Applied Soil Ecology 124 (2018) 131–140
Contents lists available at ScienceDirect
Applied Soil Ecology
journal homepage: www.elsevier.com/locate/apsoil
Anti-fungal activity of bacterial endophytes associated with legumes against
Fusarium solani: Assessment of fungi soil suppressiveness and plant
protection induction
Ameni Bahrouna,b,c, Alexandre Joussetb, Rakia Mhamdia, Moncef Mrabeta, Haythem Mhadhbia,
T
⁎
a
Laboratory of Legumes, Centre of Biotechnology of Borj Cedria, PB901, 2050 Hammam Lif, Tunisia
Utrecht University, Biology Department, Institute of Environmental Biology, Ecology and Biodiversity Group, Padualaan 8, 3584CH Utrecht, Netherlands
c
University Tunis El Manar, 2092, Tunis, Tunisia
b
A R T I C L E I N F O
A B S T R A C T
Keywords:
Endophytic bacteria
Fusarium solani
Bio-control
Legumes
Rahnella aquatilis B16C
Legumes (Fabacea) plants are mainly known for their symbiotic relationship with soil nitrogen-fixing bacteria
(rhizobia). This symbiosis requires the formation of new root structures called nodules. Besides rhizobia, nodules
host several microbial species that may serve to enhance plant growth and disease resistance. In this study, we
demonstrate that several endophytic bacteria isolated from nodules harbour plant growth promotion and biocontrol traits. A collection of 120 bacterial strains isolated from Faba bean (Vicia faba) and chickpea (Cicer
arietinum) nodules were screened for their ability to inhibit phytopathogenic Fusarium solani on “In vitro” antibiosis tests. Sixteen best effective isolates were selected, identified and sequences were deposited in Genbank.
These strains were all isolated from Faba bean nodules. These have the characteristics to produce siderophores
and auxin as well as expression of some genes coding the production of the antibiotic compounds as Pyrrolnitrin
(PRN), Phenazine (PHZ)… Based on the former PGPR and biocontrol characteristics, three strains; Rahnella
aquatilis B16C, Pseudomonas yamanorum B12 and Pseudomonas fluorescens B8P were analyzed for their “In vivo”
biocontrol potential in suppressing F. solani root rot of three cultivars of Faba bean under greenhouse conditions.
The three strains significantly reduced the pathogen symptom severity. R. aquatilis B16C showed the best protecting potentiality with the three Faba bean cultivars and it is consequently, suggested as biocontrol agent for
field application. Then again, our study confirms previous suggestion of legume nodules as untapped suitable
source of beneficial microorganisms that can be used to control pathogens in a sustainable way.
1. Introduction
Plant tissues are colonised by complex endophytic microbial communities, which can play a central role for plant growth and health
(Kobayashi and Palumbo, 2000; Stone et al., 2000). These endophytic
bacteria have the ability to promote plant growth according to a direct
and indirect mechanisms (Santoyo et al., 2016). Endophytes can directly benefit hosts through producing several plant growth regulators
(Di et al., 2016; Glick, 1995) and facilitating nutrient uptake (Vacheron
et al., 2013). They can further keep host healthy through the indirect
mechanisms by inhibiting pathogens, for instance by producing antibiotics (Glick et al., 2007), siderophores (Lodewyckx et al., 2002)
against the phytopathogens (Narula et al., 2013; Santoyo et al., 2016).
Legumes are one of the best types of plants described for their interaction with endophytic microorganisms. Various endophytic bacteria
as Rhizobium, Bradyrhizobium, Sinorhizobium and Mesorhizobium form an
⁎
intimate symbiotic relationships with legumes and develop nodules on
the roots (Oldroyd and Downie, 2008). This process is known as symbiotic nitrogen fixation in legume nodules in which bacteria will fix
atmospheric nitrogen N2. Recently, the nodule have received much
attention as a microbial diversity. They host a plethora of gram −positive and −negative genera such as: Agrobacterium, Burkholderia,
Cronobacter, Enterobacter, Mesorhizobium, Pseudomonas, Rahnella, Bacillus, Paenibacillus, Planomicrobium, Rhodococcus, … (Aserse et al.,
2013; Reeve et al., 2015). These endophytic bacteria communities can
affect plant growth, nutrition and plant health (Vacheron et al., 2013)
and may serve to suppress pathogens (Duffy et al., 2003). Plant associated microbes are of particular interest in the field of biological
control of plant diseases (Gray and Smith, 2005) as they may replace
toxic and increasingly inefficient pesticides. The efficiency of biocontrol
bacteria to a good extent based on the production of antibiotics that
directly inhibit the pathogen (Reetha et al., 2014). However, despite of
Corresponding author.
E-mail addresses: mhadhbihay@yahoo.fr, Haythem.mhadhbi@cbbc.rnrt.tn (H. Mhadhbi).
https://doi.org/10.1016/j.apsoil.2017.10.025
Received 20 June 2017; Received in revised form 16 October 2017; Accepted 21 October 2017
Available online 13 November 2017
0929-1393/ © 2017 Published by Elsevier B.V.
Applied Soil Ecology 124 (2018) 131–140
A. Bahroun et al.
2.3. Screening of nodule bacterial endophytes
increasing knowledge on biocontrol bacteria, obtaining efficient isolates remains a challenge. Here we assess whether nodule-derived endophytes can suppress Fusarium solani, a major pathogen of Faba bean
in Tunisia. The North of Tunisia is the main of Fabaceae cultivation area
in the country (Kharrat and Ouchari, 2011), characterised by hot
temperatures and a wet climate. These climatic conditions cause high
growth of soil-borne Fusarium spp., which can cause significant yield
losses (Sperschneider et al., 2015). Farmers often rely on chemical
fungicides reduce the incidence of soil-borne pathogens. However,
fungicides cause several negative effects on human health and environment. There are also a number of pathogen diseases for which
chemical solutions are ineffective or non-existent because of resistance
to the applied agents (Chakraborty and Newton, 2011). Harnessing the
power of microorganisms to suppress plant diseases (Horrigan et al.,
2002; Kandel et al., 2017) may be one of the most promising solutions
to pathogen pressure.
