696
Exposure to Phosphodiesterase Type 5 Inhibitors Stimulates
Aromatase Expression in Human Adipocytes in vitro
jsm_2152
696..704
Antonio Aversa, MD, PhD,* Massimiliano Caprio, MD, PhD,† Antonella Antelmi, BSc,†
Andrea Armani, BSc, PhD,† Marina Brama, BSc,* Emanuela A. Greco, MD, PhD,*
Davide Francomano, MD,* Matilde Calanchini, MD,‡ Giovanni Spera, MD,* Luigi Di Luigi, MD,§
Giuseppe M.C. Rosano, MD, PhD,† Andrea Lenzi, MD,* Silvia Migliaccio, MD, PhD,*§ and
Andrea Fabbri, MD, PhD‡
*Department of Experimental Medicine, Section of Medical Pathophysiology—“Sapienza” University of Rome, Rome,
Italy; †Centre for Clinical and Basic Research—IRCCS San Raffaele Pisana, Rome, Italy; ‡Endocrinology Unit,
Sant’Eugenio & CTO A. Alesini Hospital, “Tor Vergata” University of Rome, Rome, Italy; §Department of Health Sciences,
Endocrinology Unit, “Foro Italico” University of Rome, Rome, Italy
DOI: 10.1111/j.1743-6109.2010.02152.x
ABSTRACT
Introduction. Prolonged tadalafil administration in men with erectile dysfunction is associated with increased
testosterone (T): estradiol (E2) ratio mainly related to reduction of E2 levels.
Aim. To investigate the presence of phosphodiesterase type 5 (PDE5) isoenzyme in primary human visceral
adipocytes and whether different PDE5 inhibitors (PDE5i) could directly modulate aromatase (ARO) expression in
differentiated human visceral adipocytes in culture.
Main Outcome Measures. PDE5 mRNA and protein expression in primary human visceral adipocytes as well as
mRNA and protein expression of ARO, with functional activity after selective PDE5 blockade by tadalafil and
sildenafil.
Methods. Purified primary human visceral pre-adipocytes were differentiated ex vivo and were exposed to tadalafil
or sildenafil (1 mM) for different intervals of time (6-12-24-96 hours). ARO mRNA content and expression were
measured by Western Blot and quantitative reverse transcription-polymerase chain reaction (qRT-PCR), respectively. T and E2 in supernatants were measured by ELISA also in the presence of letrozole.
Results. Differentiated adipocytes were found to express detectable levels of PDE5 transcripts. Acute exposure (6
hours) to both PDE5i tadalafil and sildenafil increased ARO mRNA expression by 4.7- and 2.8-fold, respectively
(P < 0.001). ARO mRNA and protein levels were increased by the treatment with PDE5i in a time- and dosedependent manner. Such effect was mimicked by 8-bromo-cGMP but was lost after 24 and 96 hours; differently, the
PDE3B specific inhibitor milrinone (1 mM), displayed no effect. Accordingly, long-term exposure (24 and 96 hours)
to PDE5i caused a significant increase in E2 concentrations in the supernatant (1.7 and 2 fold, respectively;
P < 0.001), with a parallel reduction of T (15% and 30%, respectively; P < 0.001). Such effect was reversed by the
co-incubation with the specific ARO-inhibitor letrozole.
Conclusions. Our results demonstrate that PDE5 is expressed in human visceral adipocytes and that acute exposure
to PDE5i selectively stimulates ARO expression, which is related to a specific PDE5 blockade. We speculate that
modulation of ARO activity by PDE5i could be one of the mechanisms responsible, at least in part, for the beneficial
effects of PDE5i on endothelial and metabolic functions. Aversa A, Caprio M, Antelmi A, Armani A, Brama M,
Greco EA, Francomano D, Calanchini M, Spera G, Luigi LD, Rosano GMC, Lenzi A, Migliaccio S, and
Fabbri A. Exposure to phosphodiesterase type-5 inhibitors stimulates aromatase expression in human
adipocytes in vitro. J Sex Med 2011;8:696–704.
Key Words. Nitric Oxide; CYP19; Estradiol; Tadalafil; Sildenafil; Endothelial Health; PDE5 Inhibitors; Human
Visceral Adipocytes
The contribution of the first two authors and the last two authors must be considered equal.
J Sex Med 2011;8:696–704
© 2010 International Society for Sexual Medicine
697
PDE5 Inhibitors and Adipose Tissue
Introduction
P
hosphodiesterases (PDEs) catalyze the
hydrolysis of cyclic adenosine monophosphate (cAMP) and cyclic guanosine monophosphate (cGMP) to the corresponding 5′ nucleotide
monophosphate [1]. Currently, 11 different PDEs
families (PDE-1–11) have been characterized
throughout the body, each family containing subfamilies and multiple splice variances; they differ
in selectivity for cyclic nucleotides, sensitivity to
inhibitors and activators, physiological roles, and
tissue distribution. In the last decade, numerous
pharmaceutical compounds that selectively inhibit
the catalytic activities of PDE have been developed
for the treatment of various diseases, but only
PDE type 5 inhibitors (PDE5i) reached clinical
application mainly for treating male erectile dysfunction (ED) [2]. PDE5i inhibit cGMPdependent PDE5 in the penile corporal smooth
muscle, and their efficacy is based on the ability to
block the cGMP breakdown, produced by the
NO-dependent activation of guanylyl cyclase [3].
