Hydrobiologia
DOI 10.1007/s10750-014-1891-8
ADVANCES IN CICHLID RESEARCH
Phylogeographic analysis of genus Herichthys (Perciformes:
Cichlidae), with descriptions of Nosferatu new genus
and H. tepehua n. sp.
Mauricio De la Maza-Benignos • Claudia Patricia Ornelas-Garcı́a •
Marı́a de Lourdes Lozano-Vilano • Marı́a Elena Garcı́a-Ramı́rez •
Ignacio Doadrio
Received: 30 December 2013 / Accepted: 13 April 2014
Ó Springer International Publishing Switzerland 2014
Abstract The genus Herichthys is widely considered
to be the monophyletic representative of Cichlidae in
northeastern Mexico and southern Texas. It is also the
northernmost distributed genus of Neotropical Cichlids.
Its distribution stretches over an area that is characterized
by an intricate geologic and climatic history that affected
its temporal and spatial diversification north of the TransMexican Volcanic-Belt. We access the evolutionary
history of the genus Herichthys based on a phylogenetic
reconstruction using a mitochondrial fragment of gene
Cox1. We evaluate its morphological variation, its
correspondence with molecular differentiation and suggest a biogeographical scenario based on a molecular
clock and demographic history. Furthermore, we
describe Nosferatu new genus, composed of Nosferatu
Guest editors: S. Koblmüller, R. C. Albertson, M. J. Genner,
K. M. Sefc & T. Takahashi / Advances in Cichlid Research:
Behavior, Ecology and Evolutionary Biology
Electronic supplementary material The online version of
this article (doi:10.1007/s10750-014-1891-8) contains supplementary material, which is available to authorized users.
M. De la Maza-Benignos
Pronatura Noreste, A.C., Loma Grande 2623,
Col. Loma Larga, 64710 Monterrey, N.L, Mexico
C. P. Ornelas-Garcı́a (&)
Departamento de Zoologı́a, Universidad
Nacional Autónoma de México, Mexico,
D.F, Mexico
e-mail: patriciaornelasg@gmail.com
pame (assigned as type species), N. molango, N. pratinus,
N. bartoni, N. labridens, N. pantostictus, and N. steindachneri. Genus is characterized by a transition to
prolongation in the size of the symphysial pair of teeth
relative to that of the other teeth in the outer row of the
upper jaw; breeding pigmentation that consists of
darkening of ventral area extending over nostrils,
opercular series, or pectoral fins; depressed dorsal fin
rarely expands beyond anterior third of caudal fin; and an
elongated, elastic, smooth caecum adhered to a saccular
stomach. We also describe Herichthys tepehua n. sp.
found in the Pantepec, Cazones, Tenixtepec, Tecolutla,
and Solteros rivers, in Veracruz, Mexico. Moreover, we
provide re-descriptions for some of the species in
Herichthys and propose a biogeographic hypothesis for
both genera, based on available information on the
geological and climate history of the area of study,
associated to dating retrieved in our phylogenetic
analysis.
Keywords Nosferatu Herichthys Cox1 Phylogeny Phylogeography
M. L. Lozano-Vilano M. E. Garcı́a-Ramı́rez
Laboratorio de Ictiologı́a, Facultad de Ciencias
Biológicas, UANL, Ap. Postal 425 San Nicolás de los
Garza, 66450 Mexico, N.L, Mexico
I. Doadrio
Departamento de Biodiversidad y Biologı́a Evolutiva,
Museo Nacional de Ciencias Naturales, CSIC, José
Gutiérrez Abascal 2, 28006 Madrid, Spain
123
Hydrobiologia
Introduction
The tribe Heroini forms the second largest monophyletic group of Neotropical cichlids, with distributions
ranging from the province of Buenos Aires in Argentina, South America to the Rio Grande Basin in
North America (Kullander, 1998; Concheiro-Pérez
et al., 2006; De la Maza-Benignos & Lozano-Vilano, 2013). This tribe includes the Herichthyines, which
are represented by the genera Paraneetroplus and
Vieja as reviewed by McMahan et al. (2010), Herichthys, Herotilapia, Paratheraps, Theraps, Tomocichla,
and Thorichthys, together with other ‘‘unnamed
genera’’ (Concheiro-Pérez et al., 2006; Řı́čan et al.,
2008, 2012; De la Maza-Benignos & Lozano-Vilano,
2013).
During the last two decades, significant progress in
molecular phylogenetic studies of the Neotropical
Cichlids has been made (e.g., Roe et al., 1997; Martin
& Bermingham, 1998; Farias et al., 1999, 2000, 2001;
Sides & Lydeard, 2000; Hulsey et al., 2004; LópezFernández et al., 2005a, b; Concheiro-Pérez et al.,
2006 ;Chakrabarty, 2007; Musilová et al., 2008; Řı́čan
et al., 2008, 2012; López-Fernández et al., 2010); still,
their intrageneric relationships remain only partially
understood. Studies with few exceptions (e.g., Schmitter-Soto, 2007; Kullander et al., 2010; McMahan
et al., 2010) have largely addressed intergeneric
relationships and evolutionary history at higher taxonomic levels.
Some of the factors that have so far hindered both
phylogenetic and morphological analysis at the intrageneric level include high taxon diversity, wide
distribution ranges, phenotypic plasticity, and morphological homoplasies, as well as low morphometric
variation and absence of genetic resolution across
some of the taxa that ‘‘make character sets inadequate
for revealing relationships’’ (Martin & Bermingham,
1998; López-Fernández et al., 2010; De la MazaBenignos & Lozano-Vilano, 2013).
The genus Herichthys is widely considered as the
monophyletic representative of Cichlidae in northeastern
Mexico and southern Texas (Hulsey et al., 2004;
Concheiro-Pérez et al., 2006; Řı́čan et al., 2008; De la
Maza-Benignos & Lozano-Vilano, 2013). It is also
the northernmost distributed genus of Neotropical
Cichlids.
Herichthys are found from the lower tributaries of
the Rio Grande, excluding the Rio Conchos Basin in
123
Chihuahua, to the Misantla River Basin in Veracruz,
Mexico (De la Maza-Benignos & Lozano-Vilano,
2013), along the structural Burgos and Tampico–
Misantla basins, over an area that is characterized by
an intricate geologic (Byerly, 1991; Ferrari et al.,
1999) and climatic history (Metcalfe et al., 2000;
Ravelo et al., 2004; Metcalfe, 2006). Its distribution
range also corresponds to the inland portion of the
Eastern Mexico Continental Shelf and Slope Geological Province, which extends from 26° to 20°N
(Antoine, 1972) and whose southernmost land point
is known as Punta del Morro (PDM). PDM in turn is
the easternmost extension where the Trans-Mexican
Volcanic-Belt (TMVB) meets the Gulf of Mexico
(Contreras-Balderas et al., 1996). The origin of the
TMVB is related to Neogene subduction of the Cocos
and Rivera plates beneath the southwestern margin of
the North American plate on the Pacific coast (Avto
et al., 2007).
Climate change in the last 4 million years includes
the end of the warm period (Ravelo et al., 2004), with
higher winter precipitation, cooler and wetter conditions than today, during the Pleistocene, and early
Holocene in northern Mexico (Metcalfe et al., 2000;
Metcalfe, 2006). In this paper, we propose that both
neo-volcanism and climate change played major roles
in the temporal and spatial diversification of the
cichlid fishes found north of PDM.
In a previous taxonomic hypothesis, De la MazaBenignos & Lozano-Vilano (2013) suggested the
separation of Herichthys into two distinct groups,
the ‘‘labridens assemblage’’ (described herein as
Nosferatu new genus) and the ‘‘cyanoguttatus
assemblage’’ (herein referred to as true Herichthys).
The separation is congruent with phylogenetic
hypothesis developed by Hulsey et al. (2004),
Concheiro-Pérez et al. (2006), and López-Fernández
et al. (2010).
The aim of this study was to review the evolutionary history of the genus Herichthys by accessing its
phylogenetic relationships, as well as temporal and
biogeographic patterns. To achieve this goal, we
characterized its morphological variations as well as
its molecular structure using the mitochondrial gene,
Cox1. We reviewed the taxonomy of the group,
described a new genus, described a new species, and
re-described some of the species of Herichthys.
Moreover, we propose a biogeographic hypothesis
for the group.
Hydrobiologia
Methods
Specimens examined in the present study were
collected throughout the historical range of Herichthys
(Kullander, 2003; Miller et al., 2005; De la MazaBenignos & Lozano-Vilano, 2013) (Fig. 1) by angling
and cast nets, and include representatives of all the
nominal species that have been assigned to the genus
Herichthys at various times.
Samples were limited to 20 individuals per locality
for each sampling event. Coordinates for the localities
are given in decimal degrees. This sample size was
based on the current conservation status of the species
as determined by NOM-059 (SEMARNAT, 2010).
The collected specimens were fixed in 10% formalin,
then transferred to 50% isopropanol, and finally
deposited in the Colección Ictiológica de la Facultad
de Ciencias Biológicas de la Universidad Autónoma
de Nuevo León (UANL). Tissue samples were taken
from pectoral fin clips. Fin clips were preserved in
95% ethanol and deposited in the Museo Nacional de
Ciencias Naturales of Madrid, Spain (MNCN).
Morphometry and meristics
Thirteen counts and 42 standard body measurements
were obtained from 279 mature representatives of all
the known nominal species assigned to Herichthys
(Kullander, 2003), except H. minckleyi, plus 95
mature specimens of Nosferatu new genus (7 species),
except N. steindachneri and N. bartoni, as interpreted
by De la Maza-Benignos & Lozano-Vilano (2013)
(Supplementary Material 1). Measurements (in millimeters) in the diagnosis and descriptions are expressed
as percent of the standard length (SL) or head length
(HL) (Álvarez, 1970; Taylor & Miller, 1983). Three
specimens of each population, except for N. steindachneri (1); N. bartoni (1 pharyngeal plate), and
H. minckleyi (0), were dissected to remove the
digestive tracts and lower pharyngeal plates. The
number of teeth along the posterior margin and median
axis of the occlusal surface was counted. Counts
followed the criteria of Taylor & Miller (1983),
Snoeks (1994), and Chakrabarty (2007). Data on
ecology and distribution were collected during our
field observations and collection trips (2005–2007).
Principal components analysis (PCA) followed by
discriminant function analysis (DFA) were performed
on the morphometric dataset using the software
StatistiXL vers. 1.7. Measurements were subject to
standardization in order to remove the allometry by
effect of size using the equation Ms = Mo (Ls/Lo)b,
where Ms is the standardized measurement, Mo is the
measured character length (mm), Ls is the overall
(arithmetic) mean standard component (SL or HL) for
all individuals from all populations of each taxon, Lo is
the standard component of specimen, and ‘‘b’’ for each
character was estimated using the non-linear equation,
M = aLb as the slope of the regression of log Mo on
log Lo (Elliott et al., 1995; Ruiz-Campos et al., 2003).
In addition, we examined (a) the morphology of
observable characters (i.e., dentition of the oral jaws
and pharyngeal plate, body contour, and fins shapes,
among others); (b) breeding pigmentation [as
observed by Kullander (1996)]; (c) anatomy of the
digestive tract, and (d) ecology.
