Received: 18 April 2018
|
Accepted: 17 August 2018
DOI: 10.1002/jcp.27363
ORIGINAL RESEARCH ARTICLE
2‐Methoxyestradiol attenuates chronic‐intermittent‐
hypoxia‐induced pulmonary hypertension through regulating
microRNA-223
Shengyu Hao1,2*
Jieqiong Song1
|
|
Liyan Jiang1*
Huan Lu1,2
1
Department of Pulmonary Medicine,
Zhongshan Hospital, Fudan University,
Shanghai, China
|
|
Cuiping Fu1,2*
|
Xiaodan Wu1,2
|
Xu Wu1
|
Zilong Liu1
|
Shanqun Li1,2
Abstract
Pulmonary hypertension (PH) is prevalent in patients with obstructive sleep apnea
2
Clinical Centre for Sleep Breathing Disorder
and Snoring, Zhongshan Hospital, Fudan
University, Shanghai, China
Correspondence
Shanqun Li and Xiaodan Wu, Department of
Pulmonary Medicine, Zhongshan Hospital,
Fudan University, 180 Fenglin Road, Shanghai
200032, China.
Email: li.shanqun@zs-hospital.sh.cn (S.L.);
wu.xiaodan@zs-hospital.sh.cn (X.W.)
(OSA) syndrome, and coexistence of PH and OSA indicates a worse prognosis and
higher mortality. Chronic intermittent hypoxia (CIH) is the key pathogenesis of OSA.
Also, microRNA‐223 (miR‐223) plays a role in the regulation of CIH‐induced PH
process. However, the detailed mechanism of CIH inducing PH is still unclear. This
study aimed to investigate the pathological process of CIH associated PH and explore
the potential therapeutic methods. In this study, adult Sprague–Dawley rats were
exposed to CIH or normoxic (N) conditions with 2‐methoxyestradiol (2‐Me) or
vehicle treatment for 6 weeks. The results showed that 2‐Me treatment reduced the
Funding information
National Natural Science Foundation of China,
Grant/Award Numbers: 81770083,
81500058, 81400043, 81570081; National
Key Research and Development Program of
China, Grant/Award Number:
2018YFC130103
progression of pulmonary angiogenesis in CIH rats, and alleviated proliferation,
cellular migration, and reactive oxygen species formation was induced by CIH in
pulmonary artery smooth muscle cells (PASMCs). CIH decreased the expression of
miR‐223, whereas 2‐Me reversed the downregulation of miR‐223 both in vivo and in
vitro. Furthermore, the antiangiogenic effect of 2‐Me observed in PASMCs was
abrogated by miR‐223 inhibitor, while enhanced by miR‐223 mimic. These findings
suggested that miR‐223 played an important role in the process of CIH inducing PH,
and 2‐Me might reverse CIH‐induced PH via upregulating miR‐223.
KEYWORDS
2‐methoxyestradiol (2‐ME), chronic intermittent hypoxia (CIH), microRNA‐223 (miR‐223),
pulmonary hypertension (PH)
1 | INTRODUCTION
pulmonary hypertension (PH). Prevalence of PH in OSA remained
high, ranging from 17% to 53% across various studies (Alchanatis
Obstructive sleep apnea (OSA) is a common disease worldwide,
et al., 2001). OSA can lead to the development of right ventricular
affecting at least 9%–15% of middle‐aged adults (Ayas, Drager,
(RV) hypertrophy and dysfunction in patients with PH. Moreover, PH
Morrell, & Polotsky, 2017, Trzepizur & Gagnadoux, 2014). Several
in patients with OSA predicts functional limitations and a poor
studies have reported OSA as a risk factor for systemic hypertension
prognosis (Sajkov, Cowie, Thornton, Espinoza, & McEvoy, 1994,
and various cardiovascular diseases (Javaheri et al., 2017, Yu et al.,
Wong, Williams, & Mok, 2017). Chronic intermittent hypoxia (CIH) is
2017). Epidemic studies have reported that OSA is associated with
a key character of OSA, which can lead to PH and RV dysfunction.
Accumulating evidence have indicated that OSA is associated with
*Shengyu Hao, Liyan Jiang, and Cuiping Fu have contributed equally to this study.
J Cell Physiol. 2018;1–12.
PH through a direct effect of reactive oxygen species (ROS)
wileyonlinelibrary.com/journal/jcp
© 2018 Wiley Periodicals, Inc.
|
1
2
|
production and relative signaling pathway, leading to the prolifera-
HAO
ET AL.
2 | M A T E R I A L S AN D M E T H O D S
tion of pulmonary artery smooth muscle cells (PASMCs). Therefore,
investigating the pathophysiology of CIH‐induced PH and exploring
for possible treatment targets may have significant implication in
clinical practice (Mellis & Caporali, 2018).
Changes in estradiol homeostasis have been observed in PH and
OSA patients, and estradiol decreases the risk of cardiovascular
diseases in patients with OSA (Frump, Albrecht, McClintick, & Lahm,
2017). Previous studies have suggested that estrogen exerts its
vascular protective and antitumor effects, at least in part, via
microRNA (miRNA) activity. Some estrogen‐induced miRNAs target
and regulate the expression of estrogen receptors, thus forming a
negative feedback loop (Perez‐Cremades, Mompeon, Vidal‐Gomez,
Hermenegildo, & Novella, 2018, Piperigkou, Franchi, Gotte, &
Karamanos, 2017). However, the estrogen replacement therapy
remains limited because of its side effects (Grady et al., 1992).
2‐Methoxyestradiol (2‐Me), a metabolite of estradiol, has been
described as a potent agent for treating cardiovascular diseases
with less side effects and inducing a direct antiangiogenesis effect
(Tofovic, 2010, Tofovic, Jones, Bilan, Jackson, & Petrusevska, 2010,
Zou et al., 2018). Therefore, we developed the postulation that 2‐Me
might act on CIH‐induced PH, and the antiangiogenesis effects may
be related with miRNA.