Prior studies demonstrated that small PDE5
amounts are present in different extra-genital
tissues from humans, i.e., skeletal muscle, heart,
lung, and adrenal gland [4]. Furthermore, the
presence of different PDE5 isoforms (i.e., cGMPdependent PDE5A) in human adipocytes has been
detected [5]. Also, it is known from molecular
cloning and gene structure studies that cAMPdependent PDE3B is widely expressed in human
adipose tissue [6]. In addition, it has been shown
that the in vitro effect of a PDE5i (i.e., sildenafil at
the concentration range of 0.01 to 1.0 mM) on
cAMP levels in cardiac samples is almost equivalent to that of the specific PDE3B inhibitor milrinone, thus suggesting a possible “cross-talk”
between cGMP and cAMP-dependent signal
transduction pathways in different tissues (e.g.,
human cavernous cells, cardiac muscle) [7].
The rationale of this study started from a clinical observation [7] suggesting that the administration of a PDE5i (i.e., tadalafil) in men with ED was
associated with an increase of serum testosterone : estradiol (T/E2) ratio, mainly due to significant reduction of E2 levels [8]. In that study, where
both lean and obese subjects were investigated, no
clear-cut explanation for the observed serum E2
decrease was found as to why this effect might have
occurred. Even if a possible variation of the aromatase (ARO) activity was hypothesized, at the
present time, any potential effect of PDE5i on
ARO has never been demonstrated. On these
bases, this study was designed to confirm the presence of PDE5 in human adipocytes and to further
investigate and characterize the effect of acute and
prolonged exposure to two selective PDE5i (i.e.,
tadalafil and sildenafil) and to a specific PDE3B
inhibitor (i.e., milrinone) on ARO expression and
activity in human primary adipocytes.
Materials & Methods
Cell Cultures
Primary human visceral pre-adipocytes were purchased from Lonza (Basel, Switzerland), and were
grown and differentiated according to the manufacturer’s instructions (as previously described) [9]. In
addition, primary human visceral pre-adipocytes
were isolated from adipose tissue samples obtained
from male patients undergoing abdominal surgery
for inguinal herniation. Patients aged over 60 years
old, or affected by liver disease, renal failure, diabetes, inflammatory and neoplastic disease, or taking
steroids, were excluded. All subjects gave informed
consent before surgery. The study was approved by
the local hospital Ethics Committee. Human
adipose stromal vascular fraction was isolated by
enzymatic digestion and selective culturing techniques, as previously described [10]. Each experiment has been performed from a single donor. We
were able to isolate a stroma-vascular fraction of
approximately overall 150,000 cells from 1 g of fat
tissue. Primary human pre-adipocytes were induced
to differentiate into mature adipocytes by a 3-day
incubation in an adipogenic medium containing
DMEM/Ham F12 supplemented with troglitazone
(1 mg/mL), IBMX (0.2 mmol/L), hydrocortisone
(100 nmol/L), insulin (80 nmol/L), and triiodothyronine (0.2 nmol/L). Cells were then incubated in
the same adipogenic medium lacking IBMX and
troglitazone for a further 7 days. We therefore validated adipose differentiation by measuring adiponectin and PREF-1 mRNA expression (Figure 1).
For a morphological determination of cell lipid
content, cells were fixed in 5% formaldehyde in
phosphate-buffered saline (PBS), washed, and then
stained with oil red-O.
To evaluate potential modifications of ARO
mRNA and protein expression determined by
PDE5i exposure, the cells were treated either with
sildenafil and tadalafil (10 nmol–1 mM), milrinone,
or 8-Br-cGMP (1 mM), a PDE-resistant cyclicGMP analogue, for 6, 24, and 96 hours. In a separate experiment, co-incubation with specific ARO
inhibitor letrozole (1 mM; purchased from Santa
Cruz Biotechnology, Heidelberg, Germany) for 24
J Sex Med 2011;8:696–704
698
Aversa et al.
Figure 1 Validation of the protocol for
the differentiation of human visceral
pre-adipocytes has been performed by
RT-PCR analysis and Red-oil staining.
The mRNA of PREF-1 (pre-adipocyte
marker) is gradually down-regulated
throughout the ex-vivo differentiation
process (A). By contrast, adiponectin
mRNA (adipose differentiation marker)
is markedly up-regulated as the
adipose conversion proceeds (B).
