MICROBIAL DRUG RESISTANCE
Volume 00, Number 00, 2020
ª Mary Ann Liebert, Inc.
DOI: 10.1089/mdr.2020.0188
Colistin Resistance in Environmental Isolates
of Acinetobacter baumannii
Downloaded by SUNY Stony Brook package(NERL) from www.liebertpub.com at 08/10/20. For personal use only.
Branko Jovcic,1,2,* Katarina Novovic,2 Svjetlana Dekic,3 and Jasna Hrenovic3,*
Although the molecular mechanisms of carbapenem resistance of environmental isolates of Acinetobacter
baumannii are well described, data on the mechanisms of colistin resistance are scarce. In this study, we report
the molecular mechanisms of colistin resistance in environmental isolates of A. baumannii. Seven clinically
relevant isolates of A. baumannii belonging to ST-2Pasteur were recovered from hospital wastewater and
wastewater treatment plant. The phenotypic resistance to colistin was confirmed by broth microdilution with
minimum inhibitory concentration values ranging from 20 to 160 mg/L. Colistin sulfate and colistimethate
sodium showed bactericidal activity against two colistin-heteroresistant isolates in vitro, but substantially
recovery of population was observed after prolonged incubation. In silico genome analysis revealed nucleotide
variations resulting in amino acid changes in LpxC (N286D), LpxD (E117K), PmrB (A138T, R263S, L267W,
Q309P, and A444V), and EptA (F166L, I228V, R348K, A370S, and K531T). According to reverse transcription
quantitative PCR, all isolates had increased levels of eptA mRNA and decreased levels of lpxA and lpxD
mRNA. Isolates expressed low hydrophobicity, biofilm, and pellicle formation, but showed excellent survival in
river water during 50 days of monitoring. Colistin- and pandrug-resistant A. baumannii disseminated in the
environment could represent the source for the occurrence of serious community-acquired infections.
Keywords: Acinetobacter baumannii, environment, colistin, resistance, wastewater
phoethanolamine transferase, which is strictly regulated by
the two-component system PmrAB. The increased expression of PmrC could be a cause of colistin resistance and is
often due to mutations in genes encoding PmrAB.3,8–11 Recently, the presence of one or more copies of pmrC homologue eptA in A. baumannii genomes and its involvement in
colistin resistance was described in several studies.4,10,12
The second mechanism of colistin resistance in A. baumannii reported so far is the loss of LPS structure on cell
surface due to mutations or disruptions of LPS biosynthesis genes (lpxA, lpxC, and lpxD).6 Unlike the mentioned chromosomally located genes, plasmid-mediated
colistin resistance determinants (mcr genes), described in
Gram-negative pathogens worldwide,13 hitherto have
been reported in single A. baumannii of nosocomial (mcr1)14 and animal origin (mcr-4.3).15
The aim of this study was to elucidate the molecular
mechanism of colistin resistance in isolates of A. baumannii
recovered from hospital wastewater and wastewater treatment plant (WWTP).
Introduction
A
cinetobacter baumannii has been recognized as a
serious nosocomial pathogen that causes a wide range
of infections. Of special importance is the limited choice of
effective antimicrobial agents, since percentage of multidrugresistant (MDR) A. baumannii isolates is constantly increasing. One of the last-line antibiotics used in therapies of MDR
A. baumannii infections is colistin, but resistance to this antibiotic, although not often, has been reported.1–4
Colistin is a positively charged antibiotic at physiological
pH, which acts by electrostatic binding to the negatively
charged lipid A of bacterial lipopolysaccharide (LPS).5
Colistin resistance is either due to the modifications or to a
complete loss of lipid A that reduce or abolish the negative
charge of lipopolysaccharide and thus the electrostatic interaction with colistin.6 In A. baumannii, the most common
mechanism of colistin resistance implies modification of
lipid A through addition of phosphoetanolamine moieties
that is mediated by the pmrCAB operon.7 PmrC is a phos-
1
Faculty of Biology, University of Belgrade, Belgrade, Serbia.
Institute of Molecular Genetics and Genetic Engineering, University of Belgrade, Belgrade, Serbia.
Division of Microbiology, Department of Biology, Faculty of Science, University of Zagreb, Zagreb, Croatia.
*These authors contributed equally to this study.
2
3
1
2
JOVCIC ET AL.
Materials and Methods
Colistin adaptation experiments
of A. baumannii isolates
Downloaded by SUNY Stony Brook package(NERL) from www.liebertpub.com at 08/10/20. For personal use only.
Sampling and isolation of A. baumannii
Hospital wastewaters were collected on two occasions at
the central manhole of the Special Hospital for Pulmonary
Diseases in Zagreb, Croatia. Hospital wastewater is released
into the urban sewage system without pretreatment and
reaches the central WWTP. Samples of activated sludge and
treated effluent wastewater were collected within the longterm monitoring at the Zagreb WWTP. Details of sampling
during 2015–2016 and recovery of A. baumannii isolates
were previously described.16,17 In brief, colonies of A.
baumannii were selected on CHROM agar Acinetobacter
plates supplemented with CR102 (CHROM agar) and
15 mg/L of cefsulodin sodium salt hydrate (Sigma-Aldrich)
after incubation at 42C for 48 h. Seven isolates, identified
by MALDI-TOF MS (Microflex LT mass spectrometer and
MALDI Biotyper 3.0 software; Bruker Daltonics, Germany)
as A. baumannii,16,17 were analyzed in this study (Table 1).
Antimicrobial susceptibility of A. baumannii isolates
The susceptibility to carbapenems (meropenem and imipenem), fluoroquinolones (ciprofloxacin and levofloxacin),
aminoglycosides (tobramycin, gentamicin, and amikacin),
tetracyclines (minocycline), trimethoprim/sulfamethoxazole,
and polymyxin (colistin) was evaluated by the determination
of the minimum inhibitory concentration (MIC) values obtained with the Vitek2 system (BioMérieux, Craponne,
France), using the AST-XN05 and AST-N233 testing cards.