MiR‐223 is an antiangiogenic and hypoxia‐related miRNA,
targeting multiple components that affect vascular remodeling and
hypoxia‐induced PH (Taïbi, Metzinger‐Le Meuth, Massy, & Metzinger,
2014). MiR‐223 prevented proliferation and migration of ischemic
cardiac microvascular endothelial cells via the HIF‐1α associated
2.1 | Experimental animals
The model of CIH has been established according to our previous
studies (Fu et al., 2015, Wu et al., 2016). Briefly, rats were exposed to
1‐min period of intermittent hypoxia (IH) cycle in a designed
chamber, and the oxygen concentration was adjusted between 4%
and 21%. Nitrogen was delivered to the chambers at a rate sufficient
to achieve a fraction of inspired oxygen (FiO2) of 4–7% within 30 s
and maintain this level of FiO2 for 10 s. Then, oxygen was introduced
to achieve FiO2 of 20–21% within 30 s. This IH, which mimics a rate
of 60 apneas/hr−1 that is typical of severe OSA, was applied for
8 hr/day (8:00–16:00) for 6 weeks. All rats were obtained from the
Experimental Animal Center of Fudan University and were fed and
kept under the veterinary facility. The experimental protocol was
approved by the Ethics Committee of the Zhongshan Hospital, Fudan
University, Shanghai, China.
Twenty‐four Wistar rats (2 months old; 140–150 g) were
randomly assigned to the following groups (n = 6 per group): (a) the
normoxic control group (N): rats were in normoxic condition and
intraperitoneally injected with corn oil, 1.0 ml·kg−1·day−1; (b) N+2‐Me
group: similar conditions as in the control group, but intraperitoneally
injected with 250 μg·kg−1·day−1 of 2‐Me dissolved in corn oil; (c) CIH
group: rats were exposed to CIH condition and intraperitoneally
injected with corn oil, 1.0 ml·kg−1·day−1, 10 min before CIH; and (d)
CIH+2‐Me: similar conditions as in the CIH group, but intraperitoneally injected with 250 μg·kg−1·day−1 of 2‐Me dissolved in corn oil.
pathway (Dai, Ma, Song, Liu, Zhang, & Wu, 2014). Overexpression of
miR‐223 inhibited stretch‐stress‐enhanced proliferation and pre-
2.2 | Echocardiography
vented the activation of insulin‐like growth factor 1 receptor
(IGF‐1R) functionality and downstream PI3K–AKT signaling in
Echocardiographic measurement remains to be a valuable parameter, and
vascular smooth muscle cells (VSMCs) (Shi et al., 2016). MiR‐223
so the blood flow velocity of the pulmonary artery (PA) was detected by
was downregulated in the lungs of monocrotaline‐treated PH rats by
echocardiography. Briefly, the rats were slightly anesthetized using
directly repressing poly (ADP‐ribose) polymerase‐1 (PARP‐1)
isoflurane. After 12 hr at the end of the last IH cycle, rats were
(Meloche et al., 2015). In our previous research, we observed
anesthetized and analyzed within 2 hr. Inhaled isoflurane was adminis-
downregulation of miR‐223 in the lungs of CIH rats. Therefore, we
tered at 3% induction and 1–1.5% maintenance. After anesthetization,
inferred that miR‐223 might regulate the process of CIH‐induced PH.
each rat was placed in the supine position on a temperature‐controlled
2‐Me is a potent antioxidant that inhibits free‐radical‐induced
pad. A depilatory agent was then applied to the anterior chest to remove
proliferation and migration of VSMCs and is also described as a well‐
any hair. The probe of a Vivid S5 echocardiography system (Vivid S5, GE
characterized inhibitor of hypoxia‐inducible factor‐1α (HIF‐1α;
Healthcare, Chicago, IL) was gently be tilted laterally to obtain a view of
Mabjeesh et al., 2003). Presumably, oxidative stress seems to bridge
the PA crossing over the aorta. After that, the ultrasound was switched to
the induction of miR‐223 and 2‐Me, which subsequently effects
the color Doppler mode. The pulse wave line of the ultrasound can be
during the CIH‐induced PH. Hence, the objective of the present study
placed along the PA, parallel to the direction of blood flow in the vessel to
was to investigate the possible pathogenesis associated with CIH‐
obtain a flow waveform. This can be repeated to obtain the flow across
induced PH to validate the protective efficiency of 2‐Me and clarify
the pulmonary valve and the flow through the RV outflow tract. These
the role of miR‐223 in CIH combined with PH. For this purpose, we
views were saved and used to test the peak flow velocity of the PA.
established a rat model of CIH and used a cell model to investigate
the effect of CIH on PASMCs to evaluate the effects and
possible mechanisms of 2‐Me on PH changes occurring during CIH
2.3 | PA pressure measurement
exposure. These data would provide valuable and novel insights into
After measurement through echocardiography, a longitudinal skin
the pathophysiologic processes driving CIH‐induced PH and identify
incision was made on the right side of the neck, and blunt layer‐by‐
2‐Me as an effective therapeutic treatment target.
layer separation of the tissues was performed until the right external
HAO
|
ET AL.
3
jugular vein was exposed. A polyethylene catheter was gradually inserted
90% confluence. All experiments were performed on passage‐
into the PA through an incision in the right external jugular vein, and the
matched (within ± 1 passage) primary cells between passages 4 and 5.
RV systolic pressure was recorded using a pressure transducer, which
was interfaced to a BL‐420S Bio Lab System (Chengdu TME Technology
Co., Ltd., Chengdu, China). At the end of the experiment, the rats were
2.7 | CIH model in vitro
anesthetized with an intraperitoneal injection of 3% sodium pentobarbi-
Application of CIH or normoxia model in vitro was performed by a
tal, and various organs were harvested. RV hypertrophy was evaluated as
designed computer‐controlled incubator chamber attached to an
the ratio of the weight of the RV wall to that of the left ventricle plus
external O2–CO2 computer‐driven servo controller (Biospherix,
septum (S).
Lacona, NY), as previously described (Almendros et al., 2014).
PASMCs were maintained at 37°C in the custom‐made chamber,
2.4 | Immunohistochemistry
where the O2 concentration was altered between 0% and 21% every
30 min by injecting N2 or O2 with 5% CO2. The dissolved O2 inside
From each rat, the lung and heart that are cleared of blood were used
the culture medium was monitored by a laser O2 probe (Biospherix)
for histological analysis. Down lobe of the left lung was inflated with
and the CIH reached to 5% O2 and 21% O2 as hypoxic and normoxic
optimal cutting temperature compound (OCT; Sakura Tissue‐Tek)
values according to the sensing of the cells. Normal air conditions
before freezing, and stored at −80°C for immunohistochemistry, and
corresponded to 21% O2 and 5% CO2.
the upper lobe of the lung tissue was stored at −80°C for real‐time
polymerase chain reaction (PCR) and western blots analysis. Down
lobe of the right lung was fixed by perfusion with 3.8% paraformaldehyde and embedded in paraffin.