Red-oil staining is used to confirm
lipid deposition of human visceral
adipocytes differentiated for 10 days
ex-vivo (C).
and 96 hours was also performed. Tadalafil (kindly
supplied by ELI-Lilly ICOS Corporation, Indianapolis, IN, USA) and sildenafil (kindly supplied
by Pfizer Inc, New York, NY, USA) were dissolved
in dimethylsulfoxide and added to cells at the concentrations indicated for each experiment, in triplicate well-plates, and medium and drugs were
changed every 3 days. Experiments of overall transcription process inhibition were carried out by
treating adipocytes with 0.4 mM actinomycin D.
At the end of incubations, media were removed
and centrifuged at 250 g for 12 minutes, and
supernatants were saved for the measurements of
extracellular T and E2 by ELISA [11]. Cells were
counted after trypsinization in order to normalize
steroid level production. Neither treatment significantly altered the cell number.
RNA Extraction and Quantitative Real-Time Reverse
Transcription Polymerase Chain Reaction (qRT-PCR)
Cells were washed twice with 1¥ PBS (Invitrogen,
S.Giuliano Milanese (MI), Italy) and immediately
lysated in 1 mL of TRIzolTM Reagent (Invitrogen).
Total RNA was extracted following manufacturer’s
indications. The purity, integrity, and yield of
RNA was analyzed by Agilent Technologies 2001
bioanalyzer using the RNA 6000 LabChip kit
(Agilent Technologies, Cernusco s/N (MI), Italy).
Total RNA (1 mg) was treated with DNAse I
Amplification Grade (Invitrogen) and reversetranscribed using the SuperScriptTM II (Invitrogen). For PDE5 amplification, thermocycling
conditions were: 45 seconds of denaturation at
94°C, 45 seconds of annealing at 58°C, and 60
seconds of extension at 72°C for 34 cycles. An
additional 1-min extension step at 72°C was added
J Sex Med 2011;8:696–704
after the 35 cycles. The PCR products were then
subjected to electrophoresis in 1% agarose gel and
visualized by ethidium bromide staining. Realtime RT-PCR was performed in Mx3000PTM light
cycler (Stratagene) using iTaqSupermix with rox
(Bio-Rad, Segrate (MI), Italy) as indicated by
manufacturer’s instructions. All primers were optimized for real-time RT-PCR amplification checking the generation of a single pick in a melting
curve assay and the efficiency in a standard curve
amplification (>98% for each couple of primers).
Real-time RT-PCR sample value was normalized
for the expression of 18S rRNA. The relative
expression of investigated genes was calculated by
Mx3000PTM software version 2.0 (Stratagene) and
is reported as arbitrary units. For all experiments
each sample was analyzed in duplicate.
The following oligonucleotides were used for
amplification: human ARO: fw 5′ CCAAACCC
ACCTGCTAGTGT 3′, rev 5′ GCAAGGGTC
AAATGCTGAAT 3′; human PDE5: fw 5′ACC
GCT ATT CCC TGT TCC TT 3′, rev 5′AAG
GTC AAG CAG CAC CTG AT 3′; human
PDE11: fw 5′ GGTGGAAATTTTAGCGGTTA
3′, rev 5′ TGCTCCAAGGTAGCAGAGGT 3′;
human PREF-1: fw 5′ TGGCTTCTCAGGCA
ATTTCT 3′, rev 5′ CTGCAGGTCTTGTCGA
TGAA 3′, human adiponectin: fw 5′ TGGTCC
TAAGGGAGACATCG 3′, rev 5′ CAATCCC
ACACTGAATGCTG 3′; human 18S: fw. 5′
GTGCATGGCCGTTCTTAGTTG 3′, rev: 5′
CATGCCAGATCTCGTTCGTT 3′. For semiquantitative RT-PCR of human PDE5 were used
the following oligonucleotides: fw 5′ ACCGCT
ATTCCCTGTTCCTT 3′, rev 5′ AAGGTCA
AGCAGCACCTGAT 3′.
699
PDE5 Inhibitors and Adipose Tissue
Western Blot
For Western blot analysis, cells were lysed in RIPA
buffer, then 10 mg of whole-cell extract was separated on 10% SDS-PAGE and electroblotted onto
an Hybond-C EXTRA 0.45 mM nitrocellulose
membrane (Amersham Biosciences, Milan, Italy).
Membranes were incubated overnight at 4°C with
rabbit anti-aromatase polyclonal antibody (1:300,
ab35604, Abcam, Cambridge, UK) rabbit antiPDE5 polyclonal antibody (1:1,000, AB16994,
Chemicon, Millipore S.p.A, Vimodrone (MI),
Italy) and subsequently with peroxidase-labeled
secondary antibody (1:5,000, sc-2004, Santa Cruz
Biotechnology, Inc., Heidelberg, Germany) for 1
hour at room temperature. Monoclonal anti-actin
antibody (1:1,000, A3853, Sigma-Aldrich, Milan,
Italy) was used for the normalization of protein
loading. The instrument used for signal detection
was Hyper Processor SRX-101A (Amersham Biosciences). Bands were quantitated by densitometry
using ImageQuant TL software (Amersham
Biosciences).