Colistin gradient dilution E-test (BioMérieux) was performed
on Muller–Hinton plates (Biolife) according to the manufacturer’s guidelines to check the heteroresistant phenotype of
isolates, recognized as the presence of microcolonies within
the ellipse of inhibition. Colistin resistance was confirmed by
broth microdilution test (Mikrolatest; Erba Lachema, Brno,
Czech Republic) as suggested by EUCAST.18 Since in Mikrolatest all isolates gave the MIC values of colistin above the
maximum available, 16 mg/L, manual twofold dilution of
freshly prepared colistin sulfate (Sigma-Aldrich) suspension
of 320 mg/L in Muller–Hinton broth (Biolife) was performed.
MICs were interpreted according to the EUCAST18 criteria for all antibiotics with defined breakpoints for clinical
isolates of Acinetobacter spp., whereas for minocycline,
CLSI19 breakpoints were used.
Table 1. Origin and Date of Recovery
of Acinetobacter baumannii Isolates
Isolate
a
S2/2
S2/4a
S2/10
S14b
EF7b
EF31b
EF32b
a
Origin
Date of isolation
Hospital wastewater
Hospital wastewater
Hospital wastewater
WWTP activated sludge
WWTP effluent
WWTP effluent
WWTP effluent
August 27, 2015
August 27, 2015
October 6, 2015
February 24, 2016
September 9, 2015
March 9, 2016
March 9, 2016
Published in Seruga Music et al.16
Published in Higgins et al.17
WWTP, wastewater treatment plant.
b
For two isolates (S2/2 and S2/10) from hospital wastewater
showing heteroresistance to colistin in E-test, time and concentration killing kinetics were examined following the protocol described in Li et al.,20 which was slightly modified. The
colistin in the form of colistin sulfate (Sigma-Aldrich) and
colistimethate sodium (Altamedics) was added to a suspension
of an overnight culture in Mueller–Hinton broth (Biolife) to
yield concentrations of 0–80 mg/L. Polystyrene 10 mL tubes
were incubated with mixing at 150 rpm at 37C for 72 hours.
Number of bacteria was determined after 1, 3, 6, 24, 48, and
72 hours of contact. One milliliter of the suspension was taken
from the tube and inoculated in triplicate onto nutrient agar
plates (Biolife) either original (0.1 mL) or after decimal dilution with sterile saline. Colonies were counted after incubation of plates at 37C for 24 h. The lower limit of detection
was 10 colony forming units (CFU)/mL.
After 48 hours of incubation, 0.1 mL of bacterial suspension grown in tubes containing 80 mg/L of colistin sulfate
was transferred into fresh Mueller–Hinton broth containing
80 mg/L of colistin sulfate. The growth of adapted bacteria
was followed for 24 hours. The number of bacteria was
determined as already described.
Pulsed-field gel electrophoresis analysis
The preparation of samples was performed as previously
described.21 DNA restriction was done with ApaI enzyme
(Thermo Scientific, Lithuania) at 37C for 3 hours. Pulsedfield gel electrophoresis (PFGE) was performed with a 2015
Pulsafor unit (LKB Instruments, Broma, Sweden) equipped
with a hexagonal electrode array for 16 hours at 300 V at
9C. The gels were stained with ethidium bromide (500 ng/mL
of gel) and photographed under UV illumination.
Whole genome sequencing and genome analyses
A. baumannii genomic DNA was sequenced using Illumina
HiSeq by MicrobesNG service (MicrobesNG; IMI-School of
Biosciences, University of Birmingham, Birmingham, United
Kingdom). De Bruijn Graph methods were applied for the
assembling process, contigs <200 bp were eliminated,22 and
raw reads were mapped to assembled scaffolds with Burrows
Wheeler Aligner.23 The Rapid Annotations using Subsystems
Technology (RAST) server (http://rast.nmpdr.org) was used
for gene annotation and prediction of the open reading frames.
The acquired data were analyzed using SEED database.24
Resulting contigs were used to determine resistome (ResFinder 3.1) and multilocus sequence typing (MLST 2.0,
Pasteur scheme), available at Center for Genomic Epidemiology (www.genomicepidemiology.org), using default settings. In addition, the presence of mutations in the pmrAB,
eptA, and lpxACD genes was analyzed using DNA Strider
with corresponding genes of A. baumannii ATCC 19606
(GenBank GCA_002811175.1) and A. baumannii ATCC
17978 (GenBank GCA_001593425.2) that were used as a
negative control.
Draft genome sequences of seven A. baumannii isolates have
been deposited at the NCBI GenBank database under accession numbers JAAQOP000000000–JAAQOV000000000.
COLISTIN RESISTANCE IN ENVIRONMENTAL A. BAUMANNII
Downloaded by SUNY Stony Brook package(NERL) from www.liebertpub.com at 08/10/20. For personal use only.
Transcriptional analysis by reverse transcription
quantitative PCR
The isolates used in this study were incubated in Mueller–
Hinton broth supplemented with 2 mg/mL of colistin sulfate
(Sigma-Aldrich) at 37C with shaking overnight. The overnight cultures were diluted in fresh Mueller–Hinton broth
supplemented with colistin sulfate (final concentration
2 mg/mL) and grown until having reached the OD600 value
of 0.5. The total RNA from A. baumannii cells was isolated using the RNeasy Mini Kit (Qiagen, Germany), with
a modified lysis step.25 DNase I treatment was performed
by an Ambion DNAfree Kit (Thermo Fisher Scientific,
MA). Reverse transcription was done with a RevertAid
RT Reverse Transcription Kit (Thermo Fisher Scientific)
according to the manufacturer’s protocol. Reverse transcription quantitative PCR (RT-qPCR) was used for determination of listed genes transcription level: lpxA, lpxC,
lpxD, pmrA, pmrB, and eptA. Primers used in RT-qPCR
are listed in Table 2. RT-qPCR was performed with a
KAPA SYBR Fast qPCR Kit (KAPA Biosystems, MA) in
a 7500 Real Time PCR System thermocycler (Applied
Biosystems, Thermo Fischer Scientific, MA). Normalization was done against the rpoB gene using the DDCT
method (relative).28 The obtained values were then normalized against results for colistin-sensitive A. baumannii
isolate 6077/12.29 RT-qPCR experiments were done in
triplicate.
