25538
DsT-35
0
21
24
29
30
31
35
39
41
44
49
50
52
60
62
67
74
80
83
92
94
95
101
111
112
116
124
5H
MWG634
MWG077
HVM40
DsT-29
CDO542
CDO122
hvknox3
Dhn6
ABC303
scssr20569
CDO795
HVM3
DST-46
scind03751
scssr18005
Tef2
GBM1020
Bmag0353
scind10455
DsT-79
scssr14079
ABG472
GBM1059
KFP221
Ebmac0701
MWG652B
GBM1048
Hsh
HVM67
KFP241.1
ABG601
6H
0
6
8
11
12
scssr02306
MWG618
DsT-6
ABC483
ABG610
37
44
45
53
55
56
58
ABG395
scssr02503
scssr18076
Bmac0096
NRG045A
scsnp04260
Ale
79
82
85
90
100
ABC302
scind16991
scssr15334
scsnp06144
srh
111
scssr05939
120
128
134
141
RSB001A
scsnp00177
0SU-STS1
ABG003B
157
166
169
170
179
193
197
198
205
207
215
223
224
225
scssr10148
Tef3
MWG877
BE456118A
ABG496
scsnp02109
E10757A
ABG391
JS10B
ABC622
DsT-33
Bmag0113C
MWG602A
scssr03907
scssr03906
0
4
31
35
42
45
51
61
65
68
70
71
81
88
92
99
101
122
123
126
132
135
143
145
146
152
159
160
162
163
167
7H
MWG620
Bmac0316
scssr09398
MWG652A
MWG602B
scind60002
JS10A
GBM1021
GBM1068
BG299297
HVM31
rob
Bmag0009
scssr02093
ABG474
Bmac0218C
ABG388
scsnp21226
MWG820
GBM1008
scssr05599
MWG934
scind04312b
scssr00103
GBM1022
Bmac0040
DsT-18
DsT-32B
DsT-22
DsT-28
scind60001
DsT-74
MWG514
MWG798A
DsT-71
0
14
20
29
36
38
44
57
66
68
69
73
82
86
97
98
103
115
117
125
126
127
137
139
ABG704
Bmag0007
scind00694
AW982580
MWG089
CDO475
ABG380
BE602073
scssr07970
scsnp00460
ABC255
ABC165D
HvVRT2
scssr15864
GBM1030
scsnp22290
MWG808
DAK642
scind00149
scsnp00703
MWG2031
RSB001C
nud
lks2
ABC1024
Bmag0120
DsT-30
WG380B
ABC310B
Ris44
167
171
178
ABG461A
WG380A
GBM1065
196
197
199
HVM5
scssr04056
KFP255
ThA1
89
Disease severity of barley stripe rust resistance QTL isolines. 2006
Accession
1H
4H
5H
7H
1H + 4H
1H + 5H
4H + 5H
1H + 4H + 5H
BCD12 (1H)
BCD 47 (4H + 5H)
Baronesse
CI10587 (7H)
Huancayo,
Peru
20
5
40
0
10
50
15
0
15
15
50
10
Toluca,
Mexico
45
1
60
1
1
20
33
1
1
25
80
1
Corvallis,
USA
20
20
50
1
20
40
70
0
15
15
80
5
Mean ±
std. error
28 ± 8.3
9 ± 5.8
50 ± 5.8
1 ± 0.3
10 ± 5.5
37 ± 8.8
39 ± 16.2
0.3 ± 0.3
10 ± 4.7
18 ± 3.3
70 ± 10
5 ± 2.6
BARONESSE
BISON1H
BISON4H
BISON1H+4H
BISON5H
BISON1H+5H
BISON4H+5H
BISON1H+4H+5H
BISON7H
BCD12
BCD47
a
a
a
a
a
a
a
a
a
b
a
a
a
a
b
b
a
a
a
b
a
b
a
a
96.854 a
96.854 a
99.052 a
a
a
a
b
a
a
b
a
a
a
a
a
a
a
a
b
a
a
b
a
a
a
a
a
a
a
a
b
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
b
a
a
a