DNA extraction, PCR amplification,
and sequencing
Genomic DNA was isolated from fin clips using
standard proteinase K and phenol/chloroform extraction
methods (Sambrook et al., 1989) and stored at 4°C. The
DNA from 62 fish, representing all sampling sites
(Table 1 of Supplementary Material 2), was amplified
for the cytochrome c oxidase subunit I gene (Cox1,
585 bp) via polymerase chain reaction (PCR). The
primers used for Cox1 were FISHF1-F 50 TCAAC
CAACCACAAAGACATTGGCAC and FISHR1-R 30
TAGACTTCTGGGTGGCCAAAGAATCA
(Ward
et al., 2005). The amplification process was conducted
under the following temperature conditions: 95°C
(5 min), 35 cycles at 94°C (45 s), 54°C (1 min), 72°C
(90 s), and 72°C (5 min). PCRs were performed in 10-ll
reactions containing 0.4 mM of each primer, 0.2 mM of
each dNTP, 2 mM MgCl2, 1 unit of Taq DNA polymerase (Invitrogen), and 10 ng of template DNA. PCR
products were run on 1.0% agarose gels to confirm
amplification and purified with the EXOSAP-IT PCR
Product Clean-Up (Usb) kit. Both strands were
sequenced on an ABI PRISM 3700 DNA automated
sequencer (Applied Biosystems).
Data analysis
Chromatograms and alignments were visually
checked and verified in MEGA5 (Tamura et al.,
2011). All our phylogenetic inferences were carried
123
Fig. 1 Distribution and sampling localities for Herichthys and Nosferatu new genus
Hydrobiologia
123
Hydrobiologia
out with the Cox1 data fragment, using a separate bestfit model for each codon position by gene. The
evolutionary model of nucleotide substitution was
estimated using an Akaike’s corrected information
criterion (AICc) and a Bayesian information criterion
(BIC), as implemented in the program jModeltest
(Posada, 2008).
Haplotypes from the complete dataset composed of
149 individuals, including 146 ingroup individuals (69
from this study ? 77 sequences from GenBank) and 9
outgroup sequences from GenBank were estimated
using DnaSP 5.0 (Librado & Rozas, 2009). The
haplotypes were constructed excluding sites with
missing data for a total of 352 bp. A median joining
network illustrating haplotype frequencies was generated using NETWORK v 4.5.1.6 (Bandelt et al., 1999).
A phylogenetic hypothesis was constructed under
maximum likelihood (ML) and implemented with
RAXML, which uses a rapid hill-climbing algorithm
(Stamatakis, 2006). The program performs a heuristic
search with a general time-reversible (GTR) model that
allows data partitioning and produces likelihood values
using GTRCAT; a GTR approximation with optimization of individual per-site substitution rates and classification of those individual rates into a certain number
of rate categories. To reconstruct the ML tree, we
selected GTRMIX as a nucleotide substitution model
that makes RAXML perform a tree inference (search
for a good topology) under the GTRCAT model. When
the analysis was completed in the GTRMIX model,
RAXML switched to GTRGAMMA, and evaluated the
final tree topology that yielded stable likelihood values.
We set three codon partitions within Cox1 gene,
performed 100 inferences in each analysis, and found
the best ML tree by comparing final likelihoods among
them. To evaluate the robustness of the internal
branches of the ML tree, 100 bootstrap replications
for the dataset were calculated.
The Bayesian inference (BI) was carried out using
MrBayes version 3.1.2 (Huelsenbeck & Ronquist,
2001) using the best-fit model in BIC by codon
partition. The BI runs were performed using eight
Markov chain Monte Carlo (MCMC), 10 million
generations, sampling every thousands of steps. The
first 1,000 trees were discarded as burn-in. We used the
program Tracer v1. 4 (Rambaut & Drummond, 2007) to
assess run convergence and determine burn-in.
Divergence times among the main mitochondrial
lineages were estimated using a Bayesian-coalescence
approach as implemented in BEAST 1.6.1 (Drummond & Rambaut, 2007). For the analysis, we
considered the mtDNA gene (Cox1) and used the
matrix of 31 haplotypes and 585 bp (Table 2 of
Supplementary Material 2). We applied an uncorrelated lognormal-relaxed molecular clock, using the
SRD06 model of nucleotide substitution partitioning
the nucleotide data by codon position and allowing
third codon positions to differ from the other two in
transition bias, substitution rate, and shape of the
gamma distribution of rate heterogeneity (Shapiro
et al., 2006). Due to the absence of fossil records or
geological data, the age estimates were calibrated
using an uniform prior distribution for the mean rate
parameter, with a mean mutation rate of 0.8%/Mya
and lower and upper values of 0.5–1.2%/Mya with a
lower and upper values of 0.5–1.2% per million years
based on what has been reported in other freshwater
fish fauna for mitochondrial loci (Murphy et al., 1999;
Mateos et al., 2002; Perdices et al., 2002, 2005;
Doadrio & Dominguez, 2004; Doadrio & Perdices,
2005; Concheiro-Pérez et al., 2006; Hrbek et al., 2007;
Ornelas-Garcı́a et al., 2008).
A MCMC test was run for 30 million generations to
optimize the scale factors of the priori function. The
final MCMC chain was run twice for 20 million
generations sampled every 2,000 generations. We
checked for burn-in, convergence, and stationarity of
the different analyses in Tracer 1.5. Measures of
effective sample sizes (ESS) were used to determine
the statistical significance of each parameter, where in
most cases, it was determined to be higher than 200.
Finally, we used the combined results in the BEAST
module Log Combiner 1.6.1 after burn-in.
Historical demography
Patterns of historical demography were inferred from
estimates of the effective population size over time
using the Bayesian Skyline Plot (BSP) method, as
implemented in BEAST v. 1.5.4 (Drummond &
Rambaut, 2007). This method estimates a distribution
of effective population sizes through time via MCMC
procedures, by moving backward until the time of the
most recent common ancestor is reached. We applied
ten grouped coalescent intervals (m), and priors for the
phylogenetic model. We used the HKY ? C model
rate heterogeneity across all branches, partitioning by
codon positions, separating third from first and second
123
Hydrobiologia
6.000
PC2 12.45%
4.000
Herichthys
Nosferatu
2.000
0.000
-2.000
-4.000
-6.000
-8.000
-10.000
-5.000
0.000
5.000
10.000
PC1 41.02%
Fig. 2 Plot of scores on the first morphometric principal
component and the second morphometric principal component
of pooled material of Herichthys and Nosferatu new genus
positions, assuming a strict molecular clock, and using
an uniform rate with an initial value of 0.8% mutation rate per My, with lower and upper intervals of
0.5–1.2%, respectively (Doadrio & Perdices, 2005;
Concheiro-Pérez et al., 2006; Ornelas-Garcı́a et al.,
2008). Markov chains were run for 10 million generations and were sampled every 1,000 generations, with
10% of the initial samples discarded as burn-in.
Results
Morphological analysis
In the pooled PC analysis of 42 standardized morphometric variables obtained of 279 specimens of true
Herichthys, plus 95 specimens of Nosferatu new genus
excluding N. bartoni, N. steindachneri, and H. minckleyi, the plot of scores on PC1 against PC2 (which
explains 44.34% of the total variation in shape among
the specimens) provided good separation between the
two clusters of points, each corresponding to specimens
of Herichthys and of Nosferatu new genus (Fig. 2;
Supplementary Material 1). Pelvic fin base, pectoral fin
base, body depth, and HL were the variables that most
contributed to the variance in PC1. Jaw length, distance
from dorsal fin origin to anal fin origin, distance from
anal fin origin to hypural base, and anal fin base most
contributed to the variance in PC2 (Table 1). Furthermore DFA of the morphometric database correctly
classified 99% of Herichthys and 100% of Nosferatu
123
new genus (Table 2), clearly supporting the morphological separation of the two.
In the pooled PC analysis of the standardized
morphometric dataset of H. cyanoguttatus, H. teporatus,
and H. carpintis, the plot of scores on PC1 against PC2
(which explains 41.21% of the total variation in shape
among the specimens) provided rough separation
between H. cyanoguttatus and H. carpintis, but H. teporatus overlapped with both species (Fig. 3). Snout
width, distance from dorsal fin origin to anal fin origin,
distance from rostral tip to anal fin origin, and predorsal
distance were the variables that most contributed to the
variance in PC1. Interorbital width, snout length,
distance from rostral tip to pectoral fin origin and body
depth most contributed to the variance in PC2 (Table 3).
In the pooled PC analysis of the standardized
morphometric dataset of H. carpintis, H. tepehua n.
sp., and H. deppii, the plot of scores on PC1 against
PC2 (which explains 47.88% of the total variation in
shape among the specimens) provided good separation
between H. carpintis and H. deppii, but H. tepehua
n. sp. formed a cluster that overlapped with the other
two (Fig. 4). Distance from rostral tip to anal fin origin,
eye diameter, distance from dorsal fin origin to anal fin
origin, and cheek depth were the variables that
most contributed to the variance in PC1. Body depth,
distance from rostral tip to pectoral fin origin, anal fin
base, and distance from anal fin origin to hypural base
most contributed to the variance in PC2 (Table 4).
Further, DFA for the pooled morphometric database
of H. deppii, H. tepehua n. sp., H. carpintis, H. tamasopoensis, H. teporatus, and H. cyanoguttatus provided
good separation between H. deppii and H. tepehua n.
sp., placing them phenetically closer to each other in the
upper-right quadrant of the discriminant plot, and more
distant from H. carpintis and H. tamasopoensis
(grouped separate in the left quadrants of the discriminant plot) and from H. cyanoguttatus and H. teporatus
(grouped separate in the lower quadrants of the
discriminant plot) (Fig. 5).
Morphological results also supported the separation
of true Herichthys into three distinct geomorphological groups: the solid-colored Herichthys found south
of Sierra Tantima (i.e., H. deppii and H. tepehua n.
sp.); the iridescent pearl marked Herichthys found in
the Pánuco Basin (i.e., H. carpintis and H. tamasopoensis); and the iridescent pearl marked Herichthys
found north of Sierra de Tamaulipas (i.e., H. teporatus
and H. cyanoguttatus) (Fig. 5).