2.8 | PASMC proliferation and cell‐cycle analysis
Cell proliferation was analyzed by cell counting kit‐8 (CCK‐8) assay
Tissue sections (4 µm) were stained with hematoxylin and eosin
(Dojindo Laboratories, Kumamoto, Japan). PASMCs (1 × 103 cells/
(H&E) for routine histological analysis. Sections were deparaffinized,
well) were seeded in a 96‐well plate and allowed to adhere overnight.
rehydrated, retrieved the antigens, and then incubated with 1% H2O2 in
Cells were washed twice with PBS and starved for 24 hr in the
methanol for 15 min at room temperature to block endogenous
serum‐free medium. Then, the cells were treated with different
peroxidase. After blocked with 5% bovine serum albumin, sections
concentrations (0–100 μmol/L) of 2‐Me under normoxic or CIH
were incubated overnight with 1:100 anti‐HIF‐1α mouse monoclonal
conditions for 24, 48, and 72 hr. Ten microliters of CCK‐8 solution
antibody (No. ab8366) at 4°C. The secondary antibody used was a goat
was added to each well and incubated for another 2 hr. The
anti‐mouse antibody immunoglobulin G horseradish peroxidase (dilution
absorbance at 450 nm was assessed using a microplate reader.
1:100; cat. No. sc‐2005). The marker used was horseradish peroxidase,
The scratch wound assay was also used for cell proliferation
whereas 3,3′‐diaminobenzidine solution (Beijing Solarbio Science &
analysis. PASMCs were seeded in six‐well plates and cultured till they
Technology Co., Ltd., Beijing, China) was used for visualization.
reached 80–90% confluence. Then, the cell culture was incubated in
serum‐free media for 24 hr. Artificial wounds were made by
2.5 | ROS detection
scratching the monolayer of PASMCs with a 10‐μl pipette tip, and
then the medium was replaced with DMEM containing different
To detect the cellular ROS, the cells were treated with dihydroethi-
concentrations of 2‐Me (0, 2, and 10 μM). The cells were maintained
dium (DHE) (Sigma‐Aldrich) at a final concentration of 10 μM for
in a CIH chamber or normal chamber for 24 hr. Each experiment was
30 min at 37°C and washed with phosphate buffer solution (PBS)
conducted in triplicate.
three times. Cells were detected by quantitation of fluorescence
intensity under a fluorescence microscope.
In rat lung sections, DHE was used at a final concentration of
To detect cell apoptosis, PASMCs were stained with annexin V‐PE
and 7‐ADD (PE Annexin V Apoptosis Detection Kit I, BD Biosciences,
UC), according to the manufacturer’s instructions for flow cytometry.
50 μM on tissues embedded in OCT and were cut into 4‐μm‐thin
sections. Sections were incubated for 7 min at 37°C in the dark and
washed twice by PBS. Slides were covered and immediately mounted
using the fluoroshield mounting medium with 4′,6-diamidino-2phenylindole (DAPI) (No. ab104139).
2.9 | MiRNAs tansfection and reverse quantitative
transcription-PCR
MiR‐223‐5p mimic, inhibitor, and control miR were supplied by
Genomeditech (Shanghai, China). The sequence of miR‐223‐5P mimic
2.6 | PASMC isolation and culture
is 5′‐CGUGUAUUUGACAAGCCUGAGUUG‐3′; the sequence of
miR‐223‐5P inhibitor is 5′‐CAACUCAGCUUGUCAAAUACACG‐3′.
Briefly, PASMCs were obtained and enzymatically dissociated from
The sequence of control miR is 5′‐UCUACUCUUUCUAGGAGGUUG
the PA of 100–200 g rats and grown under standard culture
UGA‐3′. PASMCs were seeded in 96‐well or 6‐well plates for 24 hr
conditions using high‐glucose Dulbecco’s modified Eagle medium
before transfection. Control miR, mimic, and inhibitor were trans-
(DMEM) with 10% fetal bovine serum (Sigma‐Aldrich). They were
fected by Lipofectamine 2000 (Invitrogen, UK), according to the
grown in an incubator at 5% CO2 and passaged between 70% and
manufacturer’s protocol.
4
|
HAO
ET AL.
F I G U R E 1 Effect of 2‐Me on
CIH‐induced PH. Rats were exposed to N or
CIH conditions for 6 weeks with or without
2‐Me injection. RVSP (a), RV/(LV+S)
(b), and the values of RVCSA (c) were
then measured, and the respective
photomicrographs were presented (d). The
blood flow velocity of PA was measured by
echocardiography (e). The respective view
of PA in color Doppler mode, used to assess
flow through the PA, was presented (f).
Data are presented as mean ± standard
error of the mean. *p < 0.05, **p < 0.01,
and ***p < 0.001 compared with the N
group. 2‐Me: 2‐methoxyestrodiol; CIH:
chronic intermittent hypoxia; N: normoxic;
PA: pulmonary artery; PH: pulmonary
hypertension; RV/(LV+S): right ventricle
hypertrophy index; RVCSA: right ventricle
cross‐sectional area; RVSP: right ventricular
systolic pressures [Color figure can be
viewed at wileyonlinelibrary.com]
Total RNA was extracted using Trizol Reagent (Invitrogen). For
transferred to polyvinylidene fluoride (PVDF) membranes, which were
miR‐223 quantification, complementary DNA (cDNA) was synthe-
then incubated overnight at 4°C with the primary antibody diluted in
sized using One Step Prime script miRNA cDNA Synthesis Kit
blocking solution. The primary antibodies and the dilutions were as
(Shenggong, China). The following specific primers for reverse
follows: HIF‐1α (1:800; No. ab8366; Abcam), NADPH oxidase complex1
transcription and quantitative levels were used: miR‐223‐5p forward
(Nox1; 1:1,000; No. ab131088), Nox4 (1:1,000; No. ab154244; Abcam),
primer, 5′‐GCGTGTATTTGACAAGCTGAGTTG‐3′; U6 forward pri-
α‐SMA (1:1,000; No. ab124964; Abcam), total‐AKT (T‐AKT) (1:1,000; No.
mer
AP0059; Bioworld), phosphorylated‐AKT (P‐AKT; phosphor‐S473)
5′‐GCTTCGGCAGCACATATACTAAAAT‐3′;
General
down-
stream primers, 5′‐CGCTTCACGAATTTGCGTGTCAT‐3′.