a
a
a
a
a
a
b
a
cM
a
a
a
a
a
a
a
a
a
a
a
a
ch
a
a
a
a
a
a
a
a
a
a
a
a
EBmac701
1_1292
4H
95.786
4H
2_0838 4H
2_0454 4H
baal29j18 *
A
A
B
EBmac635
EBmac701
HVM03
Bmac181
Bmac030B
EST4535
1_1292 –EST4535
*k07229
GBM1071
baal29j18
baal29j18 MWG2180
HvMLO3
Bmac310
*k03352
GBM1015
Bmag419
HvSnf2
HdAmyB
EBmac635
EST4535
1_1292 –EST4535
*k07229
baal29j18
HvMLO3
*k03352
B
C
GBM1015
D
DE DE
DEF
BCD47
BCD12
F
7H
1H+4H+5H
4H+5H
5H
1H+5H
EF
1H+4H
70
60
50
40
30
20
10
0
4H
104.585
109.082
110.169
111.256
112.343
113.430
114.517
115.604
115.604
116.685
1H
4H
4H
4H
4H
4H
4H
4H
4H
4H
4H
Baronesse
1_1194
1_0712
1_1235
2_0883
1_0697
2_0224
2_0760
2_0007
1_0610
2_0932
HVM40
GBM1071
MWG2180
Bmac310
Bmag419
HvSnf2
HdAmyB
14
a
a
a
a
a
a
a
b
a
b
a
a
12
a
a
a
a
a
a
a
a
a
a
a
a
10
a
a
a
a
a
a
a
a
a
a
a
a
8
a
a
a
a
a
a
a
a
a
b
a
a
6
a
a
a
a
a
a
a
a
a
a
a
a
71.250
75.671
75.671
79.006
81.204
82.291
83.378
84.465
84.465
91.373
92.460
93.547
4
a
a
a
a
a
a
a
a
a
a
a
a
4H
4H
4H
4H
4H
4H
4H
4H
4H
4H
4H
4H
2
SSR markers
used for MAS
a
a
a
a
a
a
a
a
a
a
a
a
1_1513
2_0207
1_0309
2_1332
1_0170
1_1526
1_1213
2_0765
1_1398
2_0732
1_1168
1_0785
ORO
HVM03
Bmac181
Bmac030B
0
Chr. 4H
P-OPA 1 + 2 map
OWB
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
b
a
a
a
b
b
b
b
a
a
b
a
b
a
b
a
a
b
a
b
a
b
a
a
a
b
a
a
b
a
a
a
b
b
a
a
a
a
a
b
b
b
a
a
b
a
b
a
b
a
a
b
a
b
a
b
a
a
a
b
a
a
b
a
a
a
b
b
Unmapped in OWB
2_0749
2_0749
BCD47
b
a
a
a
a
b
b
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
BCD12
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
b
a
a
b
a
a
a
-
BISON7H
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
b
a
a
a
b
a
a
a
a
a
a
a
a
BISON5H
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
BISON4H+5H
b
a
a
a
a
b
b
b
b
a
a
b
a
b
a
b
a
a
b
a
b
a
a
a
a
a
b
a
a
a
a
a
a
a
a
BISON4H
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
BISON1H+5H
b
a
a
a
a
b
b
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
BISON1H+4H+5H
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
BISON1H+4H
1.087
6.775
7.862
8.949
11.147
14.432
33.230
46.833
47.920
51.254
51.254
52.341
52.341
56.839
57.926
57.926
59.013
61.211
61.211
62.298
65.632
65.632
67.831
67.831
68.918
70.005
72.203
76.700
78.874
78.874
79.961
81.048
83.246
83.246
90.021
BISON1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
Baronesse
cM
2_0275