All results are represented as mean values – standard
deviations. Student’s t test was used to compare differences in results obtained for colistin-resistant A. baumannii
isolates and colistin-sensitive A. baumannii isolate 6077/12.
Values at p < 0.05 were considered to be statistically
significant.
Virulence factors of A. baumannii isolates
Of the virulence factors of A. baumannii isolates, the
hydrophobicity and biofilm formation at the solid–liquid and
air–liquid interfaces were determined. Hydrophobicity of
bacteria was measured via the bacterial adhesion to hydrocarbon assay, described by Rosenberg et al.30 The ability to
form biofilm at the solid–liquid interface was tested by using
the crystal violet assay.31 Pellicle formation at the air–liquid
3
interface was evaluated according to the protocol described
in Nait Chabane et al.32 All tests were performed in technical triplicate.
Survival of A. baumannii isolates in river water
Survival of A. baumannii in river water was followed for
two selected isolates (S2/2 from hospital wastewater and EF7
from WWTP). Surface water of the Sava River was collected
on October 11, 2015 downstream the discharge point of the
Zagreb WWTP effluent into the natural recipient. Overnight
bacterial cultures were suspended in 100 mL of autoclaved
river water. Bacterial suspensions were incubated at 20C
with 170 rpm for 50 days. After the specified period, Schott
bottles were shaken, subsamples were decimally diluted in
sterile saline solution, inoculated onto nutrient agar plates,
and bacterial colonies were counted after incubation at 37C
for 24 h. Number of viable bacteria was determined as CFUs,
logarithmically transformed, and expressed as log CFUs/mL
of water. Experiments were performed in technical triplicate
with mean values presented.
Results
Antimicrobial susceptibility of A. baumannii isolates
All seven isolates were nonsusceptible to carbapenems, fluoroquinolones, aminoglycosides, trimethoprim/sulfamethoxazole,
and colistin (Table 3). Thus, according to the EUCAST,18
clinical breakpoints isolates could be classified as pandrug
resistant. However, according to the CLSI19 criteria, only two
isolates from WWTP effluent (EF7 and EF31) showed the
nonsusceptibility to minocycline.
Two isolates from hospital wastewater (S2/2 and S2/10,
Table 3) showed the heteroresistance to colistin in E-test,
whereas other isolates gave clear zones of inhibition. As
described by EUCAST,18 colistin resistance in clinical isolates of A. baumannii should be confirmed by broth microdilution assay. In the commercially available Mikrolatest
broth microdilution test, all isolates showed the MIC value
of colistin above the maximum available 16 mg/L. To elucidate the difference in the MIC values of colistin among the
isolates, manual dilution of colistin sulfate was performed.
Table 2. Primers Used in This Study
Primer
lpxA-up
lpxA-dn
lpxC-up
lpxC-dn
lpxD-up
lpxD-dn
pmrA_1
pmrA_2
pmrB-up
pmrB-dn
eptA-up
eptA-dn
rpoB for
rpoB rev
Sequences
5¢
5¢
5¢
5¢
5¢
5¢
5¢
5¢
5¢
5¢
5¢
5¢
5¢
5¢
AACCACCTACAACCACATGAGAAT 3¢
ACCGCCATTATTGATCCATCTGC 3¢
ACAACACCCGTATCATCTACACCA 3¢
ATGAAGTCAGTGAGGCACGAACT 3¢
TGCTTTCTATGCCTGTTCAGC 3¢
CGCTTACATTGTTACCGCAGC 3¢
GGTGTTGCTGCTCTTTGACG 3¢
GGTGGAATGGGTCAATAACG 3¢
CATTTGCTGGTTCCACCTGTTGAG 3¢
CCCTCTCTTGCTGACTGACCTGA 3¢
TTGCCAAAGATGATGATCGCCCAC 3¢
AGCCCTGTATCGCATTCGTATCAC 3¢
TCCGCACGTAAAGTAGGAAC 3¢
ATGCCGCCTGAAAAAGTAAC 3¢
References
Cafiso et al.3
Cafiso et al.3
Cafiso et al.3
Adams et al.26
Cafiso et al.3
Cafiso et al.3
Coyne et al.27
4
JOVCIC ET AL.
Table 3. Minimum Inhibitory Concentration Values of Tested Antibioticsa
Against Isolates of Acinetobacter baumannii
MIC values of antibiotics (mg/L)
Isolate
Downloaded by SUNY Stony Brook package(NERL) from www.liebertpub.com at 08/10/20. For personal use only.
S2/2
S2/4
S2/10
S14
EF7
EF31
EF32
MEM
IPM
CIP
LVX
TOB
GEN
AMK
R
R
R
R
R
R
R
>16
8I
8I
>16R
>16R
>16R
>16R
8
>16R
>16R
>16R
>16R
>16R
>16R
>4
>4R
>4R
>4R
>4R
>4R
>4R
>8
>8R
4R
>8R
>8R
>8R
>8R
>16
8R
4
>16R
>16R
>16R
>16R
8
>16R
8R
>16R
>16R
>16R
>16R
>64
>64R
>64R
>64R
>64R
>64R
>64R
MIN
2
4
2
4
8I
8I
4
SXT
R
>320
>320R
>320R
>320R
>320R
>320R
>320R
CST
80R
20 R
80R
160R
20R
160R
160R
a
Carbapenems (MEM-meropenem and IPM-imipenem), fluoroquinolones (CIP-ciprofloxacin and LVX-levofloxacin), aminoglycosides
(TOB-tobramycin, GEN-gentamicin, and AMK-amikacin), tetracyclines (MIN-minocycline), SXT-trimethoprim/sulfamethoxazole, and
CST-colistin. R—resistant, I—intermediate according to EUCAST or CLSI criteria.
MIC, minimum inhibitory concentration.
When testing higher concentrations of colistin, variation of
colistin MICs from 20 to 160 mg/L was observed (Table 3).
Colistin adaptation experiments
of A. baumannii isolates
Experiment on adaptation to colistin was done for two
isolates (S2/2 and S2/10) from hospital wastewaters exhibiting
heteroresistance to colistin by E-test and MIC values of
80 mg/L in the microdilution test. Both colistin-heteroresistant
isolates showed similar time and concentration killing
kinetics, which was different between colistin sulfate and
colistimethate sodium (Fig. 1).