With a general aim to assess whether legume nodules can serve as a
source of biotechnologically-relevant isolates; In the present work, we
focus on the study of the potential biocontrol activities of legumes
nodules endophytic bacteria against Fusarium solani root rot. For this
purpose, a collection of 120 endophytic bacteria isolated from nodules
of Vicia faba and Cicer arietinum were “In vitro” tested for their antibiosis
with F. solani for selection of most effective biocontrol strains. Sixteen
Potentially antagonistic strains were identified by 16S rRNA sequence
analysis and tested for their ability to produce auxin (AIA) and siderophores. Furthermore, we used a PCR approach to detect the biocontrol genes responsible for the production of well-established antifungal
compounds. The most three promising bacteria were “In Vivo” tested in
green house experiment to confirm their ability to protect plants against
root rot disease. Bacteria were evaluated for their potential to increase
plant growth and to reduce symptom root severity and the density of F.
solani in soil.
A library of 120 endophytic bacteria was tested in this work (Table,
Supplementary data). Each isolate was grown for in 100 ml Lysogeny
Broth (LB) at 25 °C with shaking at 120 rpm. Then, 2 ml of the culture
suspension (105 cell ml−1) was mixed into 20 ml of Yeast Glucose
Mineral Agar Medium (YGMA, Merck, Germany) and then placed in
Petri dishes. After the agar solidified, mycelia plugs were placed on the
agar surface. The agar plates were incubated at 30 °C for 5 days in
darkness. YGMA was used as a negative control. Radial mycelia growth
of Fusarium solani was measured (cm). Each endophyte bacteria was
screened in three independent replicate. The inhibition (%) was calculated based on the following formula (Hmouni et al., 1996):
I (%) = [1 − Cn/C0]*100;
With Cn: average diameter of colonies in the presence of active
product; and C0: average diameter of the control colonies.
2.4. Molecular identification of endophytic bacteria
Sixteen endophytic bacteria with a positive activity against Fusarium
solani using the dual culture method in vitro (described above) were
identified on the base of their partial 16S ribosomal DNA gene sequence
using the primers 1492R (Stackebrandt and Liesack, 1993) (5′
GGTTACCTTGTTACGACTT 3′) and 8F (5′AGAGTTTGATCCTGGCTCAG
3′) (Edwards et al., 1989). Sequenced fragments were assembled using
the CAP program available on the NCBI website (http://www.ncbi.nlm.
njh.gov/blast). Partial sequences of 16S rDNA were deposited in Genbank under accession numbers mentioned in Table 3.
2.5. Indole acetic acid production
In order to qualitatively detect the IAA production, 16 endophytic
bacteria with a positive activity against Fusarium solani were grown in
100 ml LB broth and incubated for 72 h at 25 °C with shaking at
120 rpm then centrifuged at 5000 rpm for 30 min. The supernatant
(50 μl) was mixed with 450 μl phosphate buffer. From this mixture
60 μl was added to 440 μl of phosphate buffer in a tube containing
500 μl of Salkowski reagent (12 g of FeCI3 per litre of 7.9 M H2SO4)
(Leveau and Lindow, 2005). Development of pink-red indicates IAA
production (Ghosh and Basu, 2006; Gordon and Weber, 1951).
2. Materials and methods
2.1. Origin of fungal isolate
Fusarium solani, the pathogenic fungi used in this study have been
isolated from potatoes fields in Tunisia. It was identified on the base of
its 18S rDNA (Genbank reference # KX576550). For use in the present
work, culture was maintained on Potato-Dextrose-Agar (PDA; Difco),
made with 39 g of PDA per litre of distilled water and supplemented
with antibiotics (streptomycin sulfate at 300 mg/l) (Goswami et al.,
2008). Culture was incubated in controlled environment (dark, temperature 28 °C) for 7–10 days prior to experiment.
2.6. Siderophores production
Sixteen endophytic bacteria tested positive for suppressing the
growth of Fusarium solani were also tested for siderophores production
using Chrome Azurol Sulfonate (CAS) agar medium (Schwyn and
Neilands, 1987). Wells (11 mm diameter) were created in the medium
plate by puncturing with sterile glass tubes into which the overnight
culture of each endophyte strain was applied. The development of the
orange color around the colonies indicates the production of siderophores.The agar plates were incubated at 28 °C for 48 h in darkness.
The radius of each zone was measured.
2.2. Isolation of endophytes bacteria from Vicia faba and Cicer arietinum
Plants were collected during flowering stage. Harvested plants were
free of fungal pathogen. The plant samples were randomly collected
from three different geographical locations in lowland in North Tunisia,
under semi-arid climate with low rainfall. Roots were carefully carefully washed in the tap water to get rid of adherent soil. The roots with
pink nodules were selected for the isolation of the endophytic bacteria
then nodules were cut from the roots and were washed. Nodule samples
were immersed in 70% ethanol solution for 30 s and then treated with
0.1% HgCl2 for 2 min. Finally nodules were rinsed five times with
sterile water and dried with sterile paper (Rajendran et al., 2012). The
nodules were ground with 1 ml saline water (NaCl at 8.5 g/l). Serial
dilutions were prepared from the ground nodules, and then 100 μl from
each dilution of 1 × 10−6, 1 × 10−7, and 1 × 10−8 CFU mL−1 were
streaked onto Lysogeny Broth medium plates(LB, 10 g NaCl, 5 g yeast
extract, 10 g tryptone, 20 g agar, per liter). All the plates were incubated at 28 ± 2 °C for 3 to 5 days. Colonies with different
morphologies were selected, checked for purity and re-streaked on LB
medium
2.7. PCR detection of the antibiotic biosynthetic gene in endophytes strains
PCR was used to investigate the biocontrol genes phzC-phzD, prnD,
pltc, phz, phlD and hcnAB (de Souza et al., 2003; de Souza and
Raaijmakers, 2003; Raaijmakers et al., 1997; Svercel et al., 2007) in the
16 best endophyte bacteria.
phzC-phzD, prnD, pltc, phz, phlD and hcnAB are responsible for the
production of the antifungal compounds Pyrrolnitrin (PRN), Phenazine
(PHZ), Phenazine-1-carboxylic acid (PCA), Pyoluteorin (PLt) and 2, 4Diacetylphloroglucinol (DAPG) and Hydrogen cyanide (HCN) respectively. Six individual primers were used for PCR assays (Table 1), the
132
Applied Soil Ecology 124 (2018) 131–140
A. Bahroun et al.
Table 1
Oligonucleotide sequences of antibiotics genes primers.
