Look at the following samples of Codons and tell me the Amino Acid Associated with it. 1. UCA _________________________________ 2. CCG _________________________________ 3. UUU _________________________________ 4. CAC _________________________________ 5. AAA _________________________________ 6. AGA _________________________________ 7. GUU _________________________________ 8. GGG _________________________________ 9. UAG _________________________________ 10. CUA _________________________________ 11. Read the mRNA below and translate the code to find the ANTI-CODONS on the line below. _______________________________________________________________________________________________ ACGUCCAGUCCAACUCAGGAA 13 14 15 16 17 18 19 12. Now break down the code using the sun dial to figure out the order of Amino Acid chain that makes this protein. Write the order on the lines below. 13. _____________________ 14. _____________________ 15. _____________________ 16. _____________________ 17. _____________________ 18. _____________________ 19. _____________________