In colistin sulfate assay (Fig. 1A), a decrease in number of
bacteria was recorded after 30 minutes of contact at all
concentrations as compared with positive control without
colistin sulfate. Bactericidal activity was demonstrated after
1 hour of contact at concentration of 80 mg/L and after 3
hours of contact at concentrations of 20 and 40 mg/L. Decay
of bacteria stopped after 6 hours and the regrowth occurred
after 24 hours of contact. After 72 hours, the number of
bacteria at concentrations up to 10 mg/L was similar to
positive control, but at concentrations >20 mg/L, the number
of bacteria was still substantially lower than in positive
control. After the inoculation of colistin-adapted population
(to 80 mg/L) into fresh Mueller–Hinton broth with 80 mg/L
of colistin sulfate, no decay of bacteria during incubation
was observed (data not shown).
There was a delay in bactericidal activity of colistimethate sodium (Fig. 1B) as compared with colistin sulfate.
There was no activity of colistimethate sodium up to concentration of 5 mg/L as compared with positive control. The
decrease of number of bacteria was observed after 3 hours of
contact at concentrations of 10–80 mg/L. At concentrations
10 and 20 mg/L that were below the MIC value of isolates
(80 mg/L), the decrease in the number of bacteria stopped
after 6 hours and the regrowth was evidenced after 24 hours
of contact. Bactericidal activity was observed after 6 hours
of contact at concentrations around MIC (40 and 80 mg/L)
and no recovery of number of bacteria was evident during
24 hours of contact. Regrowth of population was observed
after 48 hours of contact and after 72 hours, number of
bacteria at all concentrations of colistimethate sodium was
similar to that of positive control.
Whole genome analysis and sequencing
The PFGE analysis revealed high genetic relatedness
among the A. baumannii isolates recovered from hospital
wastewater and WWTP (Supplementary Fig. S1). Genome
size for seven sequenced isolates varied between 4,056,103
and 4,123,377 bp, with GC content of *39% and average
number of 170 contigs (Supplementary Table S1). Genomic sequences were submitted to MLST 2.0 in Center
for Genomic Epidemiology and all isolates were designated as sequence type ST-2Pasteur inside IC2. A myriad of
acquired antimicrobial resistance conferring genes were
found in genomes of all isolates using ResFinder platform,
for each isolate including mphE (macrolide resistance);
msrE (macrolide, lincosamide, and streptogramin B resistance); tetB (tetracycline resistance); aac(3)-Ia, aadA1,
aph(3¢¢)-Ib, aph(6)-Id, and armA (aminoglycoside resistance); sul1 (sulfonamide resistance); catA1 (chloramphenicol resistance); blaOXA-23, blaOXA-66, and blaADC-25
(beta-lactam resistance).
Amino acid alternations in colistin-resistance
associated proteins
Mutational analysis of the genes encoding LpxA, LpxC,
LpxD, PmrA, PmrB, and EptA proteins of tested isolates
revealed that amino acid alternations were absent in LpxA
and PmrA, comparing with genomes of colistin-susceptible
A. baumannii ATCC 19606 and ATCC 17978. Unlike them,
single alternation was detected in LpxC (N286D) as well as
in LpxD (E117K) in all isolates. In addition, in PmrB protein of all isolates was present two amino acid changes
(A138T and A444V), whereas alternation R263S was noticed in four isolates (S2/2, S2/4, EF32, and S14), L267W in
two isolates (S2/10 and EF31), and Q309P in one isolate
(S2/4). Variation within amino acid sequences of EptA
proteins was the same for all isolates (F166L, I228V,
R348K, A370S, and K531T) (Table 4).
Expression analysis of the colistin-resistance
associated genes
To establish molecular mechanism responsible for colistin resistance in tested isolates, transcription analysis of the
following genes was performed: lpxA, lpxC, lpxD, pmrA,
Downloaded by SUNY Stony Brook package(NERL) from www.liebertpub.com at 08/10/20. For personal use only.
COLISTIN RESISTANCE IN ENVIRONMENTAL A. BAUMANNII
5
FIG. 1. Time and concentration killing kinetics for colistin-heteroresistant Acinetobacter baumannii isolate S2/2 in
(A) colistin sulfate and (B) colistimethate sodium assay.
pmrB, and eptA. The lpxA and lpxD mRNA levels were
statistically significantly decreased in all isolates (except
lpxD of isolate S2/4), whereas the lpxC mRNA level was
increased (except the lpxC mRNA of isolate EF7) (Fig. 2A).
Variations in decrease of the lpxA (7.2% to 51% comparing
with control) and lpxD (0% to 48.8%) mRNAs within different isolates could be noticed. Expression analysis of the
pmrA and pmrB genes revealed that this two-component
system was upregulated in some isolates (S2/4, S2/10, and
EF31), whereas in other isolates it was downregulated (S2/2,
Table 4. Amino Acid Alternations in LpxC, LpxD, PmrB, and EptA Proteins
of Tested Colistin-Resistant Acinetobacter baumannii Isolates
Isolate
LpxC
LpxD
S2/2
S2/4
S2/10
S14
EF7
EF31
EF32
N286D
N286D
N286D
N286D
N286D
N286D
N286D
E117K
E117K
E117K
E117K
E117K
E117K
E117K
PmrB
A138T,
A138T,
A138T,
A138T,
A138T,
A138T,
A138T,
R263S, A444V
R263S, Q309P, A444V
L267W, A444V
R263S, A444V
A444V
L267W, A444V
R263S, A444V
EptA
F166L,
F166L,
F166L,
F166L,
F166L,
F166L,
F166L,
I228V,
I228V,
I228V,
I228V,
I228V,
I228V,
I228V,
R348K,
R348K,
R348K,
R348K,
R348K,
R348K,
R348K,
A370S,
A370S,
A370S,
A370S,
A370S,
A370S,
A370S,
K531T
K531T
K531T
K531T
K531T
K531T
K531T
Downloaded by SUNY Stony Brook package(NERL) from www.liebertpub.com at 08/10/20. For personal use only.