ELISA Assays
At the end of incubation, media were removed and
centrifuged at 250 g for 12 minutes, and the supernatants were saved for the assay. E2 and T were
measured by ELISA (PANTEC srl, Turin, Italy)
assays following manufacturer’s instruction, as
previously described elsewhere [10]. All experiments regarding ELISA assays in the supernatants
have been normalized for the number of viable
cells at the end of the experiment. The sensitivity
of testosterone kit is 1.0 pg/mL and the range of
detection varies between 1 and 800 pg/mL. The
sensitivity of estradiol kit is 0.4 pg/mL and the
range of detection is between 0.83–93 pg/mL.
Statistical Analysis
For each specific read-out three independent set of
experiments (in triplicate) were performed. Values
were expressed as mean ⫾ SEM for N experiments. Statistical analysis was performed with Student’s t-test for paired or unpaired data, with
anova followed by Fisher’s test to evaluate differences between groups, and P < 0.05 was taken as
significant.
Results
PDE5 mRNA Expression in Human Adipocytes
Differentiated ex vivo
To verify whether adipose tissue could represent a
specific target tissue of PDE5i, we first evaluated
PDE5 expression in human primary visceral adipocytes (purchased from Lonza) upon differentiation in vitro. Relevant amounts of PDE5 mRNA
were detected in mature purified human adipocytes by RT-PCR (Figure 2A). In a second step, we
confirmed the presence of detectable levels of
PDE5 protein in primary visceral adipocytes differentiated ex vivo (Figure 2B). Interestingly, the
levels of PDE5 mRNA expression decreased along
the differentiation process ex vivo (Figure 2C,
upper panel). We also characterized the pattern of
expression of PDE11 mRNA in the same experi-
Figure 2 (A). RT-PCR expression and
(B) protein analysis of PDE5 in human
primary visceral adipocytes. RT-PCR
products were subjected to electrophoresis in 1.5% agarose gel, visualized by ethidium bromide staining. No
product was obtained with the same
set of primers in the absence of cDNA
template (negative control). (C). Realtime RT-PCR analysis of PDE5 and
PDE11 in human visceral primary
adipose cells at different stages of differentiation ex vivo. Pre-adipocytes
were allowed to grow to subconfluence
(Day 0) and then exposed to an appropriate differentiation medium for 10
days. Real-time RT-PCR for PDE5 and
PDE11 was also performed before
induction of adipogenesis (Day-2) as
well as in mature adipocytes purified
from the same adipose tissue sample
used for pre-adipocytes preparation.
J Sex Med 2011;8:696–704
700
Aversa et al.
ment (Figure 5B) consistent with the upregulation of ARO transcripts occurring after 6
and 12 hours.
Figure 3 Effects of PDE5 inhibition by sildenafil (1 mM) on
PDE5 mRNA levels during ex-vivo differentiation of human
primary visceral pre-adipose cells. Sildenafil was added to
the culture medium at the time of induction of adipogenesis
(Day 0). Real-time RT-PCR analysis of PDE5 was performed before and after adipogenesis induction at various
time points both in the absence or presence of sildenafil.
mental model showing an opposite profile of
expression, with higher transcript levels in differentiated adipocytes (Figure 2B, lower panel).
PDE5 inhibition by sildenafil during adipocytes
differentiation did not alter PDE5 mRNA levels at
any studied time point (Figure 3).
Time- and Dose-dependent Effect of PDE5 Inhibitors
on ARO mRNA and Protein Expression
TAD up-regulated ARO mRNA expression in a
dose-dependent manner after 6 hours. Such effect
occurred in a similar manner at 10-6 and 10-7 M
and was lost at 10-8 M (Figure 4A). Interestingly,
such effect was clearly time-dependent, in that it
was maximal at 6 hours, still present at 12 hours,
and was then lost after 24 hours (Figure 4B). Of
importance is that when we repeated a new treatment for 6 hours with TAD (10-6 M) after withdrawal of a previous treatment (6 hours at 10-6 M
followed by PBS washing and overnight incubation in drug-free medium), a similar increase of
mRNA expression (data not shown) was again
observed.