Target DNA
Design Primer
Primer Sequence (5′-3′)
Product length (bp)
Reference
phzC and phzD
pca2a
pca3b
PRND1
PRND2
PltC1
PltC2
PHZ1
PHZ2
phl2a
phl2b
PM1
PM2
TTGCCAAGCCTCGCTCCAAC
CCGCGTTGTTCCTCGTTCAT
GGGGCGGGCCGTGGTGATGGA
YCCCGCSGCCTGYCTGGTCTG
AACAGATCGCCCCGGTACAGAACG
AGGCCCGGACACTCAAGAAACTCG
GGCGACATGGTCAACGG
CGGCTGGCGGCGTATTC
GAGGACGTCGAAGACCACCA
ACCGCAGCATCGTGTATGAG
TGCGGCATGGGCGTGTGCCATTGCTGCCTGG
CCGCTCTTGATCTGCAATTGCAGGCC
1150
Raaijmakers et al. (1997)
786
de Souza and Raaijmakers (2003)
438
de Souza and Raaijmakers (2003)
1408
de Souza and Raaijmakers (2003)
745
de Souza et al. (2003) and Raaijmakers et al. (1997)
570
Svercel et al. (2007)
prnD
pltc
phz
phlD
hcnAB
with bacteria before sowing. Bacterial inocula were prepared as follows: bacteria were grown for 48 h at 25 °C in liquid LB medium,
centrifuged, washed and then suspended with saline water (NaCl 8.5 g/
l) to an OD 600 of 0.8. Thereafter, the bacteria suspension was added to
the seeds and incubated for 1 h before sowing.
2.8.2. Pathogen introduction
Pathogen was grown on sterilized millet seed in 1 litre flask containing 50 g of millets seed and 50 ml water. The inoculum was mixed
with sterile soil (Pro-mix) and incubated for 48 h in darkness at 30 °C
inside the plastic bag to increase the humidity, the density of Fusarium
solani in infested soil was measured106 CFU per gram of soil.
2.8.3. Experimental design
The experiment was conducted with 9 treatments for each cultivar
as follows; chemical treatment (CH), bacteria (B16C, B12 and B8P) used
separately and alone, bacteria used separately with fungus and positive/negative control. Plants were arranged in a randomized block per
each treatment group with six factors (cultivar, F.solani, chemical
treatment (CH), B16C, B12, B8P) with 5 replicates for each treatment.
This experiment was maintained for 6 weeks at 25 °C 16 h light. Plants
were watered 4 times per week.
Fig. 1. Boxplots describing the inhibition activity (%) of 16 endophytes bacteria against
F.solani. a,b,c,d,e,f,g,h,i denote a significant difference between the antagonist activity of
bacteria (SNK, p = < 0.05).
PCR was performed in a total volume of 25 μl of a mix containing 125 μl
of 2 x quanta, BSA (3 mg/ml) 25 μl, 5 μM primer and 2, 5 μl template
DNA. The amplification conditions were made as follows: 5 min at
95 °C; 15 s at 95 °C, 45 s at 60 °C and 1 min at 72 °C for 40 cycles.
2.8.4. Disease assessments
After six weeks, plants were destructively sampled and examined for
root and foliar symptoms. The pants were removed from the pots,
washed off under running water and the roots were examined for presence of symptoms. Length and weight of roots and shoot were measured. The severity of the symptoms was evaluated on a percentage
scale of the root system. The symptoms were rated after 30 days on a
scale from 1 to 5, where 1: completely healthy root tissue; 2: a few
superficial dark-brown lesions of root tissue (0–25%), 3: superficial
dark-brown lesions of root tissue (25–50%),4: necrotic root (50–75%)
and 5: tissue death (75–100%) (Vettraino et al., 2003). The density of
Fusarium solani was determined as follows: 10 g of soil was added with
90 ml of 0, 1% sterile water agar and shaken at 100pm for 10 min.
Thereafter, the suspension was serially diluted using a saline water
2.8. Greenhouse experiment
Based on the “in vitro” results, three isolates B8P, B16C and B12,
that suppressed the growth of Fusarium solani more than 50% were
selected for green house experiment. The fungicide Benomyl
(C14H18N4O3), 0.5 g/l was used as chemical amendment 1 day before
sowing seeds as reference treatment.
2.8.1. Seeds preparation
Seeds of three Tunisian cultivars of Faba bean Vicia faba Minor var.:
Saber, Local and Bachar were surface sterilized and then inoculated
Fig. 2. In vitro test of anti-fungal activity of 16 endophytes. Bacteria
were mixed in Yeast Glucose Mineral Agar (YGMA), mycelial plugs
were placed on the agar surface. The agar plates were incubated at
30 °C for 5 days in darkness, YGMA was used as a negative control.
Radial mycelia growth of Fusarium solani was measured (cm). Each
endophyte was screened in three independent replicate; A, high inhibition of growth mycelium; B, medium inhibition of growth mycelium; C, YGMA control.
133
Applied Soil Ecology 124 (2018) 131–140
A. Bahroun et al.
Table 2
Identification of the antagonist strains of endophytic bacteria. The DNA of the 16 endophyte bacteria were identified used 16S rDNA and the sequences were compared using BLAST
searches to GenBank.