1_1311
1_0410
1_0636
1_1011
2_1226
2_0712
1_0760
1_0814
1_1357
1_1498
2_0514
1_1266
1_0294
1_1209
2_0810
1_1107
1_1217
2_1217
1_1256
1_0768
1_1444
1_0201
2_1463
1_0617
1_0302
2_1431
1_1367
2_0696
1_0166
1_1075
1_1267
2_0121
1_0279
1_0466
BARONESSE
BISON1H
BISON4H
BISON1H+4H
BISON5H
BISON1H+5H
BISON4H+5H
BISON1H+4H+5H
BISON7H
BCD12
BCD47
ch
Chr. 1H
P-OPA 1 + 2 map
OWB
a
b
b
b
b
a
a
a
a
b
a
Unmapped in OWB
Baronesse
BISON1H
BISON1H+4H
BISON1H+4H+5H
BISON1H+5H
BISON4H
BISON4H+5H
BISON5H
BISON7H
BCD12
BCD47
2_0749
2_0749
Morex x Barke
a
b
b
b
b
a
a
a
a
b
a
1_1223
2_1067
1_0410
2_0865
1_1011
1_0716
2_1226
2_0665
2_0318
2_0749
2_0749
2_0371
2_0712
2_0767
1_0760
2_1072
1_0764
2_0514
2_1134
1_1301
1_1287
2_1357
1_0075
2_0609
1_0293
2_1217
2_1312
1_0324
1_0198
1_1248
1_0768
2_1333
1_0201
1_0617
1_1049
2_1306
2_1431
1_0002
1_1367
1_0166
1_0463
2_0229
2_1126
0.0
1.1
3.3
4.4
5.5
7.7
8.7
10.9
17.9
20.0
21.1
25.6
27.8
36.0
37.1
45.2
46.3
47.4
51.9
53.0
55.2
56.3
57.4
58.5
60.6
61.7
62.8
63.9
65.0
66.1
68.3
69.4
70.5
73.8
77.1
78.2
OWB
bPb-6318
bPb-7112
1_0460
1_0410
1_0636
1_1011
bPb-1318
2_1226
[222208]
[222789]
MWG837B
scind00046
[223986]
Bmac0399
GBM1007
2_0712
BCD098
bPb-3217
1_0760
GBM1042
1_0238
2_0514
1_0294
1_1287
1_1301
2_1357
2_1312
1_1107
2_1217
1_0293
1_0198
2_1333
1_0768
1_0201
1_0617
1_1049
2_1131
2_1431
1_1367
1_0002
ABC160
1_0166
1_0463
0.0
1.1
6.8
7.9
8.9
11.1
12.2
14.4
17.8
18.9
22.2
25.5
26.6
28.8
29.9
33.2
35.4
42.3
46.8
47.9
51.3
52.3
56.8
57.9
59.0
61.2
62.3
65.6
67.8
68.9
70.0
72.2
76.7
77.8
78.9
BCD47
BCD12
BISON7H
BISON1H+4H+5H
BISON4H+5H
BISON1H+5H
BISON5H
BISON1H+4H
BISON4H
BISON1H
BARONESSE
cM
ch
b
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
b
a
a
a
a
a
a
a
a
a
b
a
a
a
a
a
a
a
1H 12.234
2_1226 1H 14.432 a
b
a
b
a
a
a
b
a
b
a
b
b
a
a
b
b
a
a
b
a
a
a
b
b
a
a
b
b
a
b
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
b
b
a
a
b
a
b
a
b
a
a
b
a
b
a
a
a
a
a
b
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
b
a
a
a
b
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
b
a
a
b
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
b
b
a
a
b
a
b
a
b
a
a
b
a
b
a
b
a
a
a
b
a
a
b
b
b
a
a
b
a
b
a
b
a
a
b
a
b
a
b
a
a
a
b
a
a
b
Act8
MWG837 1H
2_0749 1H
2_0749*
1_0760
1_0814
1_1357
1_1498
2_0514
1_1266
1_0294
1_1209
2_0810
1_1107
1_1217
2_1217
1_1256
1_0768
1_1444
1_0201