Hydrobiologia
Table 1 Component loadings on the first seven principal components of the pooled morphometric data for Herichthys (n = 279)
and Nosferatu (n = 95)
Variable
PC 1
Body depth
-0.178
0.293
HL
0.204
0.116
Dorsal fin base
0.067
0.412
-0.163
0.153
Predorsal distance
0.205
Rostral tip–anal fin origin
0.241
Anal fin base
PC 2
PC 3
PC 4
PC 5
-0.104
-0.093
0.022
0.033
0.370
0.001
-0.086
0.003
0.014
-0.139
-0.019
0.023
0.049
0.074
-0.176
0.334
-0.178
0.030
-0.013
0.183
0.230
-0.049
0.056
0.143
0.013
0.232
0.002
-0.112
0.120
0.124
0.058
0.135
PC 6
PC 7
Rostral tip–pectoral fin origin
0.047
0.063
0.523
0.051
-0.029
0.032
-0.242
Rostral tip–ventral fin origin
0.206
0.227
0.208
0.079
-0.036
0.193
0.011
Caudal peduncle length
0.107
-0.078
0.150
0.208
0.314
-0.407
0.090
Caudal peduncle depth
-0.151
0.144
0.125
0.238
-0.035
0.020
0.035
Postdorsal distance
-0.024
0.041
0.271
0.182
0.100
0.084
0.380
Dorsal fin origin–anal fin origin
-0.274
0.090
0.114
-0.080
-0.079
-0.059
0.035
Post dorsal fin base–anal fin origin
-0.185
0.199
-0.058
0.232
-0.118
-0.051
0.140
Dorsl fin origin–post anal fin base
-0.198
0.222
0.003
0.064
-0.123
-0.008
0.039
Dorsal fin origin–post anal fin base
Post-dorsal fin origin–post anal fin base
-0.169
-0.187
0.186
0.200
0.081
0.191
0.175
-0.122
0.057
-0.093
-0.173
0.074
0.002
0.032
Postdorsal fin base–hypural base
0.082
0.015
0.083
0.182
0.390
-0.431
-0.049
Anal fin origin–hypural base
0.134
0.263
-0.185
0.342
0.028
-0.047
0.123
Anal fin origin–pelvic fin origin
-0.038
0.075
0.010
-0.425
0.210
0.012
-0.065
Pelvic fin origin–pectoral fin origin
-0.157
0.238
0.063
-0.203
-0.030
-0.039
-0.252
0.161
0.238
-0.263
-0.082
0.219
0.088
0.173
Interorbital width
-0.220
0.094
-0.134
-0.144
0.035
0.013
0.024
Snout length
-0.122
-0.136
-0.114
0.185
0.218
0.283
-0.037
0.069
-0.082
-0.030
0.233
0.172
0.448
0.012
Premaxillary pedicel length
-0.057
-0.022
0.103
0.169
0.244
0.412
-0.332
Cheek depth
-0.229
-0.122
0.123
0.113
0.018
0.133
-0.021
Eye diameter
0.175
0.207
-0.041
-0.137
0.310
0.017
-0.060
Lachrymal depth
-0.198
-0.067
0.104
0.103
0.132
-0.074
-0.252
Snout width
-0.251
-0.052
0.081
-0.043
0.177
0.105
0.187
Preorbital width
Snout width across the lachrymal
-0.259
-0.180
0.013
-0.032
-0.098
0.104
0.036
0.032
-0.046
0.069
-0.136
0.258
0.090
0.459
Lower jaw width
-0.208
-0.057
0.119
-0.119
0.295
-0.006
0.121
Pectoral fin base
-0.125
0.172
-0.106
0.082
0.229
-0.138
-0.385
Pelvic fin base
-0.117
0.201
-0.182
0.017
0.172
0.040
-0.209
Cum. %
31.622
44.340
52.107
59.390
65.332
69.792
72.942
Head width
Lower jaw length
Phylogenetic analysis and divergence times
We obtained 31 different haplotypes (24 from the
ingroup and 7 from the outgroup) from a total of 149
Cox1 (585 bp) sequences analyzed (Table 2 of Supplementary Material 2). Significant molecular differences were retrieved between Nosferatu new genus
and true Herichthys in the phylogenetic reconstruction, including 7% mtDNA uncorrected divergence
(Table 5) between the two taxa (Fig. 6). Moreover, we
found similar topologies between the ML and BI trees.
However, a few inconsistencies were detected in true
Herichthys. While in the BI analysis, the most basal
node was haplotype 4, shared by H. deppii and
123
Hydrobiologia
Table 2 Classification rate (CDA) with holdout showing the split between Herichthys and Nosferatu new genus
Act. group
Pred. group (std)
Herichthys
Herichthys
Nosferatu
Nosferatu
4
0.99
0
95
1.000
0.99
95
1.000
0.99
4.000
2.000
PC2 11.09%
275
3
0
6.000
0.000
-2.000
-4.000
-6.000
H. cyanoguttatus
H. teporatus
-8.000
H. carpintis
-5.000
0.000
5.000
10.000
PC1 38.48%
Fig. 3 Plot of scores on the first morphometric principal
component and the second morphometric principal component
of pooled material of Herichthys cyanoguttatus, H. teporatus,
and H. carpintis
H. teporatus, in the ML topology, the most basal node
corresponded to haplotype 8, shared by H. tepehua n.
sp., H. tamasopoensis, and one specimen of N. panctostictus (possibly a hybrid) (for hybrids N. pantostictus 9 H. carpintis see Supplementary Material 3).
Still, a different relationship was found using the
Bayesian-coalescence approach (implemented in
BEAST), which resulted in H. carpintis as the most
basal species in true Herichthys. Despite these inconsistencies, we retrieved highly consistent biogeographic and taxonomic patterns in our phylogenetic
and demographic reconstructions.
The estimated age for the analyzed ingroup
(Herichthys ? Nosferatu new genus) is about 7 Mya
(*5 to 11 Mya 95% HPD, Fig. 7). This initial
divergence was followed by the separation between
both genera about 5 Mya (3–8 Mya 95% HPD).
123
Pred. group (holdout)
276
Overall correct class. rate
-10.000
-10.000
Correctly
classified
Herichthys
Nosferatu
Correctly
classified
0.99
However, despite their ancient origins, intra-diversification processes within both genera were recovered
as more recent.
By comparison with true Herichthys, we found high
levels of intrageneric divergence and structure within
Nosferatu new genus, from which the bartoni clade
(conformed by N. bartoni ? N. labridens) was the
first group to diverge during the Miocene (*3 Mya,
1.5–4.7 Mya, 95% HPD, Fig. 7). However, we also
recovered the timing of cladogenetic events within the
bartoni clade as very recent (\1 Mya). This recent
divergence is evidenced by the low within-species
divergence values (0.24 ± 0.1 uncorrected p distances) in N. bartoni, sharing haplotypes with sympatric N. labridens (i.e., haplotype 14, Supplementary
Material 4).
We retrieved two additional clades within Nosferatu
new genus: the pantostictus and the steindachneri clades.
The monophyletic pantostictus clade is composed of one
nominal species, H. pantostictus, which has both the
widest distribution range and the highest number of
haplotypes (5) within the genus. (Table 3 of Supplementary Material 2; Supplementary Materials 4 and 5).
Divergence between pantostictus and steindachneri
clades occurred shortly after the separation of the bartoni
clade (*2 Mya, 1–3 Mya, 95% HPD, Fig. 7).
The steindachneri clade is the most morphologically diverse within Nosferatu new genus. It is
composed of three nominal species: N. pame, N. pratinus, and N. steindachneri. The clade also exhibited the
highest internal levels of differentiation (Fig. 6) (i.e.,
Dp = *4.5, *4.12, and *2.83%) between N. pratinus and N. bartoni, N. labridens, and N. pantostictus,
respectively (Table 5).
True Herichthys presented a lower ingroup divergence compared to Nosferatu new genus (Dp = 0.75 ±
0.74 vs. 2.01 ± 1.86, respectively, Table 6); phylogenetic reconstructions exhibited poor resolution, and no
species were recovered as monophyletic (Fig. 6).
Hydrobiologia
Table 3 Component loadings on the first eight principal components of the pooled morphometric data for Herichthys cyanoguttatus
(n = 74), H. teporatus (n = 35), and H. carpintis (n = 67)
Variable
PC 1
Body depth
-0.182
0.302
0.052
-0.057
0.253
0.030
0.069
HL
0.196
0.270
-0.199
-0.190
0.001
-0.041
-0.018
0.157
Dorsal fin base
0.202
0.256
0.134
0.082
0.074
-0.004
0.134
-0.138
0.109
Anal fin base
PC 2
PC 3
PC 4
PC 5
PC 6
PC 7
PC 8
0.017
-0.122
0.131
0.406
0.053
-0.078
-0.046
-0.001
Predorsal distance
0.184
0.272
-0.111
-0.037
0.222
-0.042
0.050
0.242
Rostral tip–anal fin origin
0.290
0.134
-0.086
0.052
0.183
-0.036
0.073
-0.010
Rostral tip–pectoral fin origin
0.053
0.296
-0.254
-0.156
-0.215
-0.095
-0.039
0.236
Rostral tip–ventral fin origin
0.218
0.283
-0.044
-0.078
0.097
-0.121
-0.039
0.080
Caudal peduncle length
0.028
0.117
-0.178
0.239
-0.246
0.264
-0.289
-0.169
Caudal peduncle depth
-0.093
0.254
0.074
0.056
-0.082
0.014
0.043
0.160
Postdorsal distance
-0.067
0.209
-0.168
-0.100
-0.094
-0.161
-0.338
-0.221
Dorsal fin origin–anal fin origin
-0.275
0.172
-0.045
-0.088
0.026
0.124
0.078
-0.034
Post dorsal fin base–anal fin origin
-0.132
0.232
0.249
0.024
0.000
0.003
-0.051
-0.154
Dorsal fin origin–post anal fin base
-0.111
0.226
0.124
-0.123
-0.146
-0.102
0.329
-0.374
Post-dorsal fin origin–post anal fin base
Dorsal fin origin–pectoral fin origin
-0.087
-0.211
0.248
0.272
0.118
0.017
0.173
-0.111
-0.039
0.190
0.163
0.084
-0.070
0.039
-0.132
0.065
Postdorsal fin base–hypural base
0.084
0.159
-0.121
0.295
-0.195
0.313
-0.290
0.060
Anal fin origin–hypural base
0.161
0.219
0.319
0.168
0.022
-0.011
-0.193
-0.041
Anal fin origin–pelvic fin origin
0.067
0.020
-0.224
0.183
0.133
0.194
0.475
-0.119
-0.088
0.072
-0.057
-0.108
0.051
0.375
0.233
-0.094
0.237
-0.001
0.087
0.277
0.281
-0.005
0.007
-0.101
Interorbital width
-0.164
-0.062
0.060
0.140
0.388
0.194
-0.190
0.402
Snout length
-0.160
-0.010
0.075
0.242
0.181
-0.191
-0.021
0.254
0.038
0.003
-0.043
0.191
0.070
-0.550
0.070
-0.052
Premaxillary pedicel length
-0.069
0.102
-0.210
0.170
-0.092
-0.282
-0.004
0.009
Cheek depth
-0.265
0.043
-0.006
-0.037
0.009
-0.231
-0.043
-0.001
Eye diameter
0.257
-0.007
-0.200
0.179
0.037
0.030
0.136
-0.003
Lachrymal depth
-0.185
0.029
-0.084
0.103
-0.316
-0.087
0.088
0.256
Snout width
-0.254
0.023
-0.202
0.129
0.112
-0.047
0.027
-0.116
Preorbital width
Snout width across the lachrymal
-0.265
-0.171
0.000
0.022
-0.083
-0.285
0.093
0.072
0.155
0.244
0.050
-0.034
0.051
-0.116
0.032
-0.236
Lower jaw width
-0.185
-0.002
-0.320
0.162
0.070
-0.036
-0.065
-0.079
Pelvic fin origin–pectoral fin origin
Head width
Lower jaw length
Pectoral fin base
-0.064
0.067
0.004
0.354
-0.339
0.026
0.387
0.290
Pelvic fin base
-0.012
0.003
0.138
0.418
0.001
-0.105
-0.030
-0.202
Cum. %
27.543
41.212
50.121
56.240
60.875
65.120
69.096
72.362
Moreover, we recovered true Herichthys as young in
comparison to Nosferatu new genus (*1 Mya,
0.5–2 Mya, 95% HPD, Fig. 7).
Despite low phylogenetic resolutions, the highest
levels of differentiation corresponded to H. deppii,
which had the highest levels of divergence with
respect to H. carpintis, H. tamasopoensis, and
H. cyanoguttatus (Dp = 1.65 ± 1.11, 1.60 ± 0.98,
and 1.43 ± 0.86, respectively, Table 7).
Haplotype distribution exhibited a gradual transition in haplotype frequencies in true Herichthys.
H. deppii, and H. tepehua n. sp. shared the least
number of haplotypes with the other species (Supplementary Materials 4 and 5). Nonetheless, similarly to
123
PC2 10.64%
Hydrobiologia
6.000
H. carpintis
5.000
H. tepehua
4.000
H. deppii
3.000
2.000
1.000
0.000
-1.000
-2.000
-3.000
-4.000
-5.000
-10.000
-5.000
0.000
5.000
10.000
PC1 45.08%
Fig. 4 Plot of scores on the first morphometric principal
component and the second morphometric principal component
of pooled material of Herichthys carpintis, H. tepehua, and
H. deppii
Nosferatu new genus, the highest haplotype diversity
was found in the Rı́o Pánuco Basin.