(1:1,000; No. BS4006; Bioworld), GADPH (1:2,000; No. ab9385; Abcam),
Quantitative reverse transcription‐PCR was conducted using the TB
PARP‐1 (1:1,000; No. ab227244; Abcam), IGF‐1R (1:1,000; No. ab39675;
GreenTM Premix Ex TaqTM (Takara Bio, Tokyo, Japan) on the Bio‐Rad
Abcam). P‐IGF‐1R (Tyr1316) (1:1,000; CST, No. 28897S). The blots were
TM
). The small nuclear RNA U6
then incubated with horseradish peroxidase‐conjugated anti‐rabbit or
was selected as an endogenous reference for normalization. The fold
anti‐mouse secondary antibody after washing three times with Tris
changes of genes were calculated by the 2− ▵▵ Ct method. Each
buffered saline tween (TBST). Band intensity was visualized by using the
experiment was performed in triplicate and repeated three times.
electrochemiluminescence (ECL) detection system (Thermo Fisher
CFX Manager 3.1 (Bio‐Rad CFX Connect
Scientific, Waltham, MA) and quantified by Image J gel analysis software.
2.10 | Western blot analysis for the target protein
2.11 | Statistical analysis
Proteins were extracted from rat lungs and PASMCs, and the
Results are shown as mean ± standard error of the mean from at least
concentration was determined by a bicinchoninic acid disodium (BCA)
three experiments, and statistical significance was calculated with the
protein assay kit. Proteins were separated with sodium dodecyl sulfate
Student’s t test (*<0.05, **<0.01, and ***<0.001 vs. controls) using
polyacrylamide gel electrophoresis (SDS-PAGE) on 8% or 10% gels and
GraphPad Prism 6 software.
HAO
|
ET AL.
3 | RES U LTS
5
21.2 ± 1.1 to 36.7 ± 0.5 mmHg (all p < 0.05, n = 6), indicating the
successful establishment of the PH model rats. Treatment with 2‐Me
3.1 | 2‐Me suppressed CIH‐induced PH in rats
First, we investigated the preventive effects of 2‐Me on CIH‐induced
PH in rats. After being exposed to CIH for 6 weeks, the Sprague–
Dawley rats showed increased RV pressure (RVP) values from
prevented
the
elevated
RVP
values
from
36.7 ± 0.5
to
27.3 ± 1.6 mmHg, but had no such effects on control rats (Figure 1a).
In addition, the thickness of RV wall as evidenced by the RV
hypertrophy index was significantly increased in the rats exposed to
F I G U R E 2 Effects of 2‐Me on pulmonary arteriole morphological changes. H&E (a) and Masson (c) stains of lung sections from the N group,
Con+2‐Me group, CIH group, and CIH+2‐Me group. The respective thickness (b) and Masson density (d) of pulmonary arterioles in the four
groups were measured and presented. Percentage wall thickness of pulmonary arterioles was defined as the area occupied by the vessel wall
divided by the total cross‐sectional area of the arteriole. (e) Western blot analysis of α‐SMA protein in the rat lungs from four groups. Scale bar:
100 μm. Graph bars represent mean ± standard error of the mean of 20 vessels from 6 rats per group. *p < 0.05, **p < 0.01, and ***p < 0.001
compared with the N group. 2‐Me: 2‐methoxyestrodiol; CIH: chronic intermittent hypoxia; H&E: hematoxylin and eosin; N: normoxic [Color
figure can be viewed at wileyonlinelibrary.com]
6
|
CIH (from 0.23 ± 0.02 to 0.33 ± 0.01), and treatment with 2‐Me
HAO
ET AL.
expression of α‐SMA, a positive marker of smooth muscle cells, was
attenuated the increase (from 0.33 ± 0.01 to 0.19 ± 0.02; Figure 1b).
decreased after 2‐Me inoculation (Figure 2e). Taken together, 2‐Me
The average cross‐sectional area of the myocardial cells was increased
attenuated CIH‐induced thickened vascular wall, collagen hyperpla-
from 254.6 ± 11.34 to 588.0 ± 39.44 μm2 after 6 weeks of CIH
sia, and smooth muscle progression in the lung.
exposure and was decreased to 283.4 ± 12.39 μm2 by 2‐Me treatment
(Figure 1c,d). Furthermore, the exposure to CIH decreased the blood
flow velocity of PA from 992.5 ± 71.8 to 717.7 ± 55.44 mm/s, whereas
the treatment of 2‐Me reversed the effects of CIH (Figure 1e,f).
3.2 | 2‐Me inhibited CIH‐stimulated proliferation
of PASMCs in vitro
It is well known that remodeling of pulmonary blood vessels
We then investigated the effect of 2‐Me on PASMCs in vitro. PASMCs
remains to be the main character of PH. Therefore, morphometric
were treated with 2‐Me at various concentrations of 0, 0.1, 1, 2, 10, 50,
analyses of lung tissues were performed by H&E staining to detect
and 100 µM, and proliferation of PASMCs was tested by the CCK‐8
the impact of CIH on the pulmonary arterioles. Compared with the
assay at different time points (24, 48, and 72 hr). The proliferation of
rats in the control group, CIH increased the degree of vessel
PASMCs, as presented by optical density, was significantly inhibited by
muscularization as measured by the thickness of the vascular wall,
2‐Me, and this inhibitory effect on PASMCs proliferation was enhanced
whereas the application of 2‐Me inhibited the CIH‐induced morpho-
with increasing 2‐Me concentrations (Figure 3a). As illustrated in Figure
metric changes in the pulmonary arterioles (Figure 2a,b). The
3c,d, the number of PASMCs in the plates was significantly decreased in
hyperplasic state of collagen was observed by Masson collagen stain.
a dose‐dependent manner. Afterward, we determined cell apoptosis by
Collagen volume fraction was greater in the CIH group, but this
annexin V/7‐ADD flow cytometry. As illustrated in Figure 3e,f, the
change was inhibited by 2‐Me treatment (Figure 2c,d). Otherwise, the
percentage of apoptotic and dead cells (annexin V positive) was greater
F I G U R E 3 The effects of 2‐Me on PASMCs proliferation and apoptosis. (a) Proliferation of PASMCs was detected by the CCK‐8 assay after
incubation with different concentrations of 2‐Me (0.1, 1, 2, 10, 50, and 100 μM) at 24, 48, and 72 hr. (b) Western blots identified Akt and PI3K
protein expression changed after incubation with 0, 2 and, 10 μM 2‐Me for 48 hr. (c) Proliferation of PASMCs in the presence of 0, 0.1, 2, and
10 μM was examined by counting cell numbers at 48 hr. (d) Annexin V/7‐ADD staining of PASMCs incubated with 0, 0.1, 2, and 10 μM for
48 hr, and the number of annexin V positive PASMCs was shown by flow cytometry analysis. Data are presented three independent
experiments as mean ± standard error of the mean. *p < 0.05, **p < 0.01, and ***p < 0.001 compared with the N group. 2‐Me:
2‐methoxyestrodiol; CCK‐8: cell counting kit‐8; PASMCs: pulmonary artery smooth muscle cells
HAO
|
ET AL.