2_1463
1_0617
1_0302
2_1431
1_1367
2_0696
1_0166
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
1H
35.428
46.833
47.920
51.254
51.254
52.341
52.341
56.839
57.926
57.926
59.013
61.211
61.211
62.298
65.632
65.632
67.831
67.831
68.918
70.005
72.203
76.700
78.874
78.874
act8
Act8
MWG837
MWG837
22.188
a
2_0712 1H 33.230 a
BCD098
RGA54
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
2_0749*
2_0749*
BMAC213
BCD098
BCD098
2_0749* Inferred position
BMAC222
E33M42h
BMAC90
ABC160
25
a
a
a
a
a
20
b
a
a
a
a
15
a
a
a
a
a
5
1H 1.087
1H 6.775
1H 7.862
1H 8.949
1H 11.147
0
2_0275
1_1311
1_0410
1_0636
1_1011
Shyri x Galena
10
Chrom. 1H
P-OPA 1 + 2 map
OWB
P-OPA 1 + 2 map
ch
cM
BARONESSE
BISON1H
BISON4H
BISON1H+4H
BISON5H
BISON1H+5H
BISON4H+5H
BISON1H+4H+5H
BISON7H
BCD12
BCD47
5H
5H
5H
5H
5H
5H
5H
5H
5H
5H
5H
5H
5H
5H
5H
5H
5H
5H
5H
70.895
74.230
74.230
81.137
82.224
83.311
86.646
92.179
95.513
95.513
96.600
99.885
103.220
107.717
111.052
112.139
113.226
114.313
114.313
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
b
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
b
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
b
a
a
a
a
a
b
a
a
a
b
a
b
a
a
a
b
a
b
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
b
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
b
a
a
a
a
a
b
a
a
a
b
a
b
a
a
a
b
a
b
a
a
a
a
a
b
a
a
a
b
a
b
a
a
a
b
5H
5H
5H
5H
5H
5H
5H
5H
5H
5H
114.313
114.313
122.307
123.394
124.481
126.680
127.767
129.965
132.163
133.244
141.402
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
b
a
a
a
a
a
b
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
b
b
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
a
b
b
a
a
a
a
a
b
a
a
b
b
a
a
a
a
a
b
a
a
1_0641
1_1249
1_0548
2_0297
1_0953
2_0818
2_1133
2_0246
1_0140
1_1515
2_1186
1_1135
1_0674
1_0524
1_0930
1_0578
1_0771
2_0449
srh
1_0518
1_1350
2_0403
2_0134
1_0024
1_0844
1_0507
1_0477
1_1341
1_1245
14
Ale
14
b
b
a
a
b
a
b
a
a
12
b
b
a
b
b
a
b
a
a
12
a
a
a
a
a
a
a
a
a
10
a
a
a
a
a
a
b
a
a
10
b
b
a
a
b
a
b
a
a
8
b
b
a
a
b
a
b
a
a
8
b
b
a
a
b
a
b
a
a
6
a
a
a
a
a
a
a
a
a
6
a
a
a
a
a
a
a
a
a
4
a
a
a
a
a
a
a
a
a
4
a
a
a
a
a
a
a
a
a
2
59.928
63.262
63.262
65.460
65.460
66.547
66.547
67.634
70.895
2
5H
5H
5H
5H
5H
5H
5H
5H
5H
0
1_1260
2_0396
2_0059
2_0105
2_1536
1_1151
1_0237
1_1523
2_1036
Cali sib x
Bowman
0
OWB
Chrom.