To confirm that such effect was PDE5 specific,
we used either TAD, which is known to inhibit
both PDE5 and PDE11 isoforms, or sildenafil,
which is specific for PDE5 only. Furthermore,
ARO mRNA expression was evaluated after exposing adipocytes to a PDE3A inhibitor milrinone
(1 mM) or 8-Br-cGMP (1 mM) for 6 hours. As
expected, sildenafil, similarly to tadalafil, increased
ARO mRNA expression and this effect was mimicked by 8-Br-cGMP. Differently, milrinone did
not display any effect on ARO mRNA excluding
any role for PDE3A (Figure 5A). Importantly,
Western blot studies confirmed an increase in
ARO protein content after 24 hours of TAD treatJ Sex Med 2011;8:696–704
Effects of Actinomycin-D on ARO mRNA Expression
Co-treatment of terminally differentiated adipocytes with actinomycin-D (0.4 mM) completely
inhibited the increase in ARO mRNA levels
induced by TAD (Figure 6), strongly suggesting
that TAD increased the transcription of ARO
without influencing the stability of ARO mRNA.
Effect of PDE5 Inhibition on T and E2 Production
In accordance with the rapid increase in ARO
mRNA expression, long-term exposure (24 and 96
hours) to tadalafil determined a significant
increase in E2 concentrations in the supernatant
(1.7- and 2-fold, respectively), with a parallel
reduction of T (15% and 30%, respectively;
Figure 7A). This resulted in a net increase in E2/T
ratio throughout the time (Figure 7B). Sildenafil
induced similar effect on E2 and T concentration
Figure 4 (A). Effects of different concentrations of tadalafil
(10-8, 10-7 and 10-6 M) on ARO mRNA levels after 6 hours
treatment. Data were expressed as a percentage of
untreated (UT) at 6 hours. Human visceral pre-adipocytes
were cultured until subconfluence and then shifted into an
appropriate differentiation medium for 10 days. Subsequently, cells were exposed or not for 6 hours to the indicated concentrations of TAD. Real-time RT-PCR analysis
was performed to analyze ARO mRNA levels. *P < 0.05 vs.
UT. (B). Effects of tadalafil (10-6 M) on ARO mRNA levels at
3, 6, 12 and 24 hours. Primary human visceral adipocytes
differentiated for 10 days were treated or not with tadalafil
(10-6 M) for the indicated times. Real-time RT-PCR analysis
was performed to analyze ARO mRNA levels. *P < 0.05 vs.
UT.
PDE5 Inhibitors and Adipose Tissue
701
Figure 5 (A). Effects of tadalafil (1 mM), sildenafil (1 mM), milrinone (1 mM) and 8Br-cGMP (1 mM) on ARO mRNA levels after
6 hours of exposure. Primary human visceral adipocytes differentiated for 10 days were exposed to the indicated treatments.
Subsequently, real-time RT-PCR analysis was performed to analyze aromatase mRNA levels. Data were expressed as a
percentage of untreated (UT). **P < 0.001 vs. UT. (B). Western blot analysis of ARO protein in primary human visceral
adipocytes differentiated for 10 days after treatment or not with TAD for 24 hours. A representative experiment is shown.
Histograms indicate the mean band intensity expressed as arbitrary units (⫾SEM) of three independent experiments.
(data not shown), while milrinone did not significantly alter steroid level in the supernatant (data
not shown). As expected, co-incubation with specific ARO inhibitor letrozole (1 mM) reversed the
increase in E2/T ratio induced by TAD
(Figure 6A, B).
Discussion
In the present study, we confirm that PDE5
mRNA is present in human visceral adipocytes
differentiated ex vivo and that selective PDE5
inhibition significantly stimulates ARO mRNA
Figure 6 Effects of 6 hours co-treatment with
actinomycin-D (0.4 mM) and tadalafil (10-6 M) on ARO
mRNA levels in 10-day differentiated human visceral adipocytes. Real-time RT-PCR analysis was performed to
analyze ARO mRNA levels. Data were expressed as a
percentage of untreated (UT). *P < 0.05 vs. UT.
and protein expression. In particular, this effect
was maximal after 6 hours of treatment with concentrations of 10-6 and 10-7 M of TAD. Accordingly, protein expression was increased at 24 hours,
and a significant increase in E2 concentrations in
the supernatant with a parallel reduction of testosterone was observed at 96 hours. This suggests
an overall increase in ARO enzymatic activity after
short-term PDE5i treatment, while the effect was
blunted after concomitant long-term treatment
with the ARO selective inhibitor letrozole (96
hours), respectively. Since TAD is known to
inhibit both PDE5 and PDE11 isoforms, and we
demonstrated relevant PDE11 transcript levels in
our experimental model, we confirmed the same
results by using the PDE5 specific inhibitor
sildenafil (Figure 5A). By contrast, acute treatment
(6 hours) with the PDE3 inhibitor milrinone did
not affect ARO expression, strongly indicating that
the observed ARO up-regulation is related to specific PDE5 blockade, and not to PDE3 isoforms.
Our findings show for the first time that acute
PDE5i exposure is able to increase ARO expression and function. Such effect has been confirmed
when TAD was added again after withdrawal of a
previous treatment; thus, adaptation to repeated
exposure to TAD does not occur in our experimental model.