7
with a higher concentration of 2‐Me. It has been reported that
investigate whether the antiproliferative effect of 2‐Me was
PI3K/AKT pathway is linked to cell survival, transcription factor
attributed to its ability of decreasing oxidative stress. The effect of
activation, and multiple signaling pathways (Arrighi et al., 2013, Chang
in vivo treatment of CIH and 2‐Me on the oxidative stress levels was
et al., 2017, Dugourd, Gervais, Corvol, & Monnot, 2003). Therefore,
determined in the lungs of N, N+2‐Me, CIH, and CIH+2‐Me rats. The
there might be a relationship between the antiproliferative processes of
results indicated that the level of ROS (Figure 5a) and the activity of
2‐Me and PI3K/AKT survival effect on PASMCs. So, the PI3K/AKT
Nox1 and Nox4 (Figure 5c) were significantly augmented by CIH and
pathway was evaluated, and western blot analysis results showed that
decreased by 2‐Me treatment as compared with N groups (Figure 5).
2‐Me notably decreased T‐AKT, P‐AKT, and PI3K protein levels in
In addition, the ROS levels were also detected in PASMCs under N
PASMCs (Figure 3b).
and CIH conditions with or without 2‐Me treatment. As shown in
To mimic CIH‐induced proliferation of PASMCs in vitro, primary
Figure 5b, ROS and HIF‐1α in PASMCs were also increased when
cultured PASMCs were incubated for 24, 48, and 72 hr at 37°C in a
exposed to CIH and decreased when treated with 2‐Me. The effect of
chamber, wherein the oxygen‐concentration loop was 1% for 15 min
2‐Me treatment on the expression of HIF‐1α was also examined in
and 21% for 15 min and the N air was used for controls. The results
the lungs by immunohistochemical analysis, and the results are
of the CCK‐8 assay demonstrated that the proliferation of PASMCs
illustrated in Figure 5c,d.
was elevated under CIH conditions compared with the cells under N
conditions (Figure 4a). Furthermore, 2‐Me notably inhibited cell
further demonstrated the inhibitory effect of 2‐Me on the migration
3.4 | miR‐223 was decreased by CIH and reversed
by 2‐Me
of PASMCs under CIH conditions (Figure 4b,c).
Real‐time PCR was performed to determine the alterations of
proliferation in a dose‐dependent manner. The scratch wound assay
miR‐223 expression during the development of CIH‐induced PH.
3.3 | 2‐Me treatment attenuated CIH‐induced
oxidative stress in vivo and in vitro
As shown in Figure 6a, the expression of miR‐223 in rat lungs was
decreased in response to CIH, whereas treatment with 2‐Me
reversed the change. On the basis of the previous reports
Oxidative stress contributes to the hyperproliferation of VSMCs, and
(Meloche et al., 2015, Streppel et al., 2013) and the online tool
2‐Me treatment attenuates the change. Therefore, it is of interest to
(TargetSan, www.targetscan.org), we found that PARP‐1 and
F I G U R E 4 The effect of 2‐Me on PASMCs proliferation and migration under CIH condition. (a) The proliferation of PASMCs, supplemented
with 2‐Me (0, 0.1, 2, and 10 μM) under N and CIH conditions cultured for 24, 48, and 72 hr, was determined by the CCK‐8 assay. (b) Migration of
PASMCs supplemented with 0, 2 and 10 μM 2‐Me under N and CIH conditions was compared by the scratch wound‐healing assay. Photographs
were taken 24 hr after the wound was made. Data represent three independent experiments. *p < 0.05, **p < 0.01, and ***p < 0.001;
mean ± standard error of the mean. 2‐Me: 2‐methoxyestrodiol; CCK‐8: cell counting kit‐8; CIH: chronic intermittent hypoxia; N: normoxic;
PASMCs: pulmonary artery smooth muscle cells
8
|
HAO
ET AL.
F I G U R E 5 2‐Me on oxidative stress of PASMCs induced by CIH. (a) Immunohistochemistry analysis of ROS expression in rat lungs from
the N group, N+2‐Me group, CIH group, and CIH+2‐Me group. Density of red fluorescence indicates ROS level. (b) Immunohistochemistry
analysis of ROS expression in PASMCs treatment with 0, 2, and 10 μM under N or CIH condition for 24 hr. (c) Western blots
identified expression of HIF‐1α, PI3K, AKT, Nox4, and Nox1 in rat lungs from four groups. (d) The expression of HIF‐1α (arrows) in
PASMCs was also detected by immunohistochemistry analysis. Data represented as mean ± standard error of the mean. *p < 0.05,
**p < 0.01, and ***p < 0.001 compared with the N group. 2‐Me: 2‐methoxyestrodiol; CCK‐8: cell counting kit‐8; CIH: chronic
intermittent hypoxia; HIF‐1α: hypoxia‐inducible factor‐1α; N: normoxic; Nox: NADPH oxidase complex; PASMCs: pulmonary artery
smooth muscle cells; ROS: reactive oxygen species [Color figure can be viewed at wileyonlinelibrary.com]
IGF‐1R as two potential target proteins of miR‐223. A negative
correlation was detected between the expression of miR‐223 and
PARP‐1 or IGF‐1R in rat lungs and PASMCs exposed to CIH
(Figure 6).
3.5 | miR‐223 was involved in the antiproliferation
of 2‐Me on PASMCs
Previous studies have reported that CIH exposure led to PH by
enhancing the proliferation of PASMCs in vitro and in vivo, and the
HAO
|
ET AL.