Isolate code
Best BLAST match
Host
B12
B3P
B4
B6S
B14
B16C
B7S
B6P
B8P
B15
B7P
B11P
B16A
B8
B9P
B9S
Pseudomonas yamanorum
Pseudomonas frederiksbergensis
Pseudomonas yamanorum
Pseudomonas fragi
Pseudomonas putidia
Rahnella aquatilis
Stenotrophomonas maltophilia
Pseudomonas brenneri
Pseudomonas fluorescens
Enterobacter cloacae
Enterobacter cloacae
Pseudomonas yamanorum
Stenotrophomonas maltophilia
Pseudomonas rhodesiae
Pseudomonas yamanorum
Pseudomonas yamanorum
Vicia
Vicia
Vicia
Vicia
Vicia
Vicia
Vicia
Vicia
Vicia
Vicia
Vicia
Vicia
Vicia
Vicia
Vicia
Vicia
faba
faba
faba
faba
faba
faba
faba
faba
faba
faba
faba
faba
faba
faba
faba
faba
source
Country
Accession Number
nodule
nodule
nodule
nodule
nodule
nodule
nodule
nodule
nodule
nodule
nodule
nodule
nodule
nodule
nodule
nodule
Tunisia
Tunisia
Tunisia
Tunisia
Tunisia
Tunisia
Tunisia
Tunisia
Tunisia
Tunisia
Tunisia
Tunisia
Tunisia
Tunisia
Tunisia
Tunisia
KU647164
KU647165
KU647166
KU647167
KU647168
KU647169
KU647170
KU647171
KU647172
KU647173
KU647174
KU647175
KU647176
KU647177
KU647178
KU647179
Table 3
Three-way ANOVA Table of F- and p-values on the effect of inoculation of plant with and without treatments (anti-fungal strain and chemical) on root and shoot length and fresh weight
in the presence or absence of pathogen. Significant effects (p < 0.05) are highlighted in bold.
Factor
Cultivar (C)
Fusarium solani (F)
Treatments (T)
C*F
C* T
F*T
C*F*T
d.f.
2
1
4
2
8
4
8
Root Length
Root weight
Shoot Length
Shoot Weight
F
p
F
p
F
p
F
p
37.2
121.8
13.3
3.2
9.2
7.1
0.6
< 0.0001
< 0.0001
< 0.0001
0.045
< 0.0001
< 0.0001
0.710
1.1
82.1
17.4
0.8
6
10
1.6
0.333
< 0.0001
< 0.0001
0.438
0.002
< 0.0001
0.156
46
91.4
17.49
0.4
2.4
12.7
0.6
< 0.0001
< 0.0001
< 0.0001
0.667
0.017
< 0.0001
0.728
37
75.5
7.6
2.4
9
9.4
4.9
< 0.0001
< 0.0001
< 0.0001
0.094
< 0.0001
< 0.0001
< 0.0001
(NaCl at 8.5 g/l) in flask tubes and 1 ml from each of 10−2 to 10−5
serial dilutions was plated onto PPA (peptone-pentachhlorontrobenzene-based agar) medium in petri dishes (Borrego-Benjumea
et al., 2014). The density of Fusarium solani was expressed as the
number of colony-forming units (CFU).
Interestingly, three bacterial isolates B16C, B12 and B8P, decreased
more pronounced the mycelia growth of Fusarium solani (70.83%),
(60%) and (51%) respectively.
2.9. Statistical analysis
Based on 16S rDNA sequence (Table 2, Fig. 3), the 16 endophytic
bacteria where affiliated to the genus Pseudomonas (68.75%), Stenotrophomonas (12.5%), Enterobacter (12.5%) and Rahnella (6.25%)
(Fig. 3). The three best effective strains were attribuated to Rahnella
aquatilis (B16C), Pseudomonas yamanorum (B12) and Pseudomonas
fluorescens (B8P) species.
3.2. Molecular identification of endophytic bacteria
The results generated by PCR were scored as present (1) and (0) as
absent. The results were analysed with the biocontrol indicator and
described with multiple correspondence analysis (MCA). Data of plant
biomass and symptom severity were analysed using the procedures of
the general linear models (GLM) and type III sum of squares. Fusarium
solani population was performed on log CFU transformation. For all
tests, the level of the significance was assessed at P = < 0.05. The
average means were compared using Fisher’s LSD (Least Significant
Difference) and Student-Newman-Keuls (S-N-K) test in order to distinguish groups. All statistical analysis was performed using of the SPSS
software (18.0) and Mega (7.0) to generate the phylogenetic tree.
3.3. Microbial traits
3.3.1. Siderophores and indole acetic acid (IAA) production
Most of endophytic bacteria (93.4%) produce the siderophores and
only (62%) produce Indole Acetic Acid (IAA) (Fig. 3). Remarkably, the
three best biocontrol bacterial strains; Rahnella aquatilis B16C, Pseudomonas yamanorum B12 and Pseudomonas fluorescens B8P produce only
siderophores.
3. Results
3.3.2. Presence of biosynthetic gene in endophytes strains
This study shows that the 16 strains of endophytes screened were
able to produce an arsenal of antibiotics including pyrrolnitrin (PRN),
phenazine (PHZ), hydrogen cyanide (HCN), phenazine-1-carboxylic
acid (PCA), pyoluteorin (PLt) and 2, 4-diacetylphloroglucinol (DAPG)
based (Fig. 3A). The majorty of bacteria (87.5%) tested can produce at
least one or more antibiotics which can be involved in the biocontrol
activity. The best three biocontrol bacteria produced pyrrolnitrin and
HCN. Pseudomonas strains (B12 and B8P) also harbored the genes required for phenzine production. Bacterial strains were distributed in
3.1. In vitro interaction between endophytic bacteria and Fusarium solani
The “In Vitro” dual (endophyte-F.solani) method was used to screen
120 endophytes from nodule of Vicia faba and Cicer arietinum for their
antagonistic activity against F. solani. Zones of inhibition were measured 4–5 days of co-incubation (Table, Supplementary data). Results
showed that 16 endophytic bacteria, all belonging to the Faba bean
nodules, (representing 13.33% of the endophytes screened) showed an
antifungal activity (Figs. 1 and 2) with significant difference of inhibition of F.solani growth between them (F15,32 = 16.8, p < 0.0001).
134
Applied Soil Ecology 124 (2018) 131–140
A. Bahroun et al.
Fig. 3. Biocontrol traits of endophytic strains:.
(A) phylogenetic tree of antagonist endophytes with genetic similarity
and antibiotic genes and antifungal compounds involved in biocontrol
activity. Strains were identified based on the amplification and sequencing of the partial rrs gene encoding 16S ribosomal DNA. The
phylogenetic tree was inferred using the UPGMA method (Sneath and
Sokal, 1973). The scale bar was computed using the Maximum
Composite Likelihood method (Tamura et al., 2004) and the phylogenetic tree was generated using MEGA7 (Kumar et al., 2016). The
phylogenetic tree represents five groups. Colored box represents the
presence of the antibiotic gene and the anti-fungal compounds (IAA
and siderophores).