6
JOVCIC ET AL.
FIG. 2. Relative expression level of colistin-resistance associated genes from tested colistin-resistant Acinetobacter
baumannii isolates. (A) Relative expression level of the lpxA, lpxC, and lpxD genes. (B) Relative expression level of the
pmrA, pmrB, and eptA genes. All expression results were normalized relative to the rpoB gene by the 2-DDCt method. Values
are the means from results obtained in triplicate. Error bars represent the standard deviation of the mean value. A Student’s t
test was used to compare the results obtained for colistin-resistant isolates with those for colistin-susceptible isolate
A. baumannii 6077/12 (*p < 0.05, **p < 0.01, ***p < 0.001).
EF7, EF32, and S14) (Fig. 2B). Interestingly, amino acid
variations within PmrB protein correlated with the different
pmrAB expression pattern (A138T, R263S, and A444V with
decrease in pmrAB mRNAs; L267W and Q309P with increase in pmrAB mRNAs). Levels of mRNA of the phosphoethanolamine transferase, the eptA, were significantly
increased (from 1.13- to 9.58-fold) in all isolates except EF7
(Fig. 2B).
Virulence factors of A. baumannii isolates
All isolates expressed a low level of hydrophobicity with
0–17% of bacterial migration to n-hexadecane (Table 5).
Majority of the isolates were weak biofilm and pellicle
formers (Table 5). Only two colistin-heteroresistant isolates
(S2/2 and S2/10) formed a strong biofilm.
Survival of A. baumannii isolates in river water
Two isolates of A. baumannii (S2/2 and EF7) slightly
multiplied in river water (increase of 0.2–0.3 log CFU/mL)
up to 14 days of incubation (Fig. 3). Number of viable A.
baumannii started to decrease after 21 days of incubation in
river water. At the end of 50 days monitoring, initial number
of A. baumannii was reduced just for 1.1–1.2 log CFU/mL
as compared with the initial bacterial load.
Table 5. Expression of the Virulence Factors
of Acinetobacter baumannii Isolates
Isolate
Hydrophobicity (%)
Biofilm (A550)a
Pellicle
S2/2
S2/4
S2/10
S14
EF7
EF31
EF32
8.2 – 3.7
0.3 – 0.0
16.9 – 2.7
4.6 – 2.3
0 – 0.0
11.1 – 2.3
6.8 – 1.0
1.2 – 0.4
0.4 – 0.3
1.5 – 0.4
0.6 – 0.1
0.7 – 0.0
0.4 – 0.1
0.5 – 0.1
Weak
Weak
Weak
Weak
Weak
Weak
Weak
a
Biofilm formation was defined as A(550): <0.4 no biofilm; 0.4–1.0
weak biofilm; >1.0 strong biofilm formation.
Discussion
In this study, we report the occurrence of colistin-resistant
isolates of A. baumannii in hospital wastewater, activated
sludge of the urban WWTP (receiving untreated hospital
wastewater), and WWTP effluent. All isolates belonged to
the IC2, which is the most prevalent international clone
in Zagreb hospitals as well as in Europe.33 In addition, all
isolates are representatives of MLST Pasteur ST2, which is
described in association with colistin resistance of nosocomial origin in several studies.1–4,34 MIC determination as
well as analysis of antibiotic resistance determinants in the
genomes revealed that tested isolates could be considered as
pandrug resistant. Especially important is their resistance to
antibiotics used in therapy of nosocomial infections caused
by A. baumannii such as aminoglycosides, carbapenems,
and colistin.35 All isolates shared the nonsusceptibility to
carbapenems and fluoroquinolones, which is a common
antibiotic susceptibility profile of clinical isolates in Zagreb.16 However, environmental A. baumannii isolates possessed additional resistance to colistin. Colistin-resistant
A. baumannii were not reported from clinical specimens in
the Special Hospital for Pulmonary Diseases neither in other
hospitals in Zagreb during the investigation period (2015–
2016).36 Colistin-resistant A. baumannii in Croatian clinics
are also very rare these days. Only eight colistin-resistant
isolates of A. baumannii were reported in hospitals other
than Zagreb (Osijek and Pula) during 2017–2018.37
The absence of colistin-resistant A. baumannii in clinical
specimens, but their presence in hospital wastewater, suggests the development of colistin resistance in sewage.
During the wastewater sampling period in the Special
Hospital for Pulmonary Diseases, colistin has been sporadically used for therapy of some patients. However, even in
the case of colistin usage in clinics, the antibiotic residue in
hospital wastewater would be far below the effective dosage
that could provoke the development of resistance.38 Obviously, colistin-susceptible A. baumannii present in the
colonized or infected hospitalized patients are disseminated
into the hospital wastewater by hygiene maintenance. In
hospital wastewater, colistin resistance is most likely developed under the influence of other emerging water
COLISTIN RESISTANCE IN ENVIRONMENTAL A. BAUMANNII
7
Downloaded by SUNY Stony Brook package(NERL) from www.liebertpub.com at 08/10/20. For personal use only.
FIG. 3. Survival of two
A. baumannii isolates recovered
from hospital wastewater (S2/2)
and WWTP effluent (EF7) in the
autoclaved river water during 50
days of monitoring. WWTP,
wastewater treatment plant.
pollutants. Colistin is a positively charged molecule at neutral
pH,5 which was measured in the investigated wastewater
samples (data not shown). Other positively charged molecules
present in wastewater could induce the changes of bacterial
lipopolysaccharide, resulting in the colistin-resistance phenotype. Cationic surfactants are widely used in detergents, fabric
softeners, hair conditioners, and disinfectants and are released
via wastewaters in the environment.39 Therefore, the cationic
surfactants could be responsible for the development of crossresistance to colistin, but this hypothesis should be further
confirmed.