9
F I G U R E 6 The effects of 2‐Me on miR‐223 expression. (a) The relative expression of miR‐223 in rat lungs from four groups. Total miRNAs
were extracted from rat lungs, and then the level of miR‐223 was measured by the real‐time PCR. (b) Expression of HIF‐1α, PARP‐1, and IGF‐1R
in rat lungs was measured by western blots. (c) Levels of miR‐223 expression in PASMCs cultured under N or CIH condition with or without
2‐Me treatment. (d) Expressions of HIF‐1α, PARP‐1, and IGF‐1R in PASMCs from four groups were detected by western blots. Data represent
three independent experiments. *p < 0.05, **p < 0.01, and ***p < 0.001; mean ± standard error of the mean. 2‐Me: 2‐methoxyestrodiol;
CIH: chronic intermittent hypoxia; HIF‐1α: hypoxia‐inducible factor‐1α; miR‐223: microRNA‐223; N: normoxic; PARP‐1: poly (ADP‐ribose)
polymerase‐1; PASMCs: pulmonary artery smooth muscle cells; PCR: polymerase chain reaction
expression of miR‐223 was decreased in the lung tissues and
the proliferation of PASMCs significantly, and miR‐223 mimic or
PASMCs under CIH conditions; 2‐Me presented the antiprolifera-
2‐Me suppressed the progression of PASMCs (Figure 7a).
tion of PASMCs, and upregulated miR‐223 expression. Several
Expression of IGF‐1R and PARP‐1, the two target proteins of
studies have demonstrated the role of miR‐223 in PH. Therefore,
miR‐223, were detected by western blot. The results showed that
we hypothesized that 2‐Me prevented the proliferation of
the expression of IGF‐1R and PARP‐1 was decreased in PASMCs
PASMCs was by upregulating miR‐223. To test this hypothesis,
treated with miR‐223 mimic and further decreased with miR‐223
we investigated the effect of miR‐223 on CIH‐induced PASMCs
mimic and 2‐Me treatment and enhanced by miR‐223 inhibitor
proliferation. Under CIH condition, miR‐223 inhibitor promoted
treatment (Figure 7b).
10
|
HAO
ET AL.
marked increase in ROS generation was observed in the pulmonary
arterioles of the CIH group. The altered levels of Nox1, Nox4, and
HIF‐1α were correlated with oxidative stress and functional changes
occurring in lung tissues. Furthermore, the expression of miR‐223 and
its target proteins were changed in the lung tissues of CIH rats,
whereas 2‐Me supplementation markedly minimized these effects in
CIH rats. In addition, through modulating the proliferation and
oxidative‐stress‐related proteins, 2‐Me significantly suppressed the
proliferation and ROS generation of PASMCs in an in vitro model of
CIH, accompanied with alteration of miR‐223 and its target protein.
Previous studies have reported that several different mechanisms
might be involved in CIH‐induced PH. ROS are thought to play a role
in vascular remodeling during chronic alveolar hypoxia (Zhan et al.,
2005). Studies on rodents exposed to CIH showed that the ROS
generation was increased in the target tissues and pretreatment with
an antioxidant prevented not only the elevation of ROS but also the
cardiovascular abnormalities evoked by CIH (Prabhakar, Kumar,
Nanduri, & Semenza, 2007). Nox is a major source of superoxide
generation. Previous studies have reported that CIH‐induced
oxidative injury in the brain was associated with an increase in Nox
gene as well as protein expression, and the injury was abolished by
systemic administration of apocyanin, an inhibitor of Nox (Zhan et al.,
2005). More important, Nox4 contributed to the development of PH
caused by CIH, and vice versa when Nox4 was inhibited (Nisbet et al.,
2009). These studies suggested that CIH led to the oxidative injury in
target organs via ROS generated by Nox. HIF‐1α is a functional
subunit that regulates gene expression of hypoxic related enzymes,
including Nox (Diebold, Petry, Hess, & Gorlach, 2010). The roles of
HIF‐1α in regulating angiogenesis are complex. According to the
previous reports, downregulation of HIF‐1α suppressed the proliferation of smooth muscle cells (Jaitovich & Jourd’heuil, 2017).
F I G U R E 7 The effects of miR‐223 on the proliferation of
PASMCs. PASMCs were transfected with control miR, mimic or
inhibitor of miRNA‐223 for 24 hr. The cells were then cultured with
or without 2‐Me for 48 hr under N or CIH condition. (a) The CCK‐8
assay was performed to measure cell proliferation. (b) Protein levels
of IGF‐1R and PARP‐1 were detected using western blot analysis.
The ratio of target proteins/GADPH was quantified by measuring
band intensity using Image J software. Data represent three
independent experiments. *p < 0.05, **p < 0.01, and ***p < 0.001;
mean ± standard error of the mean. CCK‐8: cell counting kit‐8;
CIH: chronic intermittent hypoxia; miR‐223: microRNA‐223;
N: normoxic; PARP‐1: poly (ADP‐ribose) polymerase‐1; PASMCs:
pulmonary artery smooth muscle cells
Previous studies found that 2‐Me suppresses HIF‐1α protein levels
and its transcriptional activity (Becker et al, 2008). 2‐Me acts as a
potent antioxidant that inhibits free‐radical‐induced proliferation and
migration of VSMCs (Dubey et al., 1999, Seeger, Mueck, & Lippert,
1997, Wang, Zheng, Yuan, Li, & Gong, 2017). Our study indicated
that 2‐Me attenuated CIH‐induced PH by decreasing ROS generation
through the HIF‐1α/Nox‐related pathway.
MiRNAs are small noncoding RNA molecules that negatively
regulate gene expression, potentially regulating cellular signaling
pathways. During the past decade, miRNA has been studied as a
potential target for cardiovascular diseases (Mellis & Caporali, 2018).
Dysregulated expression of miRNA is involved in vascular cell
remodeling processes, including PASMCs proliferation and resistance
4 | D IS C U S S IO N
to apoptosis (Javaheri et al. 2017). Studies have confirmed that 2‐Me
in the regulation of various pathological processes through DNA
To date, accumulating evidence have reported the protective role of
synthesis inhibition, actions on microtubules, and inducing apoptosis
2‐Me in a wide spectrum of cardiovascular diseases. In our study, this
in actively proliferating the cells (Zou et al., 2018). The mechanism
conception has been extended to CIH model, suggesting that the
behind proliferation inhibition of VSMCs by 2‐Me may be explained
deleterious effects of CIH on PAs was abolished by 2‐Me. CIH
by decreasing the compounds or regulators that stimulate prolifera-
exposure significantly elevated PH and RV masses, as well as
tion, such as HIF‐1, phosphorylated‐ERK1/2 (MAPK), and AKT
structural remodeling of pulmonary arterioles, including the increased
(Barchiesi et al., 2006). Our study found that miR‐223 was
thickness and fibrosis of pulmonary arterioles in rats. Of note, a
profoundly downregulated after CIH exposure both in vivo and in
HAO
|
ET AL.
vitro. Interestingly, 2‐Me treatment demonstrated a significant effect
on the decreased levels of miR‐223. These findings indicated that the
regulation of miR‐223 probably accounted for the antiangiogenic
effects of 2‐Me on CIH.
