DNA barcoding the flora of Wales

advertisement
Barcode Wales: DNA
barcoding the flora of Wales
Natasha de Vere, Tim Rich, Col Ford, Sarah Trinder, Charlie Long, Chris
Moore, Danielle Satterthwaite, Helena Davies, Joe Moughan, Addie
Griffith, Laura Jones, Joel Allainguillaume, Mike Wilkinson, Kevin Walker,
Tatiana Tatarinova, Hannah Garbett, Les Baillie, Jenny Hawkins
DNA barcoding
• DNA based species
identification
• Once reference
barcodes are
established will
always be able to
identify that species
• Internationally agreed
regions of DNA used:
rbcL & matK for
plants
• Open science
>Cotoneaster_cambricus
AGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATT
ATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTG
ATATTTTGGCAGCATTTCGAGTAACTCCTCAACCTGGAGTTCCAC
CTGAGGAAGCAGGGGCCGCGGTAGCTGCTGAATCTTCTACTGGT
ACATGGACAACTGTATGGACTGACGGTCTTACCAGTCTTGATCGT
TACAAAGGTCGATGCTACCACATCGAGCCTGTTGCTGGAGAAGA
AAGTCAATTTATTGCTTATGTAGCTTACCCCTTAGACCTTTTTGAA
GAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTGT
TTGGGTTCAAGGCCCTGCGCGCTCTACGTCTGGAGGATTTGCGA
ATCCCTACTGCTTATGTTAAAACTTTCCAGGGCCCGCCTCATGGT
ATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGCCGCCCTCT
ATTGGGATGTACTATAAAACCAAAATTGGGGTTATCCGCTAAGAA
TTACGGTAGAGCAGTTTATGAATGTC
What do they eat?
What’s in this?
What pollen is it carrying?
Is this legal?
Barcode Wales: Cod Bar Cymru
• DNA barcode the
native flowering
plants and conifers
of Wales
• Develop
applications that
utilise this research
platform
Sample collection
• 1143 native flowering
plants and conifers
• 4272 individuals sampled,
3637 herbarium, 635
freshly collected
• All specimens verified by
taxonomic expert
• Herbarium vouchers and
full collection details for
all samples
DNA barcoding protocol
• DNA extraction: Qiagen
kits, modified for
herbarium material
• Amplification: rbcL 5 &
matK 23 primer
combinations
• Sanger sequencing
• Manual editing, multiple
alignment
• Sequences uploaded
onto BOLD & GenBank –
publically available
de Vere N, Rich TCG, Ford CR, Trinder SA, Long C, et al.
(2012) DNA Barcoding the Native Flowering Plants and
Conifers of Wales. PLoS ONE 7(6): e37945.
Recoverability
rbcL
matK
rbcL & matK
No. of spp. sequenced (1143)
1117 (98%)
1031 (90%)
1025 (90%)
No. of spp. with > 1 individual
sequenced
1041 (91%)
814 (71%)
808 (71%)
Mean no. of individuals per
spp.
3
2
2
Mode of individuals per spp.
3
3
3
Range of individuals per spp.
1-9
1-8
1-8
Total no. of individuals
sequenced
3304
2419
2349
In total 5,723 barcode sequences obtained for the 1143 species
Effect of herbarium specimen age
Spearman Rank
Correlation:
rbcL rho =
0.993***
matK rho =
0.986***
Relative discrimination
808 species with multiple individuals sequenced for both rbcL &
matK
69
99
75
68
74
56
57
100
98
99
96
95
rbcL & matK discrimination
Scale
n
Mean
discrimination %
(SD)
10x10 km
253
82 (3)
2x2 km
1116
93 (6)
Species lists generated for each square,
discrimination assessed by presence of a
barcode gap
Roots, shoots and pollen
• Root analysis
• Identification at
single pollen
grain resolution
• Identification of
pollen products
Gives a feeling “of
Youthful Exuberance!”
Honey and drug discovery
• Collect honey from
throughout the UK.
• Test antibacterial properties
of honey against MRSA and
Clostridium difficile.
• DNA barcode honey using
next generation DNA
sequencing (454).
• Identify plant derived
phytochemicals that
increase antimicrobial
activity.
MRSA – prelim results
DNA barcoding and phylogenetics
ML tree for rbcL,
RAxML (GTR+CAT)
1000 bootstraps, on the
CIPRES supercomputer
cluster
56% of species form
monophyletic groups
44% with bootstrap support
>70%
DNA barcoding and phylogenetic
ecology
ML tree for rbcL, threatened species
traced using Mesquite
What’s next?
• Barcode UK
• Barcode Alien
• Phylogeny for the
UK flora
• Development of
bioinformatic tools
• Diet analysis of
endangered
species
• Pollinator services
Thank you!
• Funding from Welsh Government, National
Botanic Garden of Wales, National Museum
Wales, Countryside Council for Wales
• Sponsorship from the people of Wales
• www.gardenofwales.org.uk
• Science at the Garden of Wales on Facebook
Download
Related flashcards

Rose cultivars

52 cards

Peptide hormones

66 cards

Peptides

79 cards

Dipeptides

12 cards

Create Flashcards