(B) Multiple Correspondence Analysis (MCA) describing four groups
of the endophytes bacteria based on qualitative variables; presence/
absence of all the biocontrol indicators (antibiotics, siderophores and
IAA production). Colored label represents the group of each strain in
the phylogentic tree.
root weight (LSD, p = 0.041, p = 0.002). In the local cultivar, only
B16C increase positively shoot weight (LSD, p = 0.003) (Fig. 4).
Cultivars grown in infested soil with F. solani showed that with the
cultivar Saber, all the treatment increase all the parameters of plant
growth (LSD, p < 0.01) compared with positive control C(+) (with
fungi). Concerning the cultivar Bachar, chemical treatment (CH), B16C,
B12 and B8P increase significantly root length and shoot length (LSD,
p < 0.01) compared with positive control C(+). Both B16C and B12
increase significantly root weight (p < 0.001). However shoot weight
was not affected by any treatment. In the local cultivar chemical
treatment (CH), B16C and B12 increase significantly (LSD, p < 0.01)
root and shoot length. Both B16C and chemical treatment CH increase
significantly root weight (LSD, p < 0.008, p < 0.049) (Fig. 5).
Concerning the effect on symptom root severity, treatments affect
significantly (ANOVA, p < 0.0001) all the three cultivars, as illustrated with the visual index (Fig. 6). The endophyte B16C and chemical treatment (CH) decrease the symptom root severity of cultivars
Bachar (84%) and (88%) respectively, Saber (82%) and (86%) respectively and Local (85%) and (86%) respectively. However B8P and B12
four groups based on the presence or absence of biocontrol traits. B16C,
B12 and B8P were classed on the same group (Fig. 3B).
3.4. In vivo experiment
Based on in vitro essay, three antagonist bacteria; Rahnella aquatilis
B16C, Pseudomonas yamanorum B12 and Pseudomonas fluorescens B8P
were subjected to green house experiment to confirm their anti-fungal
activity. After 6 weeks, the green house assay indicated that plant
growth parameters, unless root weight, differed significantly between
the three cultivars (Table 3). The presence of F.solani decreases significantly all the variables describing plant growth (Table 3). The plant
growth parameters were also differing significantly between treatments; in addition the multiple interaction factors (cultivar/fungi/
strains) had a significant effect at least one variable (Table 3).
In non infested soil, bacteria did not affect all plant growth parameters in the cultivar Saber (ANOVA, p > 0.05). In the cultivar
Bachar, B16C increase significantly root length and weight (LSD,
p = 0.002, p = 0.032). However, B12 and B8P decrease significantly
135
Applied Soil Ecology 124 (2018) 131–140
A. Bahroun et al.
Fig. 4. Plant fresh weight and length of cultivars inoculated only with bacteria in sterile soil; A, Bachar; B, Local and C, Saber. Histograms represent mean value of plant fresh weight and
length of cultivars. C(−), negative Control (without F. solani); endophytes bacteria, B8P; B12; B16C. Error bars represent standard error, (NS, ns) no significant difference and letters
denote significant difference (SNK, p = < 0.05) in plant growth.
overall cultivars. There is no significant difference between chemical
treatment (CH) and B16C in the three cultivars; Saber, Bachar and Local
(LSD, p = 0.206, p = 0.285, p = 0.179) respectively. Both chemical
treatment (CH) and B16C were the best treatments in reducing the F.
solani population (Fig. 8).
The evaluation of bacteria interaction with F. solani effect on plant
growth, symptom root severity and F. solani density showed that both R.
decrease the root severity of cultivars Bachar (76%) and (74%) respectively, Saber (72%) and (66%) respectively and Local (74%) and
(68%) respectively (Fig. 7).
The evaluation of Fusarium solani density on the soil (Fig. 8) showed
that treatments significantly affect all cultivars (ANOVA on log transformed data, p < 0.0001). B16C reduced significantly the pathogen
population (LSD, p < 0.0001) compared to the other bacteria on
136
Applied Soil Ecology 124 (2018) 131–140
A. Bahroun et al.
Fig. 5. Plant fresh weight and length of three cultivars; A, Bachar; B, Local and C, Saber in soil infested with F.solani S55 and inoculated with bacteria, B8P, B12, B16C or amended with
chemical treatment, CH. C(−), negative Control (without F.solani); C(+), positive Control (with F.solani) and F, F.solani. Histograms represent mean value of plant fresh weight and
length of cultivars. Error bars represent standard error, (NS, ns) no significant difference and letters denote significant difference (SNK, p = < 0.05) in plant growth.
against F. solani. Bacteria were identified using 16S method and then
tested for biocontrol indicators. Most of them produce siderophores and
auxin. Siderophores stimulate plant growth (Kloepper et al., 1980) and
inhibit various phytopathogenic fungi (Buysens et al., 1996; Sayyed and
Patel, 2011; Tariq et al., 2017). Similarly, Indole acetic acid (IAA) is
important for plant growth and defence mechanisms (Pérez et al.,
2016). Endophytic bacteria harbour biocontrol genes responsible for
the production of the antibiotics compounds Pyrrolnitrin (PRN), Phenazine (PHZ), Phenazine-1-carboxylic acid (PCA), Pyoluteorin (PLt), 2,
4-Diacetylphloroglucinol (DAPG) and Hydrogen cyanide (HCN). These
molecules are capable of killing or decreasing pathogen growth
aquatilis B16C and Benomyl chemical treatment (CH) showed the best
results with the three cultivars (Fig. 9) and both of them were classed in
the same group with the negative control C (−) (Without F.solani).
4. Discussion
In this study, we highlight that the root nodules of legumes are a
valuable source of potent endophytes that may serve to control soilborne diseases. A collection of 120 bacterial endophytes isolated from
nodules tissues of Vicia faba and Cicer arietinum were screened in vitro.