Evaluation of demographic history within true
Herichthys detected a pattern of contraction during
the lower Pleistocene (Supplementary Material 6).
Systematic section
The list of nominal species currently included in
Herichthys is as follows: In the ‘‘labridens assemblage’’ = Nosferatu new genus (De la Maza-Benignos & Lozano-Vilano, 2013), Nosferatu bartoni
(Bean, 1892), N. steindachneri (Jordan & Snyder,
1899), N. pantostictus (Taylor & Miller, 1983),
N. labridens (Pellegrin, 1903), N. pame (De la
Maza-Benignos & Lozano-Vilano, 2013), N. pratinus
(De la Maza-Benignos & Lozano-Vilano, 2013), and
N. molango (De la Maza-Benignos & Lozano-Vilano,
2013); and in the ‘‘cyanoguttatus assemblage’’ =
Herichthys [we follow Kullander (2003) and Eschmeyer (2013)]: H. deppii (Heckel, 1840), H. carpintis
(Jordan & Snyder, 1899), H. tamasopoensis, ArtigasAzas, 1993, H. cyanoguttatus, Baird & Girard, 1854,
and H. minckleyi (Kornfield & Taylor, 1983).
Nosferatu new genus
(Tables 4 and 5 of Supplementary Material 2; Figs. 8,
9, and 10)
Type species Nosferatu pame, by original
designation.
123
Diagnosis Differs from Herichthys by the following
measurements: shallower body (mean 41%, SD 2% vs.
mean 45%, SD 2%); shorter dorsal fin base (mean
55%, SD 2% vs. mean 58%, SD 2%), shorter anal fin
base (mean 22%, SD 2% vs. mean 24%, SD 2%);
shorter dorsal fin origin to anal fin origin (mean 51%,
SD 3% vs. 55%, SD 2%); shorter post dorsal fin base to
anal fin origin (mean 33%, SD 3% vs. 36%, SD 3%);
shorter dorsal fin origin to post anal fin base (mean
61%, SD 3% vs. mean 65%, SD 3%); shorter dorsal fin
origin to pectoral fin origin (mean 27%, SD 2% vs.
mean 29%, SD 2%); shorter anal fin origin to pelvic fin
origin (mean 28%, SD 2% vs. mean 30%, SD 2%), and
shorter pelvic fin origin to pectoral fin origin (mean
16%, SD 1% vs. mean 28%, SD 3%), all in SL.
Narrower interorbital width (mean 26%, SD 3% vs.
mean 29%, SD 3%); longer lower jaw (mean 33%, SD
2% vs. mean 31%, SD 2%); narrower snout (mean
32%, SD 3% vs. mean 35%, SD 3%); narrower width
at preorbital (mean 27%, SD 3% vs. mean 31%, SD
3%); shorter pectoral fin base (mean 21%, SD 2% vs.
mean 23%, SD 2%); and shorter pelvic fin base (mean
11%, SD 1% vs. mean 13%, SD 2%), all in HL.
Depressed dorsal fin rarely expands beyond the
anterior third of the caudal fin. An elongated, elastic,
smooth caecum (not present in Herichthys) is adhered
to a saccular stomach. Genus is distinguished from
most other Heroine genera by the following synapomorphies: Breeding pigmentation that consists of
darkening of the ventral area, extending over nostrils,
opercular series, or pectoral fins. All have red or purple
marks in the axil of the pectoral fin, except for
N. bartoni. Anterior teeth regularly set, well-spaced,
conic, unicuspid, strongly recurved, and pointed, with
erect implantation; with transition to prolongation in
the size of the symphysial pair of teeth relative to that
of the other teeth in the outer row of the upper jaw,
reminiscent of those in the vampire Nosferatu
(herein = nosferatuform teeth); and a less developed
pair in the lower jaw (Figs. 9, 10). Posterior teeth
small and pointed, none or few posterior rows of
diminutive teeth in the upper jaw; teeth in the jaws are
conical, recurved, well-spaced, and pointed; frontal
anterior row regularly set and lateroposterior anterior
row irregularly set, recurved, and pointed (frequently
worn in older specimens).
Description Body elongated and slender, depth
36–45% (mean 41%, SD 2%); scales ctenoid. dorsal
fin base short 48–60% (mean 55%, SD 2%); anal fin
Hydrobiologia
Table 4 Component loadings on the first seven principal components of the pooled morphometric data for Herichthys carpintis
(n = 67), H. tepehua n. sp. (n = 60), and H. deppii (n = 27)
Variable
Body depth
PC 1
PC 2
PC 3
PC 4
PC 5
PC 6
0.133
-0.081
0.378
0.247
0.003
HL
-0.200
-0.155
0.333
-0.069
-0.048
0.104
0.007
Dorsal fin base
-0.190
0.223
0.159
0.255
0.044
-0.039
-0.116
-0.022
Anal fin base
0.150
PC 7
0.096
0.158
0.327
0.025
0.003
-0.238
0.136
Predorsal distance
-0.235
-0.075
0.132
0.098
-0.019
0.088
0.140
Rostral tip–anal fin origin
-0.262
0.034
0.111
0.166
0.108
-0.068
-0.046
Rostral tip–pectoral fin origin
-0.016
-0.251
0.342
-0.304
0.096
0.089
0.046
Rostral tip–ventral fin origin
-0.224
0.051
0.279
0.033
0.066
0.128
0.076
Caudal peduncle length
0.060
0.116
0.069
-0.288
-0.109
-0.463
0.193
Caudal peduncle depth
0.183
0.130
0.299
0.084
-0.002
-0.075
-0.034
Postdorsal distance
0.065
0.067
0.114
-0.261
0.216
0.052
-0.079
Dorsal fin origin–anal fin origin
0.246
-0.138
0.139
0.094
0.055
0.032
-0.107
Post dorsal fin base–anal fin origin
0.214
0.226
0.125
0.120
-0.227
0.083
-0.011
Dorsal fin origin–post anal fin base
0.213
0.160
0.189
0.191
-0.035
0.059
-0.177
Post-dorsal fin origin–post anal fin base
Dorsal fin origin–pectoral fin origin
0.205
0.143
0.116
-0.182
0.263
0.229
0.100
0.076
-0.063
0.038
-0.143
0.011
-0.141
0.124
0.032
0.172
0.118
-0.207
0.097
-0.487
0.092
Anal fin origin–hypural base
Postdorsal fin base–hypural base
-0.087
0.416
0.059
0.034
-0.214
-0.011
0.146
Anal fin origin–pelvic fin origin
-0.100
-0.230
0.002
0.269
0.280
-0.230
-0.325
0.041
-0.090
0.195
-0.073
-0.227
-0.165
0.262
-0.218
0.178
-0.046
0.227
0.094
-0.148
0.057
0.182
-0.055
-0.121
0.354
0.066
-0.057
0.049
0.178
0.102
-0.292
0.108
0.040
0.134
0.164
-0.034
0.190
0.123
-0.068
0.390
0.279
0.197
Pelvic fin origin–pectoral fin origin
Head width
Interorbital width
Snout length
Lower jaw length
Premaxillary pedicel length
0.075
0.138
-0.022
-0.091
0.380
0.163
0.349
Cheek depth
0.226
0.012
-0.010
-0.154
0.039
0.217
-0.009
Eye diameter
-0.215
0.083
0.015
0.074
0.135
-0.192
0.169
Lachrymal depth
0.195
0.037
-0.056
-0.242
0.089
0.021
-0.252
Snout width
0.236
-0.096
0.020
0.070
0.053
-0.044
0.162
Preorbital width
Snout width across the lachrymal
0.221
0.152
-0.075
-0.188
-0.043
0.044
0.145
0.161
0.151
-0.047
-0.131
-0.219
0.003
0.211
Lower jaw width
0.190
-0.179
-0.072
0.047
0.177
-0.125
0.259
Pectoral fin base
0.095
0.217
0.099
-0.145
0.345
-0.152
-0.397
Pelvic fin base
0.060
0.250
-0.032
0.140
0.304
-0.018
Cum. %
36.17
47.88
base short 19–27% (mean 22%, SD 2%); origin of
dorsal fin base to origin of anal fin base 45–55% (mean
51%, SD 3%), all of SL; preorbital width slender
18–34% (mean 27%, SD 3%) of HL. Dorsal fin
XV–XVIII (mode XVI, freq 60%), 9–12 (mode 11,
freq 48%); anal fin III–VII (mode V, freq 62%), 8–10
(mode 8, freq 62%); pectoral fin rays 13–16 (mode 15,
freq 65%); scales ctenoid, longitudinal series 28–34
54.87
61.36
66.19
70.43
0.199
73.77
(mode 30, freq 37%). Markings consist of irregular
variegating patterns along the flanks that range from a
faint discontinuous horizontal stripe to 3–5 irregularly
constituted blotches. Breeding pigmentation dark on
anterioventral half over nostrils, opercular series and
pectoral fins, as well as big portions of posterior half,
almost imperceptible in N. stendachneri; anterior teeth
well-spaced conic-unicuspid, acutely pointed, slightly
123
Hydrobiologia
Fig. 5 Graphical
representation of canonical
discriminant functions
analysis using grouping
discriminant analysis
(GDA) of species in
Herichthys on the basis of 42
morphometric characters
Discriminant Plot
H. carpintis
H. cyanoguttatus
H. deppii
South of Sierra de Tantima
Geomorphological Group
5
H. tamasopoensis
H. tepehua
4
H. teporatus
3
Río Pánuco
Geomorphological
Group
Funct 2 (24.1%)
2
1
0
-1
-2
-3
-4
North of Sierra de Tamaulipas
Geomorphological Group
-5
-10
-5
0
5
10
Funct 1 (47.4%)
Table 5 Inter-generic COI–I genetic divergence (p = non-corrected distances) between Nosferatu and Herichthys
Herichthys
Nosferatu
Paraneetroplus
Herichthys
000.75 ± 000.74
Nosferatus
007.04 ± 001.13
002.01 ± 001.86
Paraneetroplus
008.64 ± 001.06
008.78 ± 000.44
006.97 ± 002.67
Vieja
009.09 ± 001.05
009.32 ± 000.56
005.32 ± 003.40
to strongly recurved, differentiated in length in upper
and lower jaws: a short symphysial pair of teeth in the
lower jaw, whereas an enlarged symphysial pair of
fangs on the premaxillae flanked by shorter caniniform
teeth on each side; posterior teeth diminutive; few
posterior rows or none in upper jaw. Depressed dorsal
fin short; point rarely expands beyond anterior third of
caudal fin. Robust-walled stomach is saccular rugged
with longitudinal folds walls and adhered at its anterodorsal section to an elongated elastic smooth caecum.
Etymology Masculine, proper name. The name
refers to the pair of well-developed recurved fangs in
123
Vieja
004.59 ± 003.33
Fig. 6 Phylogenetic tree derived from the ML and BI analysis
of a fragment of Cox1 (585 bp) mitochondrial data of Herichthys
and Nosferatu new genus (scientific names of the outgroup c
species are reported as they appear in genebank)
the upper jaw present in all species of the genus,
reminiscent of those in Marnau’s vampire Nosferatu.
Geographical distribution Atlantic slope in Veracruz, Hidalgo, Querétaro, and Tamaulipas in the
Pánuco-Tamesı́ River Basin; lagoon systems of San
Andrés, including the Rı́o Tigre and Tamiahua system
and its tributaries, the Cucharas and Naranjos rivers.