5H
ABC164b
PR168a
ABC164b
ABG387c
HVM2A
PR168a
ABG387c
Ale
HVM2A
HVLEU
Ale
HVLEU
CDO57
CDO57
ABC168
WG364b
ABC168
WG364b
1H
0
7
12
18
22
25
26
29
30
36
48
54
58
61
68
73
86
87
96
101
111
119
121
122
130
133
136
2H
BCD1434
DsT-66
Act8A
RbgMD
MWG837B
scind00046
ABC165C
Bmac0399
GBM1007
BCD098
GBM1042
BG367013
Bmag0211
BG369940
GBM1051
ABC160
JS10C
Bmac0144A
MWG706A
KFP170
Blp
ABC261
MWG2028
KFP257B
WMC1E8
MWG912
ABG387A
scssr04163
scssr08238
3H
0
5
7
17
DsT-1
ABG058
scind02622
ABG008
36
39
42
45
56
scssr10226
scssr07759
GBM1066
Pox
scssr03381
scssr12344
scssr02236
Ebmac0684
BCD1434.2
ABG356
GBM1023
scsnp03343
vrs1
Bmag0125
DsT-41
MWG503
GBM1062
KFP203
MWG882A
ABG1032
ABG072
Ebmc0415
cnx1
Zeo1
GBM1019
Aglu5F3R2
MWG720
GBM1012
wst7
scssr08447
MWG949A
63
65
68
71
83
88
94
97
102
103
104
108
117
124
137
139
149
161
163
165
170
173
179
180
0
4H
BCD907
Flanking
markers in
each target
region
26
30
33
36
39
42
58
61
66
69
73
ABC171A
GBM1074
scssr10559
MWG798B
Dst-27
BCD706
DsT-39
alm
Bmac0209
ABC325
DsT-67
87
89
98
scssr25691
ABG377
Bmag0225
121
124
125
Act8C
ABG499
GBM1043
151
155
scsnp23255
ABG004
166
172
scind02281
MWG883
181
DsT-24
190
HVM62
199
DsT-40
212
218
ABC172
scssr25538
DsT-35
0
21
24
29
30
31
35
39
41
44
49
50
52
60
62
67
74
80
83
92
94
95
101
111
112
116
124
5H
MWG634
MWG077
HVM40
DsT-29
CDO542
CDO122
hvknox3
Dhn6
ABC303
scssr20569
CDO795
HVM3
DST-46
scind03751
scssr18005
Tef2
GBM1020
Bmag0353
scind10455
DsT-79
scssr14079
ABG472
GBM1059
KFP221
Ebmac0701
MWG652B
GBM1048
Hsh
HVM67
KFP241.1
ABG601
6H
0
6
8
11
12
scssr02306
MWG618
DsT-6
ABC483
ABG610
37
44
45
53
55
56
58
ABG395
scssr02503
scssr18076
Bmac0096
NRG045A
scsnp04260
Ale
79
82
85
90
100
ABC302
scind16991
scssr15334
scsnp06144
srh
111
scssr05939
120
128
134
141
RSB001A
scsnp00177
0SU-STS1
ABG003B
157
166
169
170
179
193
197
198
205
207
215
223
224
225
scssr10148
Tef3
MWG877
BE456118A
ABG496
scsnp02109
E10757A
ABG391
JS10B
ABC622
DsT-33
Bmag0113C
MWG602A
scssr03907
scssr03906
0
4
31
35
42
45
51
61
65
68
70
71
81
88
92
99
101
122
123
126
132
135
143
145
146
152
159
160
162
163
167
7H
MWG620
Bmac0316
scssr09398
MWG652A
MWG602B
scind60002
JS10A
GBM1021
GBM1068
BG299297
HVM31
rob
Bmag0009
scssr02093
ABG474
Bmac0218C
ABG388
scsnp21226
MWG820
GBM1008
scssr05599
MWG934
scind04312b
scssr00103
GBM1022
Bmac0040
DsT-18
DsT-32B
DsT-22
DsT-28
scind60001
DsT-74
MWG514
MWG798A
DsT-71
0
14
20
29
36
38
44
57
66
68
69
73
82
86
97
98
103
115
117
125
126
127
137
139
ABG704
Bmag0007
scind00694
AW982580
MWG089
CDO475
ABG380
BE602073
scssr07970
scsnp00460
ABC255
ABC165D
HvVRT2
scssr15864
GBM1030
scsnp22290
MWG808
DAK642
scind00149
scsnp00703
MWG2031
RSB001C
nud
lks2
ABC1024
Bmag0120
DsT-30
WG380B
ABC310B
Ris44
167
171
178
ABG461A
WG380A
GBM1065
196
197
199
HVM5
scssr04056
KFP255
ThA1
89
Three resistance genes in chromosome 1H, 4H and 5H
THE PROBLEM
KURTFORD
• 6 –rowed hooded feed barley
• Well adapted to California conditions
• Short height
• Stripe Rust Susceptible
iBISON 1H+4H+5H
• Resistance alleles for the three genes
• 2–rowed awned barley; short height
SOLUTION: The Kurtford Conversion
Year 1
I Bison
1H
4H
X
5H
Kurtford
1H
RR RR RR
4H 5H
SS SS SS
F1 heterozygote at 3
BSR resistance loci
RS RS RS
X
Kurtford
1H 4H
5H
SS SS SS
BC1F1
12.5% of plants expected
to be heterozygote at 3
BSR resistance loci.
