Review: • We extracted DNA from wheat germ • And discovered that the color of DNA is … WHITE! • No matter what organism it comes from, DNA in a tube looks the same! Salk Institute Mobile Lab So how can scientists tell different DNA apart? Salk Institute Mobile Lab So how can scientists tell different DNA apart? • Remember that DNA is a long molecule of A, T, G, C ATTTCGCAAT TAGGCATCGGACGTAGCC TAGGCAGTCGATCGTCAGTCTTC TAACCGGATACCAGACCAGGTCCCG TTAACGCGGATATAGCCTGTCAGCTGAT GGACATCGACTCTGAACTCGACACATCCCT TAACCGATCGTCTCTGACCTCGACCTGACG CGGTAACTGATCTCCCGATCCCCGATCCTGA TGACACAGCTCGACTCCGACATCGCCCAGC TTAAGCTACGGGACTAGCATCGATCGATCG TTGACCAGCTAGCTCTGACCTCGACCTGAC CGGGATAGCTCTAGCTCTGAGAGCTCG TGAAACCGTAAAATCGTCTCTGATATAG CCCGACCTTCGGATATACGTTCTG TTAGACTGTGACAGCTTAGC TAGCGGTAGATCGA TAGCT Salk Institute Mobile Lab + Restriction Enzymes which act like Chemical “scissors” So how can scientists tell different DNA apart? • Remember that DNA is a long molecule of A, T, G, C CAT CAT ATGGTACGCATGGTCTCGAGCATAGCTTTCATGGCTT CAT Salk Institute Mobile Lab Result: • Lots of different size pieces of DNA CTCGACCTCAT Salk Institute Mobile Lab Next step is to sort the pieces by size using Gel Electrophoresis CTCGACCTCAT Salk Institute Mobile Lab Gel Electrophoresis • Gel is made from Agarose powder which comes from seaweed DNA pieces go here Bigger pieces Smaller pieces Apply electricity DNA pieces separated by SIZE! Salk Institute Mobile Lab So how do scientists tell different DNA apart? • Everyone’s DNA is unique! – So everyone’s DNA gets cut up differently! Different DNA samples Bigger pieces Smaller pieces Apply electricity Different Patterns! Salk Institute Mobile Lab DNA Fingerprinting • Unique DNA = Unique patterns – Just like your fingerprints are unique! Different DNA samples Bigger pieces Smaller pieces Apply electricity Different Patterns! Salk Institute Mobile Lab DNA Fingerprinting • Unique DNA = Forensic Unique patterns Scientists use it to solveare unique! – Just like your fingerprints crime scenes Different DNA samples Bigger pieces Smaller pieces Apply electricity Marine Biologists use it to identify new species Different Patterns! Salk Institute Mobile Lab • In labs we use a carcinogen called EtBr to make the DNA show up • Food color dyes have their own color! Salk Institute Mobile Lab Who should understand DNA? Salk Institute Mobile Lab