However, limitations should be mentioned in this study. First of
all, the interaction between PASMCs and endothelial cells under CIH
conditions is essential to be explored. Second, the involvement of
2‐Me in the regulation of miR‐223 should be further explored. To
validate our hypothesis, we need further research using mimic or
inhibitor of miR‐223 in animals.
Our study for the first time demonstrated the role of 2‐Me in
attenuating CIH‐induced PH and explored the links between 2‐Me
and miR‐223. Taken together, our findings suggest that miR‐223
associated signaling pathway may be regulated in the lung
vasculature under CIH conditions and the antiangiogenic effect of
2‐Me likely caused because of the upregulating miR‐223. Defining
the regulatory molecules that are involved in the antiangiogenic
effects of 2‐Me may lead to the development of novel therapeutic
strategies that target the progression of CIH‐induced PH.
A C K N O W L E D GM E N T S
The authors thank Jie Liu at Fudan University for assisting in editing and
Ping Yuan at Shanghai Pulmonary Hospital affiliated to Tongji University
for assisting in designing experiments. This work was supported by grants
from the National Natural Science Foundation of China (No. 81770083,
81500058, 81400043, 81570081), the National Key Research and
Development Program of China (No. 2018YFC1313600).
CO NFLICTS OF INTE RES T
The authors declare that they have no conflicts of interest.
OR CID
Shengyu Hao
http://orcid.org/0000-0003-3162-5460
REFERENC ES
Alchanatis, M., Tourkohoriti, G., Kakouros, S., Kosmas, E., Podaras, S., &
Jordanoglou, J. B. (2001). Daytime pulmonary hypertension in
patients with obstructive sleep apnea: The effect of continuous
positive airway pressure on pulmonary hemodynamics. Respiration, 68,
566–572.
Almendros, I., Wang, Y., Becker, L., Lennon, F. E., Zheng, J., Coats, B. R., …
Gozal, D. (2014). Intermittent hypoxia‐induced changes in tumor‐
associated macrophages and tumor malignancy in a mouse model of
sleep apnea. American Journal of Respiratory and Critical Care Medicine,
189, 593–601.
Arrighi, N., Bodei, S., Zani, D., Michel, M. C., Simeone, C., Cosciani Cunico, S.,
… Sigala, S. (2013). Different muscarinic receptor subtypes modulate
proliferation of primary human detrusor smooth muscle cells via Akt/
PI3K and map kinases. Pharmacological Research, 74, 1–6.
Ayas, N. T., Drager, L. F., Morrell, M. J., & Polotsky, V. Y. (2017). Update in
sleep‐disordered breathing 2016. American Journal of Respiratory and
Critical Care Medicine, 195, 1561–1566.
11
Barchiesi, F., Jackson, E. K., Fingerle, J., Gillespie, D. G., Odermatt, B., &
Dubey, R. K. (2006). 2‐Methoxyestradiol, an estradiol metabolite,
inhibits neointima formation and smooth muscle cell growth via
double blockade of the cell cycle. Circulation Research, 99, 266–274.
Becker, C. M., Rohwer, N., Funakoshi, T., Cramer, T., Bernhardt, W.,
Birsner, A., … D’Amato, R. J. (2008). 2-methoxyestradiol inhibits
hypoxia-inducible factor-1{alpha} and suppresses growth of lesions in
a mouse model of endometriosis. American journal of pathology, 172(2),
534–544. https://doi.org/10.2353/ajpath.2008.061244
Chang, Y., Li, J. Y., Jayakumar, T., Hung, S. H., Lee, W. C., Manubolu, M., …
Hsu, M. J. (2017). Ketamine, a clinically used anesthetic, inhibits
vascular smooth muscle cell proliferation via PP2A‐activated PI3K/
Akt/ERK inhibition. International Journal of Molecular Sciences,
18, 2545.
Dai, G. H., Ma, P. Z., Song, X. B., Liu, N., Zhang, T., & Wu, B. (2014).
MicroRNA‐223‐3p inhibits the angiogenesis of ischemic cardiac
microvascular endothelial cells via affecting RPS6KB1/hif‐1a signal
pathway. PLoS One, 9, 108468.
Diebold, I., Petry, A., Hess, J., & Görlach, A. (2010). The NADPH oxidase
subunit NOX4 is a new target gene of the hypoxia‐inducible factor‐1.
Molecular Biology of the Cell, 21, 2087–2096.
Dubey, R. K., Tyurina, Y. Y., Tyurin, V. A., Gillespie, D. G., Branch, R. A.,
Jackson, E. K., & Kagan, V. E. (1999). Estrogen and tamoxifen
metabolites protect smooth muscle cell membrane phospholipids
against peroxidation and inhibit cell growth. Circulation Research,
84, 229–239.
Dugourd, C., Gervais, M., Corvol, P., & Monnot, C. (2003). Akt is a major
downstream target of PI3‐kinase involved in angiotensin II‐induced
proliferation. Hypertension, 41, 882–890.
Frump, A. L., Albrecht, M. E., McClintick, J. N., & Lahm, T. (2017). Estrogen
receptor‐dependent attenuation of hypoxia‐induced changes in the
lung genome of pulmonary hypertension rats. Pulmonary Circulation,
7, 232–243.
Fu, C., Jiang, L., Zhu, F., Liu, Z., Li, W., Jiang, H., … Li, S. (2015). Chronic
intermittent hypoxia leads to insulin resistance and impaired glucose
tolerance through dysregulation of adipokines in non‐obese rats. Sleep
and Breathing, 19, 1467–1473.
Grady, D., Rubin, S. M., Petitti, D. B., Fox, C. S., Black, D., Ettinger, B., …
Cummings, S. R. (1992). Hormone therapy to prevent disease and
prolong life in postmenopausal women. Annals of Internal Medicine,
117, 1016–1037.
Jaitovich, A., & Jourd’heuil, D. (2017). A brief overview of nitric oxide and
reactive oxygen species signaling in hypoxia‐induced pulmonary
hypertension. Advances in Experimental Medicine and Biology,
967, 71–81.
Javaheri, S., Barbe, F., Campos‐Rodriguez, F., Dempsey, J. A., Khayat, R.,
Javaheri, S., … Somers, V. K. (2017). Sleep apnea: Types, mechanisms,
and clinical cardiovascular consequences. Journal of the American
College of Cardiology, 69, 841–858.