ARO is the product of the CYP19 gene, which
in humans is expressed in many tissues including
J Sex Med 2011;8:696–704
702
Aversa et al.
Figure 7 (A). Effects of 24 and 96
hours treatment with TAD (1 mM) on E2
and T production and (B) E2 : T ratio.
Co-incubation with letrozole (LT; 1 mM)
was able to blunt TAD induced effect
on the T: E2 conversion at 96 hours.
Visceral adipocytes, previously differentiated ex vivo, were exposed to TAD
for different periods of times. Culture
media were removed and centrifuged
at 250 g for 12 minutes, and the supernatants were saved for the ELISA
assay. All cell groups were counted for
normalization of steroid production,
after trypsin digestion. **P < 0.001 vs.
untreated. °°P < 0.001 vs. TAD 96.
the granulosa and luteal cells of the ovary, bone,
brain, placenta, testis, and adipose tissue. E2 is
synthesized by cytochrome P450-ARO that converts androgens into estrogens and, indeed,
changes in the level of estrogen biosynthesis are
closely related to modifications in the transcription of ARO [12]. It is known that estrogen receptors (ERa and ERb) are both expressed in
endothelial cells (ECs) and vascular smooth
muscle cells, mediating both the rapid, membraneinitiated, and genomic cardiovascular effects of
estrogens [13]. E2 plays an important role with
regard to cardiovascular disease prevention since
its effects on the ECs at the cellular and molecular
level are manifested through rapid signaling
responses and eNOS activation, and should translate to beneficial clinical effects [14]. E2-induced
vascular eNOS activation and NO production are
Akt-dependent [15] and the eNOS-dependent
E2-enhanced vasodilation requires ER triggering
of the ERK/MAPK, PI3K [16] and the tyrosine
kinase c-Src pathways. Estrogens also enhance
NO bioavailability mediated by the inhibition of
nicotinamide adenine dinucleotide phosphate
(NADPH) oxidase expression, thus limiting the
generation of superoxide (O2-) and peroxynitrite
[17]. These evidences, along with our present
results lead to hypothesize that this novel
described effect of PDE5i on ARO activity might
influence all the cells sensitive to serum E2 variation and activity in vivo (i.e., adipose tissue, endothelial cells, bone cells, breast, and prostate cells).
J Sex Med 2011;8:696–704
Indeed, a transient increase in E2 concentrations
after PDE5i exposure, might display favorable
effects on endothelial function and may be one of
the leading mechanism(s) responsible for the rapid
vasodilator responses of the penile and systemic
arteries. For instance, lack of estrogen is involved in
the development of metabolic syndrome (MetS) in
humans and rodents, including excess adiposity,
hepatic steatosis and insulin resistance [18]. A loss
of estrogen in men results in development of MetS
key risk factors: truncal obesity, elevated blood
lipids, fatty liver, and severe insulin resistance, all
characteristics that have been described in the aromatase deficient male mouse [19]. These results
obtained in an experimental animal model might be
a relevant point linking estrogens and the MetS in
humans. In fact, an imbalance in androgens/
estrogen ratio favoring androgens is known to
increase the expression of lipogenic genes (fatty
acid synthase, sterol regulatory element binding
protein-2, and lipoprotein lipase) promoting visceral fat accumulation [20]. Moreover, as suggested
by Seralini and Moslemi, the androgen/estrogen
ratio might be more important than the individual
actions of each hormone alone, in a tissue- and
gender-specific manner [21].
Interestingly, the effects of PDE5 inhibition on
adipogenesis has been recently investigated in a
murine pre-adipose cell line. Sildenafil treatment
during adipogenesis was able to promote basal and
insulin-mediated glucose uptake in 3T3-L1 cells,
favoring adipose differentiation [22]. In our study,
703
PDE5 Inhibitors and Adipose Tissue
we did not observe any effect of PDE5 inhibitors
on lipid accumulation (data not shown) but we
added treatments when adipocytes were already
fully differentiated. On the other hand, we demonstrated that PDE5 inhibition could exert beneficial effects on adipose tissue physiology through
an induction of ARO and a consequent local
increase in estrogen levels. The results of our
study highlight the possibility that PDE11 may
also play a role in the control of adipose tissue
metabolism. Unraveling the mechanisms underlying this clinically relevant regulation is therefore
becoming increasingly urgent.
Limitations
Our study lacks a direct demonstration in vivo that
estrogen levels can be increased after acute PDE5i
administration. The physiological significance of
the present finding obtained in human visceral adipocytes ex vivo needs further investigation in different experimental animal models and needs to be
fully elucidated in vivo. The observation that in
men with ED chronically (12 months) exposed to
on-demand TAD a reduction in E2 circulating
levels occurred [7] is not explained by the present
experimental model. Indeed, the present data
reflect acute effect of PDE5 inhibition on adipose
tissue biology ex vivo that has never been
described. Therefore, this is not a suitable model
for trying to explain the hormonal changes after
long-term treatment in ED patients.