Segregation in each locus:
½ RS
½ SS
Summer – Fall 2007
We have 589 BC1F1 seeds and we expect to find around 74 target
heterozygotes at the 3 BSR resistance loci.We need:
-Confirm choice of markers
-DNA extraction for 589 plants
-Genotyping for the 3 BSR resistance regions
-Selection of targeted genotypes
1H
4H
5H
Bmag399
EST4535
Bmag337
EST4473
Baal29j18
Bmag223
Bags 4e
Bmag812
.
MAS1
I
I I K I K I
I K
Kurtford iBison
1H+4H+5H
5H
BMAG337
5H
Bmag812
5H
Bmag223
4H
Bags 4e
4H
Baal29j18
4H
EST4535, 1F/5R, NarI
1H
Bmag399
1H
EST4473, 1F/4R, BanII
Plant Number
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
I
K
K
I
I
I
K
K
K
I
K
I
I
I
I
K
K
K
I
I
I
K
K
I
I
I
K
K
K
K
K
I
I
I
I
K
K
K
I
K
K
K
I
K
I
I
K
I
K
K
I
K
I
I
I
K
I
K
I
I
K
K
I
K
I
I
K
I
K
K
I
K
I
I
I
K
I
K
I
I
K
K
I
K
I
I
K
I
K
K
I
K
I
I
I
K
I
K
I
I
I
I
K
K
I
K
I
I
I
I
I
I
I
I
K
I
K
I
I
I
I
I
K
K
I
K
K
I
I
I
I
K
I
I
K
I
K
I
I
I
K
K
K
I
I
I
K
I
K
K
I
I
K
I
K
K
K
I
K
Winter 2008
1.
2.
3.
Selection of heterozygotes (~74)
10 seeds per selected plant ~ 740 BC1F2 plants.
Grow out and genotype
BC1F2 plants segregating in each
locus:
¼ RR ½ RS ¼ SS
We expect 25% of the BC1F2 to be homozygous
for AT LEAST the 4H region (~ 185). Of these:
~ 104 homozygote only for 4H
~ 35 homozygote for 4H and 1H
~ 35 homozygote for 4H and 5H
~ 11 homozygote for 1H, 4H and 5H
25/64 (~ 38%) of the
resistant plants will
be homozygous
hooded
MAS2
Winter 2008/2009 – seed increase
Summer 2009 – validate resistance
~ 70 homozygous hooded, BSR resistant plants
Field
test
Abundant, gene-based markers make MAS more effective
and informative
What makes a trait quantitative and not qualitative?
Successful MAS may precede gene characterization
Phenotypic performance is the ultimate measure of agronomic worth
MAS - coming to a field near you
Download
Related flashcards

Pediatrics

67 cards

Breastfeeding

11 cards

Tourette syndrome

17 cards

Create Flashcards