The untreated hospital wastewater from the investigated,
as well as from other hospitals in Zagreb, is released into
the urban sewage. Therefore, the urban sewage at WWTP
contains the proportion of hospital wastewater.17 The
colistin-resistant A. baumannii persist in the activated sludge
of the WWTP and are emitted via the treated effluent water
into the natural recipients. Besides the propagation of
colistin-resistant isolates A. baumannii, the additional development of colistin resistance is also possible to occur in
the WWTP, which is recognized as hot spots for the development of antibiotic resistance.40
For colistin-heteroresistant clinical isolates of A. baumannii, bactericidal action within 2 hours of contact at colistin sulfate concentrations above MIC and the regrowth
after 24 hours at concentrations up to 32X MIC have been
reported.20 In experiments with colistin sulfate, colistinheteroresistant isolates of A. baumannii from hospital
wastewater showed comparable time and concentration
killing kinetics to describe clinical isolates. As compared
with colistin sulfate, colistimethate sodium showed a delay
in bactericidal action, as well as in recovery of the population of environmental isolates of A. baumannii. Colistimethate sodium is a nonactive form, whereas the active
form of colistin is formed through time in vivo as well as
in vitro. This explains a delay in bactericidal activity of
colistimethate sodium as compared with colistin sulfate. The
colistin-hereroresistant isolates from hospital wastewater
were adapted to colistin concentration of 80 mg/L that is
much higher than maximum allowed daily human admission dosage of 6 mg/kg.41 Colistin is often the only effective
antibiotic in the treatment of infection caused by MDR A.
baumannii that remained susceptible to colistin. The proliferation of colistin-resistant subpopulation after exposure
to colistin poses a serious concern since it excludes the use
of colistin in human monotherapy.
Moreover, the presence of colistin-resistant A. baumannii
in hospital wastewater and WWTP opens the possibility of
their propagation in the environment. The removal of MDR
A. baumannii using conventional technologies of the secondary wastewater treatment17 or even disinfection of
wastewater by chlorination42 is negligible. The MDR A.
baumannii multiplied and survived in WWTP effluent during 50 days of monitoring.43 The colistin-resistant A. baumannii tested in this study showed low expression of the
virulence factors, which is consistent with the report31 that
antibiotic-resistant isolates express lower virulence factors
than the sensitive isolates. However, colistin-resistant A.
baumannii showed multiplication and long-term survival in
river water. The colistin-resistant A. baumannii were recovered from treated effluent of the WWTP, which is discharged into the Sava River. Owing to the questionable
removal in WWTP, and the ability of survival in treated
effluent as well as in the water of natural recipient, colistinand pandrug-resistant isolates of A. baumannii could be
spread into the natural environment. Such isolates in the
environment represent a public health risk and the source for
occurrence of acute community-acquired infections44 of
people and animals that are exposed to water.
According to mechanisms responsible for colistin resistance in A. baumannii,7 we analyzed mutations and expression levels of genes encoding two-component system
PmrAB, phosphoethanolamine transferase EptA, as well as
participants in LPS biosynthesis LpxA, LpxC, and LpxD.
The most common alternations associated with colistin resistance are those detected in PmrB protein as confirmed in
our study.7 Amino acid alternations of PmrB detected in all
isolates (A138T and A444V) were previously described in
clinical A. baumannii from Croatia, Greece, and Turkey and
it was assumed that they are not responsible for colistin
resistance.11,37,45,46 Unlike that mentioned, mutations noticed in the region corresponding to histidine kinase domain
could play a role in colistin resistance (R263S and
L267W),46 especially because changes on these positions
Downloaded by SUNY Stony Brook package(NERL) from www.liebertpub.com at 08/10/20. For personal use only.
8
JOVCIC ET AL.
are described in previous studies.3,4,8,11,12 In addition, the
alternation on the 309 amino acid position (Q to P) in PmrB
protein was observed for the first time. Multiple mutations
detected in the pmrC homologue eptA of all isolates have
not been reported previously, so their contribution to colistin
resistance should be investigated in the future. Single amino
acid alternation in LpxC (N286D) of all isolates was not
detected previously, but some others were noticed at the
closest positions.6,45 In addition, the change E117K of LpxD
was noticed previously in Greece and Turkey, but it was
present in both susceptible and resistant isolates.11,45
Transcriptional analysis of genes encoding pmrAB revealed
that some isolates showed increased (PmrB R263S)
mRNA levels, whereas others had decreased (PmrB,
L267W, and Q309P) mRNA levels compared with the
colistin-susceptible isolate. All tested isolates increasingly expressed the eptA gene, which could indicate its
main role in colistin resistance through lipid A modification.10 In addition, underexpression of genes essential
for LPS biosynthesis (lpxA and lpxD) could lead to decreased LPS production and be considered as additional
mechanism responsible for colistin resistance in analyzed
isolates.3
Compliance with Ethical Standards
This research fully complies with ethical standards applicable for this journal and the relevant national and international ethics-related rules and professional codes of
conduct.
Disclosure Statement
No competing financial interests exist.
Funding Information
This study was supported by the Ministry of Education,
Science and Technological Development of the Republic of
Serbia and Croatian Science Foundation (Project No. IP2014-09-5656).
Supplementary Material
Supplementary Figure S1
Supplementary Table S1
References
1. Agodi, A., E. Voulgari, M. Barchitta, A. Quattrocchi,
P. Bellocchi, A. Poulou, and A. Tsakris. 2014. Spread of a
carbapenem-and colistin-resistant Acinetobacter baumannii
ST2 clonal strain causing outbreaks in two Sicilian hospitals. J. Hosp. Infect. 86:260–266.
2. Bakour, S., A.O. Olaitan, H. Ammari, A. Touati, S. Saoudi,
K. Saoudi, and J.M. Rolain. 2015. Emergence of colistinand carbapenem-resistant Acinetobacter baumannii ST2
clinical isolate in Algeria: first case report. Microb. Drug
Resist. 21:279–285.
3. Cafiso, V., S. Stracquadanio, F. Lo Verde, G. Gabriele,
M.L. Mezzatesta, C. Caio, G. Pigola, A. Ferro, and S.
Stefani. 2019. Colistin resistant A. baumannii: genomic and
transcriptomic traits acquired under colistin therapy. Front.
Microbiol. 9:3195.
4. Trebosc, V., S. Gartenmann, M. Tötzl, V. Lucchini, B.
Schellhorn, M. Pieren, S. Lociuro, and C. Kemmer. 2019.