Conclusions
In this study, we provide confirmatory evidence that
PDE5 is expressed in human visceral adipocytes.
Acute exposure to PDE5i selectively stimulates
ARO expression in adipocytes ex vivo, which is
related to specific PDE5 blockade. We believe that
our study brings novel discovery, showing for the
first time a direct effect of PDE5i on ARO expression and function in human visceral adipocytes. Such
effect could positively modulate the serum T : E2
ratio in vivo during treatment with PDE5i and this
might represent a possible mechanism by which
PDE5i positively affects endothelial rehabilitation
[23,24] and metabolic functions in humans. These
results, if confirmed in clinical studies, may open a
new scenario for the use of PDE5 inhibitors for the
treatment of MetS-associated obesity. Further in
vivo investigations on the relationships between the
T:E2 ratio, adipocyte function and their possible
regulation of hormonal secretion after long-term
PDE5i administration are warranted.
Acknowledgments
This work was partly supported by a grant from PRIN
2007 (Programmi di Ricerca di Rilevante Interesse
Nazionale, to A.F.) and with partial support from ELILilly (spontaneous research), Indianapolis.
Corresponding Author: Antonio Aversa, MD, PhD,
Department of Experimental Medicine, Section of
Medical Pathophysiology, “Sapienza” University of
Rome, Viale del Policlinico 155, 00161 Rome, Italy.
Tel: 39-06-49970721; Fax: 39-06-4461450; E-mail:
antonio.aversa@uniroma1.it
Conflict of Interest: Massimiliano Caprio, Antonella
Antelmi, Andrea Armani, Marina Brama, Davide Francomano, Matilde Calanchini, Emanuela A Greco,
Andrea Lenzi, Luigi Di Luigi and Giuseppe MC
Rosano have nothing to declare. Antonio Aversa is a
scientific consultant for Eli-Lilly Indianapolis, Indiana,
USA and Pfizer Inc, New York, USA; Giovanni Spera
and Silvia Migliaccio are scientific consultant for EliLilly Indianapolis, Indiana, USA; Andrea Fabbri is a
scientific consultant and received grants from for Pfizer
Inc, New York, USA.
Statement of Authorship
Category 1
(a) Conception and Design
Antonio Aversa; Massimiliano Caprio; Andrea
Armani; Andrea Fabbri; Emanuela A. Greco; Silvia
Migliaccio
(b) Acquisition of Data
Massimiliano Caprio; Andrea Armani; Marina
Brama; Antonella Antelmi; Matilde Calanchini;
Emanuela A. Greco
(c) Analysis and Interpretation of Data
Antonio Aversa; Silvia Migliaccio; Massimiliano
Caprio; Andrea Armani; Davide Francomano
Category 2
(a) Drafting the Article
Antonio Aversa; Massimiliano Caprio; Silvia Migliaccio; Andrea Fabbri; Andrea Lenzi; Andrea Armani
(b) Revising It for Intellectual Content
Massimiliano Caprio; Andrea Armani; Giovanni
Spera; Giuseppe M.C. Rosano; Luigi Di Luigi;
Andrea Lenzi; Antonio Aversa; Silvia Migliaccio
Category 3
(a) Final Approval of the Completed Article
Antonio Aversa; Massimiliano Caprio; Andrea
Armani; Emanuela A. Greco; Davide Francomano;
Luigi Di Luigi; Andrea Lenzi; Silvia Migliaccio;
Andrea Fabbri
J Sex Med 2011;8:696–704
704
References
1 Aversa A, Bruzziches R, Pili M, Spera G. Phosphodiesterase 5
inhibitors in the treatment of erectile dysfunction. Curr Pharm
Des 2006;12:3467–84.
2 Manganiello V. Cyclic nucleotide phosphodiesterase 5 and
sildenafil: Promises realized. Mol Pharmacol 2003;63:1209–
11.
3 Eardley I, Donatucci C, Corbin J, El-Meliegy A, Hatzimouratidis K, McVary K, Munarriz R, Lee SW. Pharmacotherapy
for erectile dysfunction. J Sex Med 2010;7(1 Pt 2):524–40.
4 Morelli A, Filippi S, Mancina R, Luconi M, Vignozzi L,
Marini M, Orlando C, Vannelli GB, Aversa A, Natali A, Forti
G, Giorgi M, Jannini EA, Ledda F, Maggi M. Androgens
regulate phosphodiesterase type-5 expression and functional
activity in corpora cavernosa. Endocrinology 2004;145:2253–
63.