Sixteen strains have shown high and medium anti-fungal activity
137
Applied Soil Ecology 124 (2018) 131–140
A. Bahroun et al.
The three bacterial strains that had no auxin production, did not
showed Plant Growth Promoting activities in non infected soil, but had
positive effect in the presence of fungi. This is due to the fact that
biocontrol traits are not always linked with plant growth promotion and
it's quite difficult that one strain of bacteria encompasses both characters (Weidner et al., 2017). The improvement of vegetative growth of
infested plants is for probably linked to the observed reduction in disease severity in roots which is significantly revealed in our work. Indeed, all analyzed bacteria species further reduced F. solani population
in the soil, confirming that increased plant health was due to pathogen
inhibition.
Practical output of our study suggests that Rahnella aquatilis B16C as
best potential biocontrol agent. R. aquatilis specie could be suggested
for fungal disease biological control due to its pathogen inhibition and
plant growth promoting characteristics, as well as the safety of using
this species since it is rarely reported to human pathogen (Christiaens
et al., 1987; Martins et al., 2015). In other hand, the majority of studies
in the framework of biocontrol have reported the use of Bacillus Spp.
and Pseudomonas Spp (Hinarejos et al., 2016; Yang et al., 2017;
Haddoudi et al., 2017). R. aquatilis remains a little mysterious especially as biocontrol bacteria, and our finding represent an added value
in the exploration of soil microorganisms’ biodiversity, especially legume nodule endophytic microorganisms, into the biocontrol strategies.
Fig. 6. Symptom root severity of three cultivars; Bachar, Local and Saber, in soil infested
with F.solani and inoculated with bacteria, B16C, B12, B8P or amended with chemical
treatment, CH; C(+), positive control (with F.solani). Histograms represent mean value of
symptom root severity of cultivars. Error bars represent standard error and letters (a, b, c
and d) denote significant difference (SNK, p = < 0.05) in root severity.
(Lugtenberg and Kamilova, 2009). Bacterial antifungal activity is often
based on the production of a range of bioactive secondary metabolites,
which will have variable effects on different pathogens (Duffy et al.,
2003). In our study, we showed that bacteria with high biocontrol
potential, B16C, B12 and B8P, shared the production of siderophores,
PRN and HCN. PRN is a chlorinated phenylpyrrole antibiotics and HCN
is a volatile compound. Both are involved in biocontrol and have an
activity against several soil-borne fungi (de Souza and Raaijmakers,
2003; Haas et al., 2002).
In order to confirm the anti-fungal activity, the three endophytes
B16C, B12 and B8P that decreased the growth of mycelium of Fusarium
solani more than 50% were selected to be evaluated in green house
compared with chemical treatment CH. In this work, we selected a set
of three effective strains among 120 tested isolates. This percentage of
2% indicates the complexity of researching biocontrol agents based on
natural soil microorganisms’ biodiversity. This requires paying deep
investigation at different research steps to get the really effective strain.
The rarity of natural biocontrol agents was earlier reported by
(Haddoudi et al., 2017) who selected only one effective strain among a
collection of 100 bacterial isolates.
5. Conclusion
In our study, research of effective biocontrol agents, was started by
“In vitro” screening of endophytes bacteria. Three strains showed important biocontrol characteristics, and then, confirmed by green house
experiment. Effective strains have the ability to suppress Fusarium solani. Rahnella aquatilis B16C showed the best protecting potentiality, in
“In vivo” greenhouse assays, with the three faba bean cultivars and it is,
consequently, suggested as biocontrol agent for field application. In a
related project and to confirm the usefulness and the safety of our results at large scale, field trials are planned for studying the survey of our
inoculated strain on field conditions and its interaction with local soils’
microorganisms. On the other hand, our study confirms previous suggestion of legume nodules as suitable untapped source of beneficial
microorganisms that can be used to control pathogens in a sustainable
way.
Fig. 7. Severity of symptoms in root of cultivar Bachar. A, plant was grown in soil infested with Fusarium solani; B, plant was grown in soil infested with S55 and inoculated with B8P; C,
plant was grown in soil infested with F. solani and inoculated with B12; D, plant was grown in soil infested with Fusarium solani and inoculated with B16C; E, plant was grown in soil
infested with Fusarium solani and amended with chemical treatment CH; F, plant was grown in sterile soil.
138
Applied Soil Ecology 124 (2018) 131–140
A. Bahroun et al.
Fig. 8. Boxplots representing log-transformed density of F.solani in infested soil and inoculated with
bacteria, B8P, B12, B16C or amended with chemical
treatment, CH; C(+), positive control (with F.solani).
Three cultivars A, Bachar; B, Local; C, Saber with five
replications for each treatment. Error bars represent
standard error and letters (a, b and c) denote significant difference (SNK, p = < 0.05) in F.solani S55
density, Medians are displayed together with 25th
and 75th quartiles.
Fig. 9. principal components analysis (PCA) of plant
growth parameters (length and weight), symptom
root severity and Fusarim solani density for three
cultivars A, Bachar; B, Local; C, Saber grown in soil
infested with F.solani and inoculated with bacteria,
B8P, B12, B16C or amended with chemical treatment, CH. C(−), negative Control (without F.solani);
C(+), positive Control (with F.solani) and F, F.solani.
139
Applied Soil Ecology 124 (2018) 131–140
A. Bahroun et al.
Acknowledgments
control and plant growth promotion potential of Salicaceae endophytes. Front.
Microbiol. 8. http://dx.doi.org/10.3389/fmicb.2017.00386.
Kharrat, M., Ouchari, H., 2011. Faba bean status and prospects in Tunisia. Grain Legum
56, 11–12.
Kloepper, J.W., Leong, J., Teintze, M., Schroth, M.N., 1980. Enhanced plant growth by
siderophores produced by plant growth-promoting rhizobacteria. Nature 286,
885–886.
Kobayashi, D.Y., Palumbo, J.D., 2000. Bacterial endophytes and their effects on plants
and uses in agriculture. Microb. Endophytes 19, 199–233.
Kumar, S., Stecher, G., Tamura, K., 2016. MEGA7: molecular evolutionary genetics
analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33, 1870–1874.