Dissecting colistin resistance mechanisms in extensively
drug-resistant Acinetobacter baumannii clinical isolates.
MBio 10:e01083-19.
5. Clausell, A., M. Garcia-Subirats, M. Pujol, M.A. Busquets,
F. Rabanal, and Y. Cajal. 2007. Gram-negative outer and
inner membrane models: insertion of cyclic cationic lipopeptides. J. Phys. Chem. B. 111:551–563.
6. Moffatt, J.H., M. Harper, P. Harrison, J.D. Hale, E. Vinogradov, T. Seemann, R. Henry, B. Crane, F. St Michael,
A.D. Cox, B. Adler, R.L. Nation, J. Li, and J.D. Boyce.
2010. Colistin resistance in Acinetobacter baumannii is
mediated by complete loss of lipopolysaccharide production. Antimicrob. Agents Chemother. 54:4971–4977.
7. Olaitan, A.O., S. Morand, and J.M. Rolain. 2014. Mechanisms of polymyxin resistance: acquired and intrinsic
resistance in bacteria. Front. Microbiol. 5:643.
8. Arroyo, L.A., C.M. Herrera, L. Fernandez, J.V. Hankins, M.S.
Trent, and R.E.W. Hancock. 2011. The pmrCAB operon
mediates polymyxin resistance in Acinetobacter baumannii
ATCC 17978 and clinical isolates through phosphoethanolamine modification of lipid A. Antimicrob. Agents Chemother.
55:3743–3751.
9. Lee, J.Y., E.S. Chung, and K.S. Ko. 2017. Transition of
colistin dependence into colistin resistance in Acinetobacter baumannii. Sci. Rep. 7:1–11.
10. Gerson, S., J.W. Betts, K. Lucaße, C.S. Nodari, J. Wille, M.
Josten, and J. Vila. 2019. Investigation of novel pmrB and
eptA mutations in isogenic Acinetobacter baumannii isolates
associated with colistin resistance and increased virulence
in vivo. Antimicrob. Agents Chemother. 63:e01586-18.
11. Nurtop, E., F.B. Bilman, S. Menekse, O.K. Azap, M. Gönen, O. Ergonul, and F. Can. 2019. Promoters of colistin
resistance in Acinetobacter baumannii infections. Microb.
Drug Resist. 25:997–1002.
12. Lesho, E., E.J. Yoon, P. McGann, E. Snesrud, Y. Kwak,
M. Milillo, and P.E. Waterman. 2013. Emergence of
colistin-resistance in extremely drug-resistant Acinetobacter baumannii containing a novel pmrCAB operon
during colistin therapy of wound infections. J. Infec. Dis.
208:1142–1151.
13. Gharaibeh, M.H., and S.Q. Shatnawi. 2019. An overview of
colistin resistance, mobilized colistin resistance genes dissemination, global responses, and the alternatives to colistin: a review. Vet. World 12:1735–1746.
14. Hameed, F., M.A. Khan, H. Muhammad, T. Sarwar, H.
Bilal, and T.U. Rehman. 2019. Plasmid-mediated mcr-1
gene in Acinetobacter baumannii and Pseudomonas aeruginosa: first report from Pakistan. Rev. Soc. Bras. Med.
Trop. 52:e20190237.
15. Ma, F., C. Shen, X. Zheng, Y. Liu, H. Chen, L. Zhong, Y.
Liang, K. Liao, Y. Xia, G.B. Tian, and Y. Yang. 2019.
Identification of a novel plasmid carrying mcr-4.3 in an
Acinetobacter baumannii strain in China. Antimicrob.
Agents Chemother. 63:e00133-19.
16. Seruga Music, M., J. Hrenovic, I. Goic-Barisic, B. Hunjak, D.
Skoric, and T. Ivankovic. 2017. Emission of extensively-drug
resistant Acinetobacter baumannii from hospital settings to
the natural environment. J. Hosp. Infect. 96:232–237.
17. Higgins, P.G., J. Hrenovic, H. Seifert, and S. Dekic. 2018.
Characterization of Acinetobacter baumannii from water
and sludge line of secondary wastewater treatment plant.
Water Res. 140:261–267.
Downloaded by SUNY Stony Brook package(NERL) from www.liebertpub.com at 08/10/20. For personal use only.
COLISTIN RESISTANCE IN ENVIRONMENTAL A. BAUMANNII
18. EUCAST, European Committee on Antimicrobial Susceptibility Testing. Breakpoint tables for interpretation of
MICs and zone diameters, Version 9.0. 2019.
19. CLSI, Clinical and Laboratory Standards Institute. 2019.
Performance Standards for Antimicrobial Susceptibility
Testing, Document M100-ED29. Clinical and Laboratory
Standards Institute, Wayne, NJ.
20. Li, J., C.R. Rayner, R.L. Nation, R.J. Owen, D. Spelman,
K.E. Tan, and L. Liolios. 2006. Htereroresistance to colistin in multidrug-resistant Acinetobacter baumannii. Antimicrob. Agents Chemother. 50:2946–2950.
21. Kojic, M., I. Strahinic, and L. Topisirovic. 2005. Proteinase
PI and lactococcin A genes are located on the largest
plasmid in Lactococcus lactis subsp. lactis bv. diacetylactis
S50. Can. J. Microbiol. 51:305–314.
22. Peng, Y., H.C. Leung, S.M. Yiu, and F.Y. Chin. 2012. IDBAUD: a de novo assembler for single-cell and metagenomic
sequencing data with highly uneven depth. Bioinformatics
28:14208.
23. Li, H., and R. Durbin. 2010. Fast and accurate long-read
alignment with Burrows-Wheeler transform. Bioinformatics
26:58995.
24. Disz, T., S. Akhter, D. Cuevas, R. Olson, R. Overbeek, V.
Vonstein, R. Stevens, and R.A. Edwards. 2010. Accessing
the SEED genome databases via Web services API: tools
for programmers. BMC Bioinf. 11:319.
25. Hood, M.I., A.C. Jacobs, K. Sayood, P.M. Dunman, and
E.P. Skaar. 2010. Acinetobacter baumannii increases tolerance to antibiotics in response to monovalent cations.
Antimicrob. Agents Chemother. 54:1029–1041.