50/-/0.99
H29. Vieja argentea
H25. Vieja regani
100/-/-
60/-/-
H28. Vieja synspila
Vieja melanura
H30. Paraneetroplus sysnpilus
9 6 /93/ 1
H27. Vieja bifasciata
Nosferatu new genus
H31. Paraneetroplus fenestratus
95/100/1
true Herichthys genus
Clade Bartoni
0.02
PhyML/RaxML/BI
9 6/96/1
H15. H. carpintis (Guayalejo)
H17. H. carpintis (Guayalejo)
H9. H. carpintis (Guayalejo/El Salto/Media Luna/Tamiahua)
H. tamasopoensis (Tamasopo)
H. tepehua (Tenixtepec)
H. cyanoguttatus (San Fernando/San Juan)
99/99/1
H7. N. pame (Tamasopo)
H24. N. steindachneri (Tamasopo)
H5. N. pratinus (El Salto)
H23. N. steindachneri (Tamasopo)
H6. N. pame (Tamasopo)
N. steindachneri (Tamasopo)
N. pratinus (El Salto)
H13. N. bartoni (Los Anteojos)
H12. N. bartoni (Los Anteojos)
H14. N. bartoni (Los Anteojos)
N. labridens (Media Luna)
Hap26. Vieja heterospila
Paraneetroplus maculicauda
100/100/1
H22. N. pantostictus (Mante)
H19. N. pantostictus (Axtla/Tamiahua)
H21. N. pantostictus (Guayalejo)
H20. N. pantostictus (Guayalejo)
H18. N. pantostictus (Huazalingo/Axtla/Jaumave/Guayalejo/Mante/Tamiahua)
62/-/0.95
61/62/0.83
89/93/1
Clade Pantostictus
82/87/1
H10. H. carpintis (El Salto)
H. teporatus (Soto la Marina)
H. tepehua (Tenixtepec)
H. cyanoguttatus (Lampazos/San Marcos)
H16 H. carpintis (Lower Pánuco)
H4. H. deppii (Nautla/Misantla)
H. teporatus (Soto la Marina)
H11. H. carpintis (Tamiahua)
-/-/1
H3. H. deppii (Nautla)
H. tepehua (Pantepec/Tenixtepec/Tecolutla/Cazones)
H1. H. tepehua (Pantepec/Tenixtepec)
H. cyanoguttatus (San Juan)
H2. H. deppii (Nautla-Zanjas de arena)
H. tepehua (Solteros)
H8. H. tepehua (Tenixtepec)
H. tamasopoensis (Tamasopo)
H. pantostictus* (Mante)
Clade Steindachneri
99/99/-
-/57/-
77/88/0.99
54/60/-
Hydrobiologia
123
Hydrobiologia
123
Hydrobiologia
b Fig. 7
Ultrametric tree based on a fragment of Cox1
mitochondrial gene, uncorrelated lognormal relaxed molecular
clock, using the SRD06 model of nucleotide substitution
partitioning the nucleotide data by codon position. Mean of
divergence time with highest posterior density intervals [in
brackets 95%] for each divergence time is annotated in the main
nodes. Scale is in millions of years
both nuclear and mitochondrial markers are required.
We detected 14 Cox1 haplotypes exclusive to the
genus: H5, H6, H7, H12, H13, H14, H18, H19, H20,
H21, H22, H23, H24, and H26 (Table 3 of Supplementary Material 2, and Supplementary Material 7).
Herichthys Baird & Girard, 1854
Species composition Seven species: Nosferatu
molango, N. pame, N. pratinus, N. bartoni, N. labridens, N. pantostictus, and N. steindachneri.
Remarks Our morphologic analysis supports Nosferatu as different from Herichthys. Our mitochondrial
DNA analysis also recovered Nosferatu as monophyletic, and sister to Herichthys; average Dp = 7.0%,
thus separating both genera in evolutionary terms,
which is slightly higher than the divergence (5.32%)
recovered between Paraneetroplus and Vieja. Our
results concur with mtcytb analyses by Hulsey et al.
(2004), Concheiro-Pérez et al. (2006), and LópezFernández et al. (2010) that registered 7.0% average
non-parametric rate smoothing (NPRS) divergence
between Nosferatu new genus and true Herichthys.
Our findings are also in agreement with De la MazaBenignos & Lozano-Vilano (2013) whereby Nosferatu new genus corresponds to the ‘‘labridens assemblage.’’ In addition, our analysis recovered three
monophyletic sister groups within Nosferatu new
genus: the ‘‘bartoni clade’’ conformed by N. labridens
and N. bartoni of the Media Luna and the upper Rı́o
Verde; the ‘‘pantostictus clade’’ conformed by the
polymorphic N. pantostictus; and the ‘‘steindachneri
clade’’ conformed by N. steindachneri, N. pame, and
N. pratinus. In the preliminary analysis, we recovered
haplotypes from N. molango (1) within the true
Herichthys group. We hypothesize that our preliminary finding could correspond to a pattern of recent
introgression. The Lago Azteca is remote and isolated,
and N. molango is the only native cichlid found
therein. Further studies in order to clarify the evolutionary history of N molango using a combination of
(Tables 4 and 5 of Supplementary Material 2; Figs. 8,
9, and 10)
Type species Herichthys cyanoguttatus Baird &
Girard, 1854.
Diagnosis Differs from Nosferatu new genus in that
the red/purple mark on the axil of the pectoral fin is
absent, and depressed dorsal fin reaches past the
frontal third of caudal fin (for comparative morphometrics, see Nosferatu new genus in the previous
section). Genus is distinguished from most other
Heroine genera by the following synapomorphies: Six
to seven vertical flank bars bearing a series of dark
blotches below the lateral line that make up the
principal markings. Breeding pigmentation consists of
darkening of posterior half and anterioventral areas
that do not extend over the nostrils, opercular series,
and pectoral fins. Anterior teeth are closely spaced,
spatulate, chisel-like, bicuspid or weakly bicuspid, or a
mixture of bicuspid and bluntly pointed conical, with
straight curvature, undifferentiated in length in upper
and lower jaws (Figs. 9, 10), except in H. minckleyi.
Description Body depth 40–51% (mean 45%, SD
2%), scales ctenoid. Dorsal fin XIV–XVII (mode XVI,
freq 15%) 9–12 (mode 11, freq 15%); anal fin IV–VII
(mode VI, freq 19%); 6–10 (mode 8, freq 16%);
pectoral rays 13–15 (mode 14, freq 26%). Teeth
spatulate, bicuspid or weakly bicuspid, undifferentiated in length in upper and lower jaw. Soft dorsal fin
and anal fins pointed extending past the frontal third of
the caudal fin.
Geographical distribution Rivers in the Atlantic slope
of Mexico and Texas, north of PDM, including Santa
Table 6 Intergeneric COI–I genetic divergence (p = non-corrected distances) between Nosferatu and Herichthys
Herichthys
Nosferatu
Paraneetroplus
Herichthys
000.75 ± 000.74
Nosferatu
007.04 ± 001.13
002.01 ± 001.86
Paraneetroplus
008.64 ± 001.06
008.78 ± 000.44
006.97 ± 002.67
Vieja
009.09 ± 001.05
009.32 ± 000.56
005.32 ± 003.40
Vieja
004.59 ± 003.33
123
Hydrobiologia
123
000.69 ± 000.92
000.81 ± 000.27
000.93 ± 000.15
001.13 ± 000.46
001.08 ± 000.73
000.70 ± 000.83
000.75 ± 000.68
000.73 ± 000.32
H. tamasopoensis
H. tepehua n. sp.
H. teporatus
000.77 ± 000.56
000.89 ± 000.92
001.60 ± 000.98
001.65 ± 001.11
H. deppii
000.90 ± 000.70
000.46 ± 000.42
000.31 ± 000.38
000.57 ± 000.43
H. carpintis
H. cyanoguttatus
001.43 ± 000.86
000.84 ± 000.70
000.59 ± 000.54
H. tepehua n. sp.
H. tamasopoensis
H. deppii
H. cyanoguttatus
Herichthys deppii (Heckel, 1840).
(Tables 6 and 7 of Supplementary Material 2;
Figs. 8, 10, 11, and 12)
Synonymy Herichthys geddesi (Regan, 1905) and
Heros montezumae (Heckel, 1840).
Holotype Lost (Kullander, 2003; Eschmeyer, 2013).
Neotype Designated due to holotype loss and for the
purpose of clarifying the taxonomic status and type
locality: UANL 20300 (1: 131 mm male) La Palmilla
(Rı́o Bobos), Tlapacoyan, Ver. Lat. 20.0148167, Long.
-97.1418333, masl 137, De la Maza-Benignos, March
20, 2006.
Diagnosis Differs from H. carpintis, H. cyanoguttatus, and H. teporatus in having a longer anal fin base
(mean 27%, SD 2% vs. mean 22, 24 and 25%; SD 1, 2,
and 1%, respectively) and distance from the anal fin
origin to the hypural base (mean 42%, SD 1% vs. mean
36, 38, and 39%; SD 1, 2, and 2%, respectively). Also
differs from other Herichthys in the following autapomorphies: ground color brownish with head area
sometimes bluish-gray when alive and head marked
H. carpintis
South of Sierra de Tantima geomorphological
group
Table 7 Intrageneric COI–I genetic divergence (p = non corrected distances) in Herichthys
Ana, Misantla, Nautla, Solteros, Tecolutla, Tenixtepec,
Cazones, Pantepec, Pánuco, Soto la Marina, San
Fernando, Lower Rı́o Grande; absent in the Rı́o
Conchos, Cuatro Ciénegas, and the Rı́o Nueces in Texas.
Species composition Seven species: H. deppii,
H. tepehua n. sp., H. carpintis, H, tamasopoensis,
H. cyanoguttatus, H. teporatus, and H. minckleyi.
Remarks Our phylogenetic reconstructions exhibited poor resolution among species. None of the
recognized Herichthys species were recovered as
monophyletic. We detected 11 Cox1 haplotypes that
were exclusive to the genus: H1, H2, H3, H4, H8, H9,
H10, H11, H15, H16, and H17.
H. teporatus
b Fig. 8
000.42 ± 000.51
A Herichthys deppii (Rı́o Bobos); B H. deppii (Zanjas
de Arena); C H. tepehua n. sp. (Rı́o Solteros); D H. tepehua n.
sp. (Rı́o Tecolutla); E H. tepehua n. sp. (Rı́o Cazones);
F H. tepehua n. sp. (Rı́o Pantepec); G H. tamasopoensis;
H H. carpintis (Rı́o El Salto); I H. carpintis (Tamiahua);
J H. teporatus; K H. cyanoguttatus (Rı́o San Fernando);
L H. cyanoguttatus (Rı́o Bravo); M H. minckleyi (Cuatro
Ciénegas); N Nosferatu bartoni (Media Luna); O N. labridens
(Media Luna); P N. pratinus (Rı́o El Salto); Q N. pame; R N
steindachneri; S N. pantostictus (Laguna La Puerta); T N. molango (Laguna Azteca); and U N. pantostictus (Arroyo el Tigre)
000.47 ± 000.68
Hydrobiologia
123
Hydrobiologia
Fig. 9 The drawings by Aslam Narváez-Parra depict the anterior teeth of Nosferatu pratinus, N. labridens, N. bartoni, in comparison
to Herichthys carpintis
with conspicuous big round 3–5 mm orange/brown
freckles. Dorsal and ventral contour symmetric and
convex gives fish an elongated, elliptic appearance.