5 Moro C, Klimcakova E, Lafontan M, Berlan M, Galitzky J.
Phosphodiesterase-5A and neutral endopeptidase activities in
human adipocytes do not control atrial natriuretic peptidemediated lipolysis. Br J Pharmacol 2007;152:1102–10.
6 Taira M, Hockman SC, Calvo JC, Taira M, Belfrage P,
Manganiello VC. Molecular cloning of the rat adipocyte
hormone-sensitive cyclic GMP-inhibited cyclic nucleotide
phosphodiesterase. J Biol Chem 1993;268:18573–9.
7 Stief CG, Uckert S, Becker AJ, Harringer W, Truss MC,
Forssmann WG, Jonas U. Effects of sildenafil on cAMP and
cGMP levels in isolated human cavernous and cardiac tissue.
Urology 2000;55:146–50.
8 Greco EA, Pili M, Bruzziches R, Corona G, Spera G, Aversa A.
Testosterone: Estradiol ratio changes associated with longterm tadalafil administration: A pilot study. J Sex Med 2006;
3:716–22.
9 Armani A, Mammi C, Marzolla V, Calanchini M, Antelmi A,
Rosano GM, Fabbri A, Caprio M. Cellular models for understanding adipogenesis, adipose dysfunction, and obesity. J Cell
Biochem 2010;110:564–72.
10 Nisoli E, Clementi E, Tonello C, Sciorati C, Briscini L,
Carruba MO. Effects of nitric oxide on proliferation and differentiation of rat brown adipocytes in primary cultures. Br J
Pharmacol 1998;125:888–94.
11 Fujinami A, Ohta K, Matsui H, Kitada N, Kitaura Y, Kawahara
Y, Obayashi H, Kuno S, Nakamura N, Ohta M. Resistin concentrations in murine adipose tissue and serum measured by a
new enzyme immunoassay. Obesity 2006;14:199–205.
J Sex Med 2011;8:696–704
Aversa et al.
12 Simpson ER, Mahendroo MS, Means GD, Kilgore MW, Hinshelwood MM, Grahm-Lorence S, Amarneh B, Ito Y, Fisher
CR, Michael MD, Mendelson CR, Bulun SE. Aromatase
Cytochrome P450, the enzyme responsible for estrogen biosynthesis. Endocr Rev 1994;15:342–55.
13 Miller AP, Xing D, Feng W, Fintel M, Chen YF, Oparil S.
Aged rats lose vasoprotective and anti-inflammatory actions of
estrogen in injured arteries. Menopause 2007;14:251–60.
14 Kim KH, Bender JR. Membrane-initiated actions of estrogen
on the endothelium. Mol Cell Endocrinol 2009;308:3–8.
15 Florian M, Lu Y, Angle M, Magder S. Estrogen induced
changes in Akt-dependent activation of endothelial nitric oxide
synthase and vasodilation. Steroids 2004;69:637–45.
16 Guo X, Razandi M, Pedram A, Kassab G, Levin ER. Estrogen
induces vascular wall dilation: Mediation through kinase signaling to nitric oxide and estrogen receptors a and b. J Biol
Chem 2005;280:19704–10.
17 Traupe T, Stettler CD, Li H, Haas E, Bhattacharya I, Minotti
R, Barton M. Distinct roles of estrogen receptors a and b
mediating acute vasodilation of epicardial coronary arteries.
Hypertension 2007;49:1364–70.
18 Jones ME, McInnes KJ, Boon WC, Simpson ER. Estrogen and
adiposity-utilizing models of aromatase deficiency to explore
the relationship. J Steroid Biochem Mol Biol 2007;106:3–7.
19 Misso ML, Murata Y, Boon WC, Jones ME, Britt KL,
Simpson ER. Cellular and molecular characterization of the
adipose phenotype of the aromatase-deficient mouse. Endocrinology 2003;144:1474–80.
20 McInnes KJ, Corbould A, Simpson ER, Jones ME. Regulation
of adenosine 5′,monophosphate-activated protein kinase and
lipogenesis by androgens contributes to visceral obesity in an
estrogen-deficient state. Endocrinology 2006;147:5907–13.
21 Seralini G, Moslemi S. Aromatase inhibitors: Past, present and
future. Mol Cell Endocrinol 2001;178:117–31.
22 Zhang X, Ji J, Yan G, Wu J, Sun X, Shen J, Jiang H, Wang H.
Sildenafil promotes adipogenesis through a PKG pathway.
Biochem Biophys Res Commun 2010;396:1054–59.
23 Shindel AW. 2009 update on phosphodiesterase type 5 inhibitor therapy part 1: Recent studies on routine dosing for penile
rehabilitation, lower urinary tract symptoms, and other indications (CME). J Sex Med 2009;6:1794–808.
24 Shindel AW. 2009 update on phosphodiesterase type 5 inhibitor therapy part 2: Updates on optimal utilization for sexual
concerns and rare toxicities in this class. J Sex Med
2009;6:2352–64.