26. Adams, M.D., G.C. Nickel, S. Bajaksouzian, H. Lavender,
A.R. Murthy, M.R. Jacobs, and R.A. Bonomo. 2009. Resistance to colistin in Acinetobacter baumannii associated
with mutations in the PmrAB two-component system.
Antimicrob. Agents Chemother. 53:3628–3634.
27. Coyne, S., N. Rosenfeld, T. Lambert, P. Courvalin, and B.
Perichon. 2010. Overexpression of resistance-nodulation
cell division pump AdeFGH confers multidrug resistance in
Acinetobacter baumannii. Antimicrob. Agents Chemother.
54:4389–4393.
28. Livak, K.J., and T.D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR
and the 2-DDCT method. Methods 25:402–408.
29. Novovic, K., S. Mihajlovic, Z. Vasiljevic, B. Filipic, J.
Begovic, and B. Jovcic. 2015. Carbapenem-resistant Acinetobacter baumannii from Serbia: Revision of CarO
classification. PLoS One 10:e0122793.
30. Rosenberg, M., D. Gutnick, and E. Rosenberg. 1980. Adherence of bacteria to hydrocarbons: a simple method for
measuring cell-surface hydrophobicity. FEMS Microbiol.
Lett. 9:29–33.
31. Kaliterna, V., M. Kaliterna, J. Hrenovic, I. Barisic, M.
Tonkic, and I. Goic-Barisic. 2015. Acinetobacter baumannii
in the Southern Croatia: clonal lineages, biofilm formation
and resistance patterns. Infect. Dis. 47:902–907.
32. Nait Chabane, Y., S. Marti, C. Rihouey, S. Alexandre, J.
Hardouin, O. Lesouhaitier, J. Vila, J.B. Kaplan, T. Jouenne,
and E. Dé. 2014. Characterisation of pellicles formed by
Acinetobacter baumannii at the air-liquid interface. PLoS
One 9:e111660.
33. Higgins, P.G., K. Prior, D. Harmsen, and H. Seifert. 2017.
Development and evaluation of a core genome multilocus
typing scheme for whole- genome sequence-based typing
of Acinetobacter baumannii. PLoS One 12:e0179228.
9
34. Mustapha, M.M., B. Li, M.P. Pacey, R.T. Mettus, C.L.
McElheny, C.W. Marshall, R.K. Ernst, V.S. Cooper, and
Y. Doi. 2018. Phylogenomics of colistin-susceptible and
resistant XDR Acinetobacter baumannii. J. Antimicrob.
Chemother. 73:2952–2959.
35. Michalopoulos, A., and M.E. Falagas. 2010. Treatment of
Acinetobacter infections. Expert Opin. Pharmacother. 11:
779–788.
36. CAMS. 2016. Antibiotic Resistance in Croatia, 2015.
Croatian Academy of Medical Sciences, Zagreb, Croatia.
37. D’Onofrio, V., R. Conzemius, D. Varda-Brkic, M. Bogdan,
A. Grisold, I.C. Gyssens, B. Bedenic, and I. Barisic. 2020.
Epidemiology of colistin-resistant, carbapenemase-producing
Enterobacteriaceae and Acinetobacter baumannii in Croatia.
Infect. Genet. Evol. 104263.
38. Verlicchi, P. 2018. Hospital Wastewaters: Characteristics,
Management, Treatment and Environmental Risks. Springer
International Publishing, Cham, Switzerland.
39. Ivankovic, T., and J. Hrenovic. 2010. Surfactants in the
environment. Arch. Ind. Hyg. Toxicol. 61:95–110.
40. Hrenovic, J., T. Ivankovic, D. Ivekovic, S. Repec, D. Stipanicev, and M. Ganjto. 2017. The fate of carbapenemresistant bacteria in a wastewater treatment plant. Water
Res. 126:232–239.
41. Biswas, S., J.M. Brunel, J.C. Dubus, M. Reynaud-Gaubert,
and J.M. Rolain. 2012. Colistin: An Update on the Antibiotic of the 21st Century. Expert Rev. Anti. Infect. Ther.
10:917–934.
42. Zhang, C., S. Qiu, Y. Wang, L. Qi, R. Hao, X. Liu, Y. Shi,
X. Hu, D. An, Z. Li, P. Li, L. Wang, J. Cui, P. Wang, L.
Huang, J.D. Klena, and H. Song. 2013. Higher isolation of
NDM-1 producing Acinetobacter baumannii from the
sewage of the hospitals in Beijing. PLoS One 8:e64857.
43. Hrenovic, J., I. Goic-Barisic, S. Kazazic, A. Kovacic, M.
Ganjto, and M. Tonkic. 2016. Carbapenem-resistant isolates of Acinetobacter baumannii in a municipal wastewater treatment plant, Croatia, 2014. Euro Surveill. 21:21–30.
44. Dexter, C., G.L. Murray, I.T. Paulsen, and A.Y. Peleg.
2015. Community-acquired Acinetobacter baumannii:
clinical characteristics, epidemiology and pathogenesis.
Expert. Rev. Anti. Infect. Ther. 13:567–573.
45. Oikonomou, O., S. Sarrou, C.C. Papagiannitsis, S. Georgiadou, K. Mantzarlis, E. Zakynthinos, G.N. Dalekos, and
E. Petinaki. 2015. Rapid dissemination of colistin and
carbapenem resistant Acinetobacter baumannii in Central
Greece: mechanisms of resistance, molecular identification
and epidemiological data. BMC Infect. Dis. 15:559.
46. Nhu, N.T.K., D.W. Riordan, T.D.H. Nhu, D.P. Thanh, G.
Thwaites, N.P.H. Lan, B.W. Wren, S. Baker, and R.A.
Stabler. 2016. The induction and identification of novel
Colistin resistance mutations in Acinetobacter baumannii
and their implications. Sci. Rep. 6:1–8.
Address correspondence to:
Jasna Hrenovic, PhD
Division of Microbiology
Department of Biology
Faculty of Science
University of Zagreb
Rooseveltov trg 6
HR-10000 Zagreb
Croatia
E-mail: jasna.hrenovic@biol.pmf.hr