Description Description is based on sexually mature
specimens over 63.6 mm SL. Morphometric and meristic data are summarized in Tables 6 and 7 of Supplementary Material 2. Anal fin base 24–31% (mean 27%,
SD 2%); anal fin origin–hypural base distance 29–44%
(mean 42%, SD 1%). Dorsal fin XVI–XVII (Mode
XVII, freq 67%) 9–12 (Mode 11, freq 39%), anal fin
VI–VII (Mode VI, freq 72%) 7–10 (Mode 8, freq 44%);
dorsal and ventral contour symmetric and convex gives
fish an elongated, elliptic appearance. Nuchal hump
absent in mature males. Teeth spatulate, chisel-like,
bicuspid or weakly bicuspid, undifferentiated in length
123
in upper and lower jaws. Lower pharyngeal plate is stout
and broad; two rows of 9–10 unpigmented molars
increasing caudally in size flank midline; 20–22 conical,
progressively compressed teeth along posterior margin.
Coloration in preservative Light rust-brown; ventral area whitish in some individuals. Fins the same
color as body, except paler, with speckles over soft
areas of dorsal and anal fins.
Live colors Ground color brown, sometimes
splashed with blue-gray over dorsal, caudal, and
central areas of the body. Head dotted with conspicuous, big, round 3–5 mm orange/brown freckles that
vary in number and size. Freckles extend over gill
covers, head, and pectoral fin base. Two to three rows
of freckles form a diagonal with the horizontal that
Hydrobiologia
Fig. 10 The drawings by
Aslam Narváez-Parra depict
the occlusal surface and
caudal aspect of the lower
pharyngeal plates in
Nosferatu bartoni and
N. pratinus, and the occlusal
surface of the lower
pharyngeal plates in
Herichthys tamasopoensis,
H. carpintis,
H. cyanoguttatus,
H. tepehua n. sp., and
H. deppii
Fig. 11 Neotype UANL 20300, Herichthys deppii (Heckel
1840) collected in La Palmilla (Rı́o Bobos), Tlapacoyan, Ver.
(131 mm SL)
extend from the lip fold to the orbit of the eye. Fins the
same color as body with small brown streaks or spots
on the soft ray regions and the caudal fin; pectoral and
pelvic fins opaque.
Geographical distribution Upper Nautla and Misantla Rivers and their tributaries, in the municipalities
of Tlapacoyan and Misantla in the state of Veracruz,
Mexico.
Habitat and associates Herichthys deppii is found
in clear water with current, over sand substrate with
big boulders, between rapids of the upper Nautla and
Misantla Rivers. It shares habitat with Xiphophorus cf.
helleri, Poecilia mexicana, Astyanax mexicanus,
Gobiomorus dormitor, Agonostomus monticola, and
Awaous tajasica. Little is known of its behavior in the
wild. It nests underneath big boulders where it protects
itself and its fry from local fishermen that capture them
year-round using homemade spears.
Vernacular names Nautla cichlid.
Remarks Until the late 1990s, both H. deppii and
H. geddesi were treated as incertae sedis with type
localities in ‘‘Mexico’’ and ‘‘Southern Mexico,’’
respectively. In 2005, Miller et al. noted that Stawikowski & Werner (1998) had retrieved the locality of
H. deppii as Rı́o Misantla, Veracruz. Kullander (2003)
noted that the validity of H. geddesi Regan, 1905
needs further research and its generic allocation was
123
Hydrobiologia
Fig. 13 UANL 20297 Herichthys tepehua n. sp. holotype
collected by Mauricio De la Maza-Benignos in the Rı́o Pantepec
(138.17 mm SL)
Fig. 12 a Top Juvenile of Herichthys deppii collected and
photographed in La Palmilla (Rı́o Bobos), Tlapacoyan, Ver.
(*70 mm TL), Veracruz. b Bottom Drawing of H. geddesi from
(Regan, Pisces, 1906–1908)
uncertain. According to the Natural History Museum
of the London Fish Collection Database (21/12/2004),
syntypes BMNH 1880.4.7.40-45 (6) were collected by
P. Geddes in 1880, in former ‘‘Hacienda del Hobo [sic]
between Veracruz and Tampico, Mexico.’’ The first
step in establishing the identity of H. geddesi was to
determine the exact type locality of the syntypes.
Former ‘‘Hacienda del Jobo’’ is located in the municipality of Tlapacoyan, Veracruz in the Nautla River
Basin. The main compound of Hacienda del Jobo or
San Joaquı́n del Jobo is located in the state of
Veracruz, ‘‘between the city of Veracruz and Tampico.’’ The Hacienda was bought in 1825 by General
Guadalupe Victoria (1786–1843), the first President of
Mexico, sold by his son in 1857 to Rafael Martı́nez de
la Torre, and sold again to Juan B. Diez, in 1878.
Hence, the (6) H. geddesi were collected in the Nautla
River System. Regan’s account (Regan 1905,
1906–1908) mentions its brownish color with the
123
principal markings composed of ‘‘7 or 8 cross-bars
bearing a series of blackish blotches below the lateral
line; vertical fins spotted.’’ His description matches
almost all species in Herichthys. However, the drawing of H. geddesi shown in Plate III, Fig. 4, p. 188 of
Regan (1906–1908) is almost certainly H. deppii
(Fig. 11), hence in our opinion is synonymous to
Heros deppii = Cichlasoma deppii = Herichthys
deppi (Heckel, 1840). Average mitochondrial divergence retrieved between H. deppii and H. carpintis
was Dp = 1.65%. We detected 7 Cox1 haplotypes
among the specimens surveyed, including haplotypes
H1 (*17%), uncommon in H. cyanoguttatus (*6%),
H4 (*22%), uncommon in H. teporatus (*6%), H8
(*4%), very common in H. tamasopoensis, H9
(*4%), very common in H. carpintis, and also shared
with H. tamasopoensis and H. cyanoguttatus, and H10
(*4%), very common in H. cyanoguttatus and less so
in H. carpintis. We also detected haplotypes H2 (3%)
and H3 (9%), representing divergent lineages exclusive to the south of Sierra de Tantima geomorphological group (i.e., H. deppii and H. tepehua n. sp.)
(Supplementary Materials 5 and 7).
Hydrobiologia
Herichthys tepehua n. sp.
(Tables 6 and 7 of Supplementary Material 2; Figs. 8,
10, and 13)
Holotype UANL 20297, adult male, 138.17 mm SL,
Rı́o Pantepec, Salsipuedes, Francisco Z Mena, Puebla,
Mexico, Long. 20.6750833, Lat. -97.8764667, masl
125, M. De La Maza-Benignos (MMB), June 25, 2006.
Paratypes: Pantepec River Basin (54) 47.5–138.17
mm SL: UANL 17490 (17: 73.66–138.17 mm LP) same
data as holotype; UANL 17468 (7: 47.5–97.6 mm LP),
Potrero del Llano, Temapache, Veracruz, Lat.
21.0870410, Long. -97.7548250, 92 masl, Mauricio
De la Maza-Benignos, March 22, 2006; UANL 17403
(10: 53.1–106.6 mm LP), Llano de En medio, Francisco
Z Mena, Puebla, Lat. 20.7663290, Long. -97.8624350,
308 masl, MMB, 20 August, 2005; UANL 17489
(5: 55.1–67.7 mm LP), Llano de En medio, Francisco Z
Mena, Puebla, Lat. 20.7663290, Long. -97.8624350,
308 masl, MMB, June 25, 2006; UANL 17490 (15:
73.66–132.44 mm LP), Salsipuedes, Francisco Z Mena,
Puebla Long. 20.6750833, Lat. -97.8764667, 125 masl,
MMB, June 25, 2006. Cazones River Basin (10) 62.44–
130.55 mm SL: UANL 17409 (9: 62.44–130.55 mm
SL) Zanatepec, Venustiano Carranza, Puebla, Mexico,
Lat. 20.4702330, Long. -97.7584210, masl 389, 1 m
depth, MMB, 27 September, 2005; UANL 9326 (1:
85.85 mm SL), Buena Vista River ±1 km North of
Chicoaloque, Veracruz, H. Obregón (HO), February 10,
1988; Rı́o Solteros (5) 58.5–119.5 mm SL: UANL
17499 (3: 58.5–78.85 mm SL) Solteros River, Veracruz, Mexico, Lat. 20.2647580, Long. -97.0546300
masl 19, MMB, June, 2006; UANL 17454 (2: 102.7–
119.5 mm SL), Solteros River, Veracruz, Mexico Lat.
20.2647580, Long. -97.0546300 masl 19, MMB,
March, 2006; Tecolutla River Basin (9) 63.15–
160 mm SL: UANL 9895 (2: 63.15–138.1 mm SL),
Rı́o Coyutla at the Port, HO, 12 February, 1988; UANL
9865 (5: 70.1–109.8 mm SL), Necaxa River at El
Frijolillo bridge, Veracruz, Mexico, HO, 12 February,
1988; UANL 9797 (1: 106.35 mm SL), Chichicatzapan
River, under the bridge found 2.2 km at the ‘‘5 de
Mayo’’ junction—hnos. Valdez, Veracruz, Mexico,
HO, February 9, 1988; UANL 17450 (1:160 mm SL),
Estero Tlahuanapa, Veracruz, Mexico, lat. 20.3716540,
long. -97.2987560, masl 42, MMB, March 18, 2006.
Rı́o Tenixtepec (15) 51.9–102.09 mm SL: UANL 17447
(15: 51.9–102.09 mm SL), Arroyo Sta. Agueda, Papantla, Veracruz, Mexico, Lat. 20.71566667, Long.
-98.04983333, masl 57, 1 m depth, MMB, March 18,
2006.
Diagnosis Differs from H. deppii in that it has a
longer head (mean 37%, SD 2% vs. mean 35%, SD
1%); shorter distance from the anal fin origin to the
hypural base (mean 39%, SD 2% vs. 42%, SD 1%), all
in SL, a larger eye (mean 26%, SD 3% vs. mean 24%,
SD 2%) in HL. Differs from H. carpintis in that it has a
longer anal fin origin–hypural base distance (mean
39%, SD 2% vs. mean 38%, SD 2%) in SL; deeper
cheeks (mean 32%, SD 4% vs. mean 28%, SD 4%) and
longer snout (mean 39%, SD 4% vs. mean 37%, SD
3%) all in HL. Also differs from other Herichthys in
the following autapomorphies: Two conspicuous blue/
green parallel markings on the sides of the cheeks
extending from the lip fold to the orbit of the eye.
Ground color is blue-green. Shares with H. deppii the
absence of iridescent spots/pearls on the body.
Description Description is based on sexually
mature specimens over 47.5 mm SL of the Rı́o
Pantepec. Morphometric and meristic data are summarized in Tables 6 and 7 of Supplementary Material
2. HL 34–40% (mean 37%, SD 2%); anal fin origin–
hypural base 36–42% (mean 39%, SD 2%). Eyes large
21–32% (mean 25%, SD 3%) in HL. Dorsal fin XV–
XVII (mode XVI, freq 59%) 10–12 (mode 11, freq
48%). Anal fin IV–VI (mode V, freq 67%) 8–10 (mode
8, freq 44%). Predorsal profile curved; frontal profile
concave before the eyes. Teeth spatulate, bicuspid or
weakly bicuspid, undifferentiated in length in upper
and lower jaw. Lower pharyngeal tooth plate moderately stout and broad, two rows of 10–11 pigmented
molars increasing caudally in size and molarization
flank midline; 22–24 conic progressively compressed
teeth along posterior margin. Stomach is saccular with
strong rugged walls (length 22.5% of SL).
Coloration in preservative Color is reddish-brown,
darker above the lateral line; ventral area between
lower jaw and pelvic fin base darker in some
individuals. Six vertical flank bars bearing a series of
dark blotches below the lateral line make the principal
markings.