Leveau, J.H.J., Lindow, S.E., 2005. Utilization of the plant hormone indole-3-acetic acid
for growth by Pseudomonas putida strain 1290. Appl. Environ. Microbiol. 71,
2365–2371. http://dx.doi.org/10.1128/AEM.71.5.2365-2371.2005.
Lodewyckx, C., Vangronsveld, J., Porteous, F., Moore, E.R., Taghavi, S., Mezgeay, M., van
der Lelie, D., 2002. Endophytic bacteria and their potential applications. Crit. Rev.
Plant Sci. 21, 583–606.
Lugtenberg, B., Kamilova, F., 2009. Plant-growth-promoting rhizobacteria. Annu. Rev.
Microbiol. 63, 541–556.
Martins, W., Carvalhaes, C.G., Cayô, R., Gales, A.C., Pignatari, A.C., 2015. Co-transmission of Rahnella aquatilis between hospitalized patients. Braz. J. Infect. Dis. 19,
648–650.
Narula, S., Anand, R.C., Dudeja, S.S., 2013. Beneficial traits of endophytic bacteria from
field pea nodules and plant growth promotion of field pea. J. Food Legum. 26, 73–79.
Oldroyd, G.E., Downie, J.A., 2008. Coordinating nodule morphogenesis with rhizobial
infection in legumes. Annu. Rev. Plant Biol. 59, 519–546.
Pérez, C., Barcia-Piedras, J.M., López, A., Camacho, M., 2016. Characterization of plant
growth promoting bacteria (PGPR) isolated from the rhizosphere of Arthrocnemum
macrostachyum. Biosaia Rev. Los Másteres Biotecnol. Sanit. Biotecnol. Ambient Ind.
Aliment 0.
Raaijmakers, J.M., Weller, D.M., Thomashow, L.S., 1997. Frequency of antibiotic-producing Pseudomonas spp. in natural environments. Appl. Environ. Microbiol. 63,
881–887.
Rajendran, G., Patel, M.H., Joshi, S.J., 2012. Isolation and characterization of noduleassociated Exiguobacterium sp. from the root nodules of Fenugreek (Trigonella
foenum-graecum) and their possible role in plant growth promotion. Int. J. Microbiol.
2012.
Reetha, A.K., Pavani, S.L., Mohan, S., 2014. Hydrogen cyanide production ability by
bacterial antagonist and their antibiotics inhibition potential on Macrophomina
phaseolina (Tassi.) Goid. Int. J. Curr. Microbiol. Appl. Sci. 3, 172–178.
Reeve, W., Ardley, J., Tian, R., Eshragi, L., Yoon, J.W., Ngamwisetkun, P., Seshadri, R.,
Ivanova, N.N., Kyrpides, N.C., 2015. A Genomic Encyclopedia of the Root Nodule
Bacteria: assessing genetic diversity through a systematic biogeographic survey.
Stand. Genomic Sci. 10, 14. http://dx.doi.org/10.1186/1944-3277-10-14.
Santoyo, G., Moreno-Hagelsieb, G., del Carmen Orozco-Mosqueda, M., Glick, B.R., 2016.
Plant growth-promoting bacterial endophytes. Microbiol. Res. 183, 92–99. http://dx.
doi.org/10.1016/j.micres.2015.11.008.
Sayyed, R.Z., Patel, P.R., 2011. Biocontrol potential of siderophore producing heavy
metal resistant Alcaligenes sp. and Pseudomonas aeruginosa RZS3 vis-à-vis organophosphorus fungicide. Indian J. Microbiol. 51, 266–272. http://dx.doi.org/10.1007/
s12088-011-0170-x.
Schwyn, B., Neilands, J.B., 1987. Universal chemical assay for the detection and determination of siderophores. Anal. Biochem. 160, 47–56.
Sneath, P.H.A., Sokal, R.R., 1973. Numerical Taxonomy Freeman San Francisco Google
Scholar.
Sperschneider, J., Dodds, P.N., Gardiner, D.M., Manners, J.M., Singh, K.B., Taylor, J.M.,
2015. Advances and challenges in computational prediction of effectors from plant
pathogenic fungi. PLoS Pathog. 11, e1004806.
Stackebrandt, E., Liesack, W., 1993. Nucleic acids and classification. Handb. New Bact.
Syst. Acad. Lond. 151–194.
Stone, J.K., Bacon, C.W., White, J.F., 2000. An overview of endophytic microbes: endophytism defined. Microb. Endophytes 3, 29–33.
Svercel, M., Duffy, B., Défago, G., 2007. PCR amplification of hydrogen cyanide biosynthetic locus hcnAB in Pseudomonas spp. J. Microbiol. Methods 70, 209–213.
Tamura, K., Nei, M., Kumar, S., 2004. Prospects for inferring very large phylogenies by
using the neighbor-joining method. Proc. Natl. Acad. Sci. U. S. A. 101, 11030–11035.
Tariq, M., Noman, M., Ahmed, T., Hameed, A., Manzoor, N., Zafar, M., 2017. Antagonistic
features displayed by Plant Growth Promoting Rhizobacteria (PGPR): A Review.
Vacheron, J., Desbrosses, G., Bouffaud, M.-L., Touraine, B., Moënne-Loccoz, Y., Muller,
D., Legendre, L., Wisniewski-Dyé, F., Prigent-Combaret, C., 2013. Plant growthpromoting rhizobacteria and root system functioning. Front. Plant Sci. 4. http://dx.
doi.org/10.3389/fpls.2013.00356.
Vettraino, A.M., Belisario, A., Maccaroni, M., Vannini, A., 2003. Evaluation of root damage to English walnut caused by five Phytophthora species. Plant Pathol. 52,
491–495. http://dx.doi.org/10.1046/j.1365-3059.2003.00864.x.
Weidner, S., Latz, E., Agaras, B., Valverde, C., Jousset, A., 2017. Protozoa stimulate the
plant beneficial activity of rhizospheric pseudomonads. Plant Soil 410, 509–515.
Yang, M., Mavrodi, D.V., Mavrodi, O.V., Thomashow, L.S., Weller, D.M., 2017.
Construction of a recombinant strain of Pseudomonas fluorescens producing both
phenazine-1-carboxylic acid and cyclic lipopeptide for the biocontrol of take-all
disease of wheat. Eur. J. Plant Pathol. 1–12.