Mabjeesh, N. J., Escuin, D., LaVallee, T. M., Pribluda, V. S., Swartz, G. M.,
Johnson, M. S., … Giannakakou, P. (2003). 2ME2 inhibits tumor growth
and angiogenesis by disrupting microtubules and dysregulating HIF.
Cancer Cell, 3, 363–375.
Mellis, D., & Caporali, A. (2018). MicroRNA‐based therapeutics in
cardiovascular disease: Screening and delivery to the target.
Biochemical Society Transactions, 46, 11–21.
Meloche, J., Le Guen, M., Potus, F., Vinck, J., Ranchoux, B., Johnson, I., …
Bonnet, S. (2015). miR‐223 reverses experimental pulmonary arterial
hypertension. American Journal of Physiology: Cell Physiology, 309,
C363–C372.
Nisbet, R. E., Graves, A. S., Kleinhenz, D. J., Rupnow, H. L., Reed, A. L., Fan,
T. ‐H. M., … Hart, C. M. (2009). The role of NADPH oxidase in chronic
intermittent hypoxia‐induced pulmonary hypertension in mice. American Journal of Respiratory Cell and Molecular Biology, 40, 601–609.
12
|
Perez‐Cremades, D., Mompeon, A., Vidal‐Gomez, X. , Hermenegildo, C.,
& Novella, S. (2018). miRNA as a new regulatory mechanism of
estrogen vascular action. International Journal of Molecular Sciences,
19, 473.
Piperigkou, Z., Franchi, M., Götte, M., & Karamanos, N. K. (2017). Estrogen
receptor beta as epigenetic mediator of miR‐10b and miR‐145 in
mammary cancer. Matrix Biology, 64, 94–111.
Prabhakar, N. R., Kumar, G. K., Nanduri, J., & Semenza, G. L. (2007). ROS
signaling in systemic and cellular responses to chronic intermittent
hypoxia. Antioxidants & Redox Signaling, 9, 1397–1403.
Sajkov, D., Cowie, R. J., Thornton, A. T., Espinoza, H. A., & McEvoy, R. D.
(1994). Pulmonary hypertension and hypoxemia in obstructive sleep
apnea syndrome. American Journal of Respiratory and Critical Care
Medicine, 149, 416–422.
Seeger, H., Mueck, A. O., & Lippert, T. H. (1997). Effect of estradiol
metabolites on the susceptibility of low density lipoprotein to
oxidation. Life Sciences, 61, 865–868.
Shi, L., Kojonazarov, B., Elgheznawy, A., Popp, R., Dahal, B. K., Böhm, M., …
Fleming, I. (2016). miR‐223‐IGF‐IR signalling in hypoxia‐ and load‐
induced right‐ventricular failure: A novel therapeutic approach.
Cardiovascular Research, 111, 184–193.
Streppel, M. M., Pai, S., Campbell, N. R., Hu, C., Yabuuchi, S., Canto, M. I., …
Maitra, A. (2013). MicroRNA 223 is up‐regulated in the multistep
progression of Barrett’s esophagus and modulates sensitivity to
chemotherapy by targeting PARP1. Clinical Cancer Research, 19,
4067–4078.
Taïbi, F., Metzinger‐Le Meuth, V., Massy, Z. A., & Metzinger, L. (2014).
miR‐223: An inflammatory oncomiR enters the cardiovascular field.
Biochimica et Biophysica Acta/General Subjects, 1842, 1001–1009.
Tofovic, S. P. (2010). Estrogens and development of pulmonary
hypertension: Interaction of estradiol metabolism and pulmonary
vascular disease. Journal of Cardiovascular Pharmacology, 56, 696–708.
Tofovic, S. P., Jones, T. J., Bilan, V. P., Jackson, E. K., & Petrusevska, G.
(2010). Synergistic therapeutic effects of 2‐methoxyestradiol with
either sildenafil or bosentan on amelioration of monocrotaline‐
induced pulmonary hypertension and vascular remodeling. Journal of
Cardiovascular Pharmacology, 56, 475–483.
HAO
ET AL.
Trzepizur, W., & Gagnadoux, F. (2014). [Epidemiology of obstructive sleep
apnoea syndrome]. Revue des Maladies Respiratoires, 31, 568–577.
Wang, L., Zheng, Q., Yuan, Y., Li, Y., & Gong, X. (2017). Effects of
17β‐estradiol and 2‐methoxyestradiol on the oxidative stress‐hypoxia
inducible factor‐1 pathway in hypoxic pulmonary hypertensive rats.
Experimental and Therapeutic Medicine, 13, 2537–2543.
Wong, H. S., Williams, A. J., & Mok, Y. (2017). The relationship between
pulmonary hypertension and obstructive sleep apnea. Current Opinion
in Pulmonary Medicine, 23, 517–521.
Wu, X., Gu, W., Lu, H., Liu, C., Yu, B., Xu, H., … Shao, C. (2016). Soluble
receptor for advanced glycation end product ameliorates chronic
intermittent hypoxia induced renal injury, inflammation, and apoptosis via P38/JNK signaling pathways. Oxidative Medicine and Cellular
Longevity, 2016, 1015390.
Yu, J., Zhou, Z., McEvoy, R. D., Anderson, C. S., Rodgers, A., Perkovic, V., &
Neal, B. (2017). Association of positive airway pressure with
cardiovascular events and death in adults with sleep apnea: A
systematic review and meta‐analysis. Journal of the American Medical
Association, 318, 156–166.
Zhan, G., Serrano, F., Fenik, P., Hsu, R., Kong, L., Pratico, D., … Veasey, S. C.
(2005). NADPH oxidase mediates hypersomnolence and brain
oxidative injury in a murine model of sleep apnea. American Journal
of Respiratory and Critical Care Medicine, 172, 921–929.
Zou, X., Zhang, L., Yuan, J., Yang, C., Wu, Z., Song, J., … Chen, L. (2018).
Endogenous hormone 2‐methoxyestradiol suppresses venous hypertension‐induced angiogenesis through up‐ and down‐regulating p53
and id‐1. Journal of Cellular and Molecular Medicine, 22, 957–967.
How to cite this article: Hao S, Jiang L, Fu C, et al.
2‐Methoxyestradiol attenuates chronic‐intermittent‐hypoxia‐
induced pulmonary hypertension through regulating
microRNA-223. J Cell Physiol. 2018;1–12.
https://doi.org/10.1002/jcp.27363