Live colors Ground color olive-green with Persianblue/green; dorsal and anal fins same color as body.
Dorsal, anal, and caudal fins with teal spots or streaks
randomly distributed. Tips of the dorsal fin rays red in
some individuals; a conspicuous black blotch over the
middle of the dorsal fin may be present in both males
and females. Pectoral fins are opaque; pelvic fins bear
123
Hydrobiologia
longitudinal teal streaks over the ventral portion. Some
have salmon pigmentation on gill covers. Two
conspicuous, distinct blue/green parallel markings on
the sides of the cheeks extend from the lip fold to the
orbit of the eye.
Breeding pigmentation In the aquarium, ground
color changes to pale pink with golden brown
markings on the nuchal area. Six vertical dark bars
contrast pale frontal half; color between bars and tips
of the dorsal rays changes to golden brown. Pelvic fins
dark.
Geographical distribution H. tepehua is found in
the Tuxpan/Pantepec, Cazones, Tecolutla, Tenixtepec, and the Solteros river systems.
Etymology From the Nahuatl language meaning
‘‘the ones who possess the mountains.’’ The name
refers to the remaining, as of the 1990 Mexico census,
10,573 members of the indigenous Tepehua ethnic
group and their language, spoken in eastern Mexico in
the states of Veracruz, Hidalgo, and Puebla.
Allopatric forms Forms of the Cazones, Tenixtepec,
Solteros, and Tecolutla basins differ from the Pantepec
in having ground color aquamarine, except for Tenixtepec, which is brownish and its ventral area whitish.
Dorsal and anal fins are the same color as the body
with mint-green color; variegated markings over the
spiny sections; and golden yellow or mint-green spots
and streaks over the soft rays of the dorsal, anal, and
caudal fins. Pectoral fins are opaque; pelvic fins bear
longitudinal turquoise dots or streaks. Head is marked
with conspicuous variegated wavy, golden yellow
patterns, and freckles over the lachrymal, less conspicuous than in H. deppii that extend onto and around
the orbit of the eye. Dorsal view of head is solidmedium sea green over the premaxillae. Conspicuous
golden yellow markings on the dorsa extend caudally
from the interorbital space onto the dorsal fin base.
Scales over the flanks, especially along the ventral half
are pigmented in the center with light golden yellow
spots, fringed by diamond-shaped aquamarine/medium sea green outline, thicker over the dorsal half,
giving flanks a reticulate appearance.
Remarks Miller et al. (2005) considered the forms
herein described as H. tepehua as an undescribed
species. Mitochondrial DNA analysis recovered
H. deppii and H. tepehua as paraphyletic, with
haplotypes H2 and H3 exclusive to both species.
Average Dp = 1.08%, thus separating both species.
H. tepehua has become extremely rare and is seldom
123
captured in the Cazones, Tecolutla, and Solteros
Rivers. Remaining populations appear to be confined
to the most isolated tributaries with turbid water where
visibility limits the use of diving masks and homemade spears used by local fishermen. These lineages
appear to be critically endangered.
Rı́o Pánuco geomorphological group
Herichthys carpintis (Fowler, 1903).
(Tables 8 and 9 of Supplementary Material 2;
Fig. 8, 9 and 10)
Synonyms Cichlosoma laurae Regan, 1908.
Holotype SU 6162; Laguna del Carpintero, near
Tampico, Tamaulipas, Mexico; J. O. Snyder, January
15, 1899.
Paratypes BMNH 1900.9.29.172-175 (4), FMNH
(1), SU 6201 (29).
Diagnosis Differs from H. cyanoguttatus in that
adult males develop nuchal humps; from H. teporatus
and H. cyanoguttatus in that it has a longer head (mean
38%, SD 1% vs. mean 35 and 35%, SD 2 and 1%,
respectively); longer distance from the rostral tip to the
pectoral fin origin (mean 37%, SD 1% vs. mean 35 and
35%, SD 2 and 1%, respectively); shorter snout (mean
37%, SD 3% vs. mean 39 and 40%, SD 3 and 3%,
respectively); and larger eyes (mean 26%, SD 2% vs.
mean 23 and 22%, SD 1 and 2%, respectively). Also
differs from other Herichthys in the following autapomorphy: In live specimens, big [1.5 mm, iridescent, thick pearls giving the fish a beveled appearance.
Description Description is based on sexually
mature specimens over 53.4 mm SL. Morphometric
and meristic data are summarized in Tables 8 and 9 of
Supplementary Material 2. Body depth 40–50% (mean
44%, SD 2%); HL 35–40% (mean 38%, SD 1%);
distance from the rostral tip to the pectoral fin origin
length 35–40% (mean 37%, SD 1%); snout short
30–43% (mean 37%, SD 3%); eyes large 22–30%
(mean 26%, SD 2%). Dorsal fin XV–XVII (mode XVI,
freq 90%) 9–12 (mode 10, freq 56%); anal fin IV–VI
(mode V, freq 86%) 7–10 (mode 8, freq 81%); pectoral
rays 13–15 (mode 14, freq 82%). Pre-dorsal contour
high, steep, and flattened at the front, forming a
concavity before the eyes. Adult males develop nuchal
humps. Teeth spatulate, chisel-like, bicuspid, weakly
bicuspid or a mixture of bicuspid and bluntly pointed
conical, undifferentiated in length in the upper and
lower jaws, implantation erect, curvature straight,
Hydrobiologia
neck wide.; teeth in the outer series of the premaxillae
(22–28); tooth-rows in the inner series of the premaxillae (4–5); in lower jaw (4–5). One inner row
anteriorly and three rows posteriorly in the upper jaw.
Lower and upper arcades rounded. Lower pharyngeal
tooth plate moderately stout and broad, two rows of
10–12, pigmented in some populations (e.g., Tamiahua), unpigmented in others (e.g., El Salto), enlarged
teeth increasing caudally in size and molarization
flank midline, 20–23 conic, progressively compressed
teeth along posterior margin. Teeth range from
enlarged-molariform to conical in some populations
(e.g., Tamiahua). In live fish, ground color olive-green
with big [1.5 mm iridescent, thick, Persian-green
colored pearls that give the fish a beveled appearance.
Dorsal and anal fins the same color as the body,
splashed with pearls over the dorsal, anal, and frontal
third of the caudal fins. Head marked with round and
elongate series of 10–12 spots over lachrymal and
cheeks that extend from the lip fold onto the orbit of
the eye. Dorsal view of head solid olive-green over the
premaxillae. Seven inconspicuous bars are visible in
non-breeding coloration. Breeding pigmentation is
typical of the genus.
Geographic distribution Pánuco River Basin below
1,200 masl, except in the Rı́o Gallinas and its tributaries in Tamasopo; Laguna de Tamiahua and its
tributaries in Veracruz; and San Andres Lagoon and its
tributaries in Tamaulipas.
Remarks This species was described as Neetroplus
carpintis by Jordan & Snyder (1899) from type
locality Laguna del Carpintero, Tamaulipas; and a
number of very small specimens in the Rı́o Verde near
Rascón, San Luis Potosı́. Heros laurae was later
described by Regan (1908), from type locality Tampico, hence is Junior synonym of H. carpintis. Heros
teporatus was described by Fowler in 1903 from type
locality Victoria, on the Victoria River, a tributary of
the Rı́o Soto la Marina, Tamps., Mexico. Álvarez
(1970) considered H. carpintis, a subspecies of
H. cyanoguttatus, separate from H. cyanoguttatus
teporatus and H. cyanoguttatus cyanoguttatus. In
2003, Kullander synonymized Heros teporatus with
H. carpintis. Observations of Álvarez (1970) generally
coincide with ours: H. carpintis and H. cyanoguttatus
are species too weakly differentiated. Low average
Dp = 0.73 and 0.57%, separate H. carpintis from
H. teporatus; and H. carpintis from H. cyanoguttatus,
respectively. This is in agreement with López-
Fernández et al. (2010). These authors noted the ‘‘zero
to none’’ 0.1% divergence between Herichthys cyanoguttatus, H. carpintis, and H. tamasopoensis. In
our analysis, H. carpintis was the species with the
highest haplotype richness within true Herichthys. We
detected six Cox1 haplotypes among the specimens
surveyed, including haplotypes H9 (*79%), shared
with H. cyanoguttatus and H. tamasopoensis; and H10
(*5%), uncommon in H. deppii and very common in
H. cyanoguttatus. We also detected haplotypes H11
(*2%) in Tamiahua, H15 (*2%) in Rı́o Guayalejo,
H16 (*9%) in the Lower Pánuco, and H17 (*2%) in
the Rı́o Guayalejo, representing divergent lineages
exclusive to this species (Supplementary Materials 5
and 7).
Herichthys tamasopoensis Artigas-Azas, 1993
(Tables 8 and 9 of Supplementary Material 2; Figs. 8
and 9)
Holotype UMMZ 221577; adult male, 85.5 mm SL
‘‘Las Cascadas’’ (99°230 4700 W Long., 21°560 4700 N.
Lat.) in the Rı́o Tamasopo, J.M. Artigas-Azas.
Paratypes UMMZ 221829 (6: 72.6–86.9 mm SL),
same data as the holotype.
Diagnosis Differs from H. carpintis in that it has a
longer caudal peduncle (mean 17%, SD 1% vs. mean
15%, SD 1%), and shorter lower jaw (mean 29%, SD
2% vs. mean 31%, SD 2%). Differs from all other
species in Herichthys in the following autapomorphies: Frontal teeth closely set, flattened, truncate, and
unicuspid to weakly bicuspid in both jaws; lateral teeth
bicuspid. Lower and upper arcades very rounded.
Lower pharyngeal tooth plate stout, broad, and
rugged; two rows of 10–12 unpigmented, compressed,
very small, closely set, molars flank midline, 30–32
compressed teeth along posterior margin. Also differs
from other Herichthys in having dorsal profile convex
markedly curved between the nuchal area and the first
dorsal spine, and in live ground color grayish yellowgreen to olive-green, with body covered with greenish
yellow dots *1 mm in diameter.
Description Description is based on sexually
mature specimens over 57.25 mm SL. Morphometric
and meristic data are summarized in Tables 8 and 9 of
Supplementary Material 2. Dorsal fin XV–XI (mode
XVI, freq 80%), 9–10 (mode 9, freq 50%); anal fin V
(freq 100%), 7–8 (mode 8, freq 80%); pectoral rays
13–14 (mode 14, 50%); scales in the lateral line
123
Hydrobiologia
28–31(mode 30, freq 60%). Body depth 41–47%
(mean 44%, SD 1%). Pre-dorsal contour high, steep,
and flattened at the front, convex before the eyes;
nuchal hump present in older males. Dorsal contour
strongly convex, markedly curved between nuchal
area and first dorsal spine. Frontal teeth flattened,
closely set, truncate, and unicuspid to weakly bicuspid
in both jaws; lateral teeth bicuspid, implantation erect,
curvature straight, neck wide, decreasing in size
posteriorly. Teeth in the outer series of the premaxillae
(18), tooth-rows in the inner series of the premaxillae
(5), and lower jaw (6–7). One inner row anteriorly and
5–6 rows posteriorly in the upper jaw. Lower and
upper arcades very rounded. Lower pharyngeal tooth
plate stout, broad, and rugged; two rows of 10–12
unpigmented, compressed, small, closely set molars
flank midline, 30–32 compressed teeth along posterior
margin.
Coloration in preservative Preserved specimens are
light brown, darker in the head and dorsal area. Fins
are the same color as the body, with dorsal, anal fins
dotted with lighter spots. Seven inconspicuous vertical
flank bars, bearing a series of dark blotches below the
lateral line over the caudal, half make up the principal
markings.
