Name: _________________________________________ Date: _____________
Modeling How DNA Fingerprints Are Made
�You have probably seen crime dramas where police have a sample of a person’s DNA and
can use it to identify the criminal. The process of DNA analysis has multiple steps, but in all
techniques, the DNA must be cut into small pieces using restriction enzymes.
Restriction enzymes were isolated from bacteria and are used by the bacteria to cut DNA of
invading viruses. Restriction enzymes cut DNA at specific places, called recognition sites. We
have isolated over 3000 restriction enzymes, and identified where they cut DNA. They are
named after the bacteria they came from, EcoRI was isolated for the E. coli bacteria.
The EcoRI enzyme cuts DNA at the following site:
The Smal enzyme cuts at a different site.
Because DNA differs for individuals, adding a restriction enzyme to a sample can create multiple cuts that are
unique to each sample.
✂1) Examine the sequences below and indicate where the Smal enzyme cuts the DNA and how many
fragments are created
ATCATCCCGGGAGAGCTAGCCCGGGAAATAGGCCCGGGATCATGATT
TAGTAGGGCCCTCTCGATCGGGCCCTTTATCCGGGCCCTAGTACTAA
How many fragments are created? _____
AACATGAACATCCCGGGATCAAGGCAGGAAACCCGGGATAGTTAACC
TTGTACTTGTAGGGCCCTAGTTCCGTCCTTTGGGCCCTATCAATTGG
How many fragments are created? _____
Polymerase Chain Reaction (PCR)
Each digested sample creates a different number of fragments at different lengths. Because the
fragments might come from a small original sample, like blood or hair, scientists amplify the
fragments with a technique called PCR, or polymerase chain reaction. This will make multiple
copies of the fragments that will be used in the next step. The sample is then loaded into a
micropipette and transferred to a gel plate.
2) Why would PCR be necessary for crime scene evidence? ____________________________
www.biologycorner.com
⚡ Gel Electrophoresis
The next step is to place the fragments onto a gel and then apply a current.
The fragments will move through the gel, but smaller fragments will move
farther in the gel. DNA has a negative charge, so it will move toward the
positive end of the fragment when electricity is applied.
Once the fragments have been separated, the gel is stained so that the
DNA bands will be visible under a UV light. The bands will look like a
barcode. A marker can also be used to indicate how long each fragment is.
3) The image shows a marker with fragments of
known lengths and three samples.
How many fragments were in sample A? _____
Which sample had the shortest fragment ? ____
Carefully examine sample C and determine the length
of each fragment (bp).
_________________________________________
Discuss WHY samples would have fragments of
different lengths.
4) Would you expect different samples that came from the same person, such as skin cells and blood, to have
the same number and length of fragments? Why or why not?
5) Would samples that were digested with EcoRI have a different pattern than the same sample digested with
Smal? Explain your answer.
www.biologycorner.com
Crime Scene Analysis
�When investigators find body fluids from a suspect, they use
the same techniques to cut the DNA into fragments, load
them into the gel, and compare them with known suspects. If
DNA is a match, then the number and the length of the
fragments should line up.
6) Examine the sample taken from a crime scene, which
suspect matches the sample? _______
7) Explain why some Individual bands of other suspects
match the sample
�A crime was committed in the teacher’s workroom. Mr.
DePew’s sandwich was discovered half-eaten. Biology
students were able to isolate saliva on the sandwich that
could match the person who ate half the sandwich. Cameras
show that three other teachers entered the workroom at the
time the crime was committed. The teachers agreed to
provide a sample of their DNA to prove their innocence.
8) Which teacher ate the sandwich? __________________
The teacher swears that he didn’t touch the sandwich and that
his twin must have done it. Would a twin have the same DNA
fingerprint? Why or why not?
9) In most cases, a sample of a person’s DNA can be requested by law enforcement, but a person can refuse.
Do you think a person should be required to submit their DNA? Why or why not?
www.biologycorner.com
Who’s the Father?
Paternity tests use the same technology, but with one small
difference. A child’s DNA will contain matching sequences from the
mother and the father. To determine the father, you must first
identify fragments that match the mother.
On the diagram, color (or shade) and fragment that matches
mother’s DNA. Any other fragments must then match the father.
Color the father’s DNA a different color.
10) Who is the father of the baby? ________________
Explain why the father’s DNA fingerprint has bands not found on
the baby’s fingerprint.
Discussion and Synthesis
11) The following image shows the steps in
creating a DNA fingerprint. Match the
number to the description:
___ PCR amplification
___DNA extracted from tissue.
___DNA fragments move across the gel
___DNA sample loaded into wells
___DNA stained with fluorescent dye
___Electricity applied to gel
12) Explain why larger bands are closer to the wells where the sample was loaded?
13) Discuss how DNA fingerprinting can be used?
14) Describe some limitations of DNA fingerprinting.
________________________________________________________________________________________
www.biologycorner.com