DNA Replication and Cell Division Form A
DNA Replication
1. What is made during DNA replication?
a. 2 identical copies of DNA
b. 2 different copies of DNA
c. 1 strand of mRNA
d. New cells
2. Which of the following pictures best shows DNA replication?
a.
= new
= old
b.
c.
d.
3. The purpose of DNA replication is…
a. To make copies of DNA to send to the ribosome.
b. To make back-up copies of DNA in case there are mutations.
c. To make more DNA for new cells.
d. To destroy mutated DNA.
4. What enzyme breaks the hydrogen bonds to unzip the DNA for DNA replication?
a. Amylase
b. DNA polymerase
c. Helicase
d. Restriction enzymes
5.
DNA polymerase is the enzyme that…
a. adds the nucleotides to the DNA during replication
b. causes the DNA strands to separate during replication
c. cuts DNA into its individual nucleotides
d. tells the cell to replicate its DNA
6. In DNA replication the DNA must…
a. Unzip
b. Complementary pair with new DNA nucleotides
c. Complementary pair with new RNA nucleotides
d. Go to the ribosome
AB. Both A and B
AC. Both A and C
1A
BB0211-12
DNA Replication and Cell Division Form A
7. What will DNA replication make from the template DNA sequence: G C C T A T C G G T A A?
a. C A A T G G C T A T C C
b. C G G A T A G C C A T T
c. T A A G C G A T T G C C
d. C G G A U A G C C A U U
Cell Cycle
Match the diagram to the following parts of the cell cycle.
A.
8. Anaphase
9. Interphase
10. Metaphase
11. Prophase
12. What is the cell cycle?
a. It describes the death of a cell.
b. It shows how more DNA is made.
c. It describes the life of a cell.
d. It shows how proteins are made.
D. C.
B.
Cytokinesis
Telophase
13. What happens to a cell when its checkpoints in the cell cycle are not functioning properly?
a. A tumor can form
b. The cell dies
c. The cell goes through meiosis
d. There is no change
14. Which of the following is not a mutagen?
a. Chemicals found in cigarettes
b. UV rays from the sun or tanning beds
c. Salty foods
d. X-ray radiation
Mitosis
15. Mitosis is the process by which…
a. DNA is replicated
b. body cells are made
c. cytokinesis occurs
d. sex cells are made
16. As a result of mitosis, each daughter cell…
a. Has the same number of chromosomes as the parent cell
b. Has half the chromosomes of the parent cell
c. Has twice as many chromosomes as the parent cell
d. Donates a chromosome to the parent cell
2A
BB0211-12
DNA Replication and Cell Division Form A
17. How many cells are there at the end of mitosis?
a. 1
b. 2
c. 4
d. 8
18. If the parent cell has 30 chromosomes, how many chromosomes will the daughter cells have after
mitosis?
a. 2
b. 15
c. 30
d. 60
19. Why does a cell do mitosis?
a. To create egg and sperm cells
b. To make cells for growth, healing, and maintenance
c. To make proteins
d. To make DNA
20. What type of an organism can reproduce using mitosis?
a. Insects
b. Humans
c. Fish
d. Bacteria
Phases
21. The nuclear membrane disappears during this stage.
a. Anaphase
b. Interphase
c. Metaphase
d. Prophase
e. Telophase
22. Stage in which DNA replication occurs.
a. Anaphase
b. Interphase
c. Metaphase
d. Prophase
e. Telophase
23. The stage of mitosis in which the chromosomes line up in the middle of the cell.
a. Anaphase
b. Interphase
c. Metaphase
d. Prophase
e. Telophase
3A
BB0211-12
DNA Replication and Cell Division Form A
24. Nuclear membrane forms around DNA and the cell membrane pinches in.
a. Anaphase
b. Interphase
c. Metaphase
d. Prophase
e. Telophase
25. Stage in which the chromatin becomes chromosomes.
a. Anaphase
b. Interphase
c. Metaphase
d. Prophase
e. Telophase
26. Stage when the cell is grows, makes new organelles, and does its normal jobs.
a. Anaphase
b. Interphase
c. Metaphase
d. Prophase
e. Telophase
27. The stage when do the sister chromatids split apart.
a. Anaphase
b. Interphase
c. Metaphase
d. Prophase
e. Telophase
Meiosis
28. Meiosis is the process by which…
a. DNA is replicated
b. body cells are made
c. cytokinesis occurs
d. sex cells are made
29. What type of cell is made through the process of meiosis?
a. haploid cells
b. diploid cells
c. parent cells
d. toe cells
30. Meiosis makes…
a. 4 cells that are different from each other
b. 4 identical cells
c. 2 cells that are different from each other
d. 2 identical cells
4A
BB0211-12
DNA Replication and Cell Division Form A
31. Why does a cell do meiosis?
a. To create egg and sperm cells
b. To make cells for growth, healing, and maintenance
c. To make proteins
d. To regenerate toes, fingers, and limbs when a fetus loses them before birth
32. Which of the following pictures best shows the homologous chromosomes in metaphase I?
a.
b.
c.
d.
33. What type of an organism would reproduce using meiosis?
a. Yeast
b. Dogs
c. Bacteria
d. Cloned sheep
34. What type of mutation will happen if the homologous chromosomes do not split apart evenly
during meiosis?
a. point mutation
b. frame-shift mutation
c. nondisjunction
d. cancer
35. How many chromosomes does a typical human body cell have?
a. 12
b. 23
c. 46
d. 92
5A
BB0211-12
DNA Replication and Cell Division Form A
1. a. Draw what will happen to the below DNA when the restriction enzyme for G A A T T C is added.
CTTAAG
CAACGAATTCC CTTAAGCTATCTTGCAGAATTCC TTCTA
GTTGCTTAAGGGAATTCGATAGAACGTCTTAAGGAAGAT
b. Explain what is made above. USE COMPLETE SENTENCES.
2. Read the following DNA fingerprint.
a. Whose DNA was found at the crime scene?
b. Explain how you decided whose DNA was at the
crime scene.
3. Label the following pictures as a Chromosome or Chromatin
a.
____________________
b.
c.
____________________
6A
____________________
BB0211-12
DNA Replication and Cell Division Form A
4-7. Label the following diagrams with the phase of mitosis they are in.
4. ________________ 5 ________________ 6. ________________ 7. ________________
8-11 Label the following diagrams with the phase of meiosis they are in (don’t forget I or II)
8. ________________ 9. ________________ 10. ________________ 11. ________________
12. What stage does the following picture show?
13. Label the following diagrams as: Mitosis, Meiosis, or Neither
1n
1n
1n
1n
1n
2n
2n
2n
1n
2n
1n
1n
2n
1n
a. ______________________
1n
b.______________________
7A
c. ______________________
BB0211-12