Authors are grateful to Centre of Biotechnology of Borj Cedria,
Agriculture-agrifood London Ontario Canada especially Dr Yuan Zechun and Brian Weselowski (for assuring the English checking in the
revised version) and to Utrecht University Netherlands to carry out this
study. This research was supported by scholarship from the government
of Tunisia (University Tunis El Manar).
Appendix A. Supplementary data
Supplementary data associated with this article can be found, in the
online version, at https://doi.org/10.1016/j.apsoil.2017.10.025.
References
Aserse, A.A., Räsänen, L.A., Aseffa, F., Hailemariam, A., Lindström, K., 2013. Diversity of
sporadic symbionts and nonsymbiotic endophytic bacteria isolated from nodules of
woody shrub, and food legumes in Ethiopia. Appl. Microbiol. Biotechnol. 97,
10117–10134.
Borrego-Benjumea, A., Basallote-Ureba, M.J., Melero-Vara, J.M., Abbasi, P.A., 2014.
Characterization of Fusarium isolates from asparagus fields in southwestern Ontario
and influence of soil organic amendments on Fusarium crown and root rot.
Phytopathology 104, 403–415.
Buysens, S., Heungens, K., Poppe, J., Hofte, M., 1996. Involvement of pyochelin and
pyoverdin in suppression of pythium-induced damping-off of tomato by
Pseudomonas aeruginosa 7NSK2. Appl. Environ. Microbiol. 62, 865–871.
Chakraborty, S., Newton, A.C., 2011. Climate change, plant diseases and food security: an
overview. Plant Pathol. 60, 2–14.
Christiaens, E., Hansen, W., Moinet, J., 1987. Isolement des expectorations d’un patient
atteint de leucemie lymphoide chronique et de broncho-emphyseme d’une
Enterobacteriaceae nouvellement decrite: Rahnella aquatilis. Médecine Mal. Infect.
17, 732–734. http://dx.doi.org/10.1016/S0399-077X(87)80177-4.
de Souza, J.T., Raaijmakers, J.M., 2003. Polymorphisms within the prnD and pltC genes
from pyrrolnitrin and pyoluteorin-producing Pseudomonas and Burkholderia spp.
FEMS Microbiol. Ecol. 43, 21–34.
de Souza, J.T., Weller, D.M., Raaijmakers, J.M., 2003. Frequency, diversity, and activity
of 2, 4-diacetylphloroglucinol-producing fluorescent Pseudomonas spp. in Dutch
take-all decline soils. Phytopathology 93, 54–63.
Di, X., Takken, F.L., Tintor, N., 2016. How phytohormones shape interactions between
plants and the soil-borne fungus fusarium oxysporum. Front. Plant Sci. 7.
Duffy, B., Schouten, A., Raaijmakers, J.M., 2003. Pathogen self-defense: mechanisms to
counteract microbial antagonism. Annu. Rev. Phytopathol. 41, 501–538.
Edwards, U., Rogall, T., Blöcker, H., Emde, M., Böttger, E.C., 1989. Isolation and direct
complete nucleotide determination of entire genes: characterization of a gene coding
for 16S ribosomal RNA. Nucleic Acids Res. 17, 7843–7853.
Ghosh, S., Basu, P.S., 2006. Production and metabolism of indole acetic acid in roots and
root nodules of Phaseolus mungo. Microbiol. Res. 161, 362–366. http://dx.doi.org/
10.1016/j.micres.2006.01.001.
Glick, B.R., Cheng, Z., Czarny, J., Duan, J., 2007. Promotion of plant growth by ACC
deaminase-producing soil bacteria. Eur. J. Plant Pathol. 119, 329–339.
Glick, B.R., 1995. The enhancement of plant growth by free-living bacteria. Can. J.
Microbiol. 41, 109–117.
Gordon, S.A., Weber, R.P., 1951. Colorimetric estimation of indoleacetic acid. Plant
Physiol. 26, 192–195.
Goswami, R.S., Dong, Y., Punja, Z.K., 2008. Host range and mycotoxin production by
Fusarium equiseti isolates originating from ginseng fields1. Can. J. Plant Pathol. 30,
155–160. http://dx.doi.org/10.1080/07060660809507506.
Gray, E.J., Smith, D.L., 2005. Intracellular and extracellular PGPR: commonalities and
distinctions in the plant–bacterium signaling processes. Soil Biol. Biochem. 37,
395–412.
Haas, D., Keel, C., Reimmann, C., 2002. Signal transduction in plant-beneficial rhizobacteria with biocontrol properties. Antonie Van Leeuwenhoek 81, 385–395.
Haddoudi, I., Sendi, Y., Batnini, M., Ben Romdhane, S., Mhadhbi, H., Mrabet, M., 2017.
The bean rhizosphere Pseudomonas aeruginosa strain RZ9 strongly reduces Fusarium
culmorum growth and infectiveness of plant roots. Span. J. Agric. Res. 15 (2), e1003.
http://dx.doi.org/10.5424/sjar/2017152-10595. eISSN: 2171-9292.
Hinarejos, E., Castellano, M., Rodrigo, I., Bellés, J.M., Conejero, V., López-Gresa, M.P.,
Lisón, P., 2016. Bacillus subtilis IAB/BS03 as a potential biological control agent. Eur.
J. Plant Pathol. 146, 597–608.
Hmouni, A., Hajlaoui, M. r., Mlaiki, A., 1996. Résistance de Botrytis cinerea aux benzimidazoles et aux dicarboximides dans les cultures abritées de tomate en Tunisie.
EPPO Bull. 26, 697–705. http://dx.doi.org/10.1111/j.1365-2338.1996. tb01513.x.
Horrigan, L., Lawrence, R.S., Walker, P., 2002. How sustainable agriculture can address
the environmental and human health harms of industrial agriculture. Environ. Health
Perspect. 110, 445.
Kandel, S.L., Firrincieli, A., Joubert, P.M., Okubara, P.A., Leston, N.D., McGeorge, K.M.,
Mugnozza, G.S., Harfouche, A., Kim, S.-H., Doty, S.L., 2017. An In vitro study of bio-
140