Live colors Ground color grayish yellow-green to
olive-green, darker dorsally; eyes and gill covers
purple, body covered with vanilla color dots *1 mm
in diameter. Dotting denser over dorsal half, and soft
dorsal, anal, and caudal fins; absent on head and chest.
Fins opaque. Seven dark blotches over the caudal half
below the lateral line make the principal markings
(central and caudal more conspicuous).
Breeding pigmentation Typical of the genus,
ground color changes to khaki. Five vertical dark
flank bars contrast pale frontal half. The purple areas
around the gill covers and cheeks, and the salmon
pigmented areas of dorsal fin intensify.
Geographic distribution Mainstream and tributaries of the Rı́o Gallinas, upriver from the Tamul
Cascade (Artigas-Azas, 1993).
Habitat and associates Habitat is characterized by
hard, clear waters with pH 7.8–8.3, over rock
substrate. Shares its habitat with Nosferatu pame,
N. steindachneri, Xiphophorus montezumae, Gambusia panuco, and Astyanax mexicanus among other fish
species.
Vernacular name Mojarra de Tamasopo, Tamasopo
Herichthys.
123
Remarks Hulsey et al. (2004) and Concheiro-Pérez
et al. (2006) recovered H. tamasopoensis as sister to
H. carpintis. We recovered a very low Cox1 average
divergence (Dp = 0.70%) between H. tamasopoensis
and H. carpintis. This is in agreement with LópezFernández et al. (2010). Nonetheless, our morphologic
analysis supports the validity of H. tamasopoensis as a
separate parapatric species. We detected two mitochondrial haplotypes among the specimens surveyed,
including haplotypes H8 (*89%), uncommon in
H. tepehua from the Tenixtepec River, and H9
(*11%), very common in H. carpintis and less so in
H. cyanoguttatus.
North of Sierra de Tamaulipas geomorphological
group
Herichthys cyanoguttatus Baird & Girard, 1854.
(Tables 8 and 9 of Supplementary Material 2;
Figs. 8 and 9)
Synonyms Heros pavonaceus, Garman 1881; Parapetenia cyanostigma (Hernández-Rolón, 1990).
Syntypes ANSP 9097 (1); MCZ 15415 [ex USNM
852]; UMMZ 92113 (1); USNM 851, 852 (now 4).
Brownsville, Texas, USA. Collected by Capt. Van
Vliet and John H. Clark.
Diagnosis Differs from H. teporatus in that it does
not develop prominent nuchal humps. Differs from
H. carpintis in that it has a shorter head (mean 35%,
SD 1% vs. mean 38%, SD 1%) and smaller eyes (mean
22%, SD 2% vs. mean 26%, SD 2%), all in HL; as well
as shorter distance from rostral tip to pectoral fin origin
(mean 35%, SD 1% vs. mean 37%, SD 1%) in SL.
Differs from both H. carpintis and H. teporatus in that
it has a longer snout (mean 40%, SD 3% vs. mean 37
and 39%, SD 3 and 3%, respectively). Also differs
from other Herichthys in the following autapomorphy:
In live fish, small \1 mm iridescent dots cover the
flanks.
Description Description is based on sexually
mature specimens over 61.7 mm SL. Morphometric
and meristic data are summarized in Tables 8 and 9 of
Supplementary Material 2. Head short 31–38% (mean
35%, SD 1%); distance from rostral tip to pectoral fin
origin short 31–37% (mean 35%, SD 1%); snout long
33–46% (mean 40%, SD 3%); eyes small 18–27%
(mean 22%, SD 2%). In live fish, small \1 mm
iridescent dots cover the flanks. Dorsal fin XV–XII
(mode XVI, freq 60%) 5–12 (mode 11, freq 55%); anal
Hydrobiologia
fin IV–VI (mode V, freq 75%) 8–10 (mode 9, freq
63%); pectoral rays 13–15 (mode 14, freq 88%); scales
in the lateral line 28–32 (mode 29, freq 38%). Body
depth 40–51% (mean 46%, SD 2%). Predorsal contour
high, steep, and flattened at front, forming an angular
depression before the eyes; nuchal hump absent in
large males. Frontal teeth regularly set, decreasing in
size posteriorly, spatulate, truncate and weakly bicuspid, implantation erect, curvature straight, neck wide,
undifferentiated in length in upper and lower jaws.
Teeth in the outer series of premaxillae (24); toothrows in the inner series of the premaxillae (2–3) and
lower jaw (4); one inner row anteriorly and 1–2 rows
posteriorly in the upper jaw. Lower and upper arcades
rounded. Lower pharyngeal tooth plate moderately
stout and broad, two rows of 11 pigmented, enlarged
teeth increasing caudally in size and molarization
flank midline, 24 conical, progressively compressed
teeth along posterior margin. Ground color is grayish
to asparagus-green with small \1 mm iridescent blue
to olive-green dots scattered over body and fins. Dot
diameter, density, patterns, and arrangements vary
among lineages; from diminutive \0.5, densely and
randomly scattered olive-green iridescent dots in the
northernmost populations of the Salado-Nadadores
and Ocampo sub-basins in Coahuila and Nuevo León,
to larger 0.5–1 mm, horizontally aligned iridescent
blue dots in the southernmost lineage of the San
Fernando River Basin. Head is marked with series of
3–15 diagonal rows of dots over lachrymal and cheeks
that extend from the edge of the lip fold onto the orbit
of the eye. Dorsal view of the head is solid grayish to
asparagus-green over the premaxillae.
Breeding pigmentation Typical of the genus. Six
vertical flank bars fuse darkening the entire posterior
half of body, contrasting the pale frontal half of the
fish.
Geographic distribution Lower Rı́o Grande/Bravo
basin in the US and Mexico, excluding the Conchos
River in Chihuahua; and the San Fernando River Basin
in Nuevo León and Tamaulipas, Mexico.
Habitat and associates H. cyanoguttatus is found
sympatric with Centrachid species (Lepomis sspp. and
Micropterus salmoides) throughout its distribution
range.
Vernacular name Texas cichlid, guapota del rı́o
Bravo.
Remarks This species was described as Herichthys
cyanoguttatus by Baird & Girard (1854) from type
locality Brownsville, Texas, U.S. Heros pavonaceus,
syntypes MCZ 24877 (5) and UMMZ 95837 (1) was
described by Garman (1881) from a spring in the
proximities of Monclova, Coahuila. Confusion always
existed with respect to the type locality largely
because type material was collected in an area of the
Salado-Nadadores River Basin near the Cuatro Cienegas Valley. Meek’s (1904) account of H. pavonaceus
is very general and matches about any species in
Herichthys. Álvarez (1970) sets the distribution of
H. pavonaceus as Coahuila and Nuevo León (in the
Salado-Nadadores River Basin). Kullander (2003)
considers H. pavonaceous a synonym of H. cyanoguttatus. Our analysis is in agreement with Kullander
(2003). Some specimens within the allopatric San
Fernando River lineage have in life different color
patterns from H. cyanoguttatus of the Rı́o Grande
Basin. The first have distinct, larger blue dots that are
aligned in horizontal lines over the flanks. HernándezRolón (1990) described Parapetenia cyanostigma
from type locality Playa Bruja, Tequesquitengo,
Mexico. His description is based on an introduced
population of H. cyanoguttatus. Álvarez (1970) considered H. carpintis and H. teporatus subspecies of
H. cyanoguttatus. The observations of Álvarez (1970)
generally coincide with our observations that H. carpintis and H. cyanoguttatus are weakly differentiated
species. We recovered a low Cox1 average mitochondrial divergence (Dp = 0.57%) between H. carpintis
and H. cyanoguttatus. This is in agreement with
López-Fernández et al. (2010). We detected four
mitochondrial haplotypes among the specimens surveyed, including haplotypes H1 (*6%) and H4
(*6%), shared with H. deppii; and H9 (*17%),
shared with H. carpintis, H. tamasopoensis, and
H. tepehua n. sp., as well as H10 (*72%), shared
with H. carpintis and H. tepehua n. sp. (Supplementary Materials 5 and 7).
Herichthys teporatus (Fowler, 1903)
(Tables 8 and 9 of Supplementary Material 2; Fig. 8)
Holotype ANSP 24242.
Diagnosis Differs from H. cyanoguttatus in that
adult males develop nuchal humps. Live H. teporatus
also differs from H. cyanoguttatus in having irregularly shaped iridescent spots 1–1.5 mm covering the
entire body versus iridescent dots \1 mm. Differs
from H. carpintis in having shorter heads (mean 35%,
123
Hydrobiologia
SD 2% vs. mean 37%, SD 1%); smaller eyes (mean
23%, SD 1% vs. mean 26%, SD 2%); shorter distance
from the rostral tip to the anal fin origin (mean 67%,
SD 2% vs. mean 71%, SD 2%); and shorter distance
from rostral tip to pectoral fin origin (mean 35%, SD
2% vs. mean 37%, SD 1%).
Description Description is based on sexually
mature specimens over 63.7 mm SL. Morphometric
and meristic data are summarized in Tables 8 and 9 of
Supplementary Material 2. Dorsal fin XV–XVI (mode
XVI, freq 90%) 10–12 (mode 11, freq 70%); anal fin
V–VI (mode VI, freq 50%) 9 (freq 100%); pectoral
rays 14 (freq 100%); scales in the lateral line 28–33
(mode 31, freq 30%). Body depth 42–49% (mean
45%, SD 2%). Pre-dorsal contour steep, flattened at
the front, forming a depression before the eyes. Adult
males develop nuchal humps. Frontal teeth are regularly set, decreasing in size posteriorly, spatulate,
truncate and weakly bicuspid, implantation erect,
curvature straight, neck wide. Teeth in the outer series
of the premaxillae (18); tooth-rows in the inner series
of the premaxillae (4) and lower jaw (4); one inner row
anteriorly and 3 rows posteriorly in the upper jaw.
Lower and upper arcades rounded. Lower pharyngeal
tooth plate moderately stout and broad, two rows of
10–12 lightly pigmented, enlarged teeth increasing
caudally in size and molarization flank midline, 20
conical, progressively compressed teeth along posterior margin.
Coloration in preservative Olive-brown with six to
nine vertical flank bars bearing a series of dark
blotches fading out below the lateral line make up the
principal markings.
Live colors Ground color is olive-green with a
series of horizontal rows of asymmetric turquoise
iridescent spots 1–1.5 mm in adults, scattered
throughout the entire body. Tip of dorsal fin rays red
in some individuals; a conspicuous dark blotch over
the middle of the dorsal fin may be present in both
males and females. Pectoral fins opaque; pelvic fins
have longitudinal blue streaks. Seven inconspicuous
bars are visible in non-breeding coloration.
Breeding pigmentation Typical of the genus.
Geographic distribution Soto La Marina River
Basin, including the Rı́o Blanco in Aramberri, Nuevo
León, as well as some of the smaller coastal rivers and
creeks of the Villa Aldama Volcanic Complex, including Rı́o Carrizal and Arroyo Tepehuajes in El Panal,
Tamaulipas.
123
Habitat and associates In the Rı́o Blanco and Rı́o
Purificación at elevations above 1,000 m, it shares
habitat with Xiphophorus xiphidium, whereas in the
lower reaches it shares habitat with Poecilia mexicana,
Poecilia formosa, and Fundulus sp. nov (under
description by one coauthor) among other fish species.
Vernacular name Green Texas cichlid, guapota del
Soto la Marina.
Remarks Heros teporatus was described by Fowler
(1903) from type locality Victoria, on the Victoria
River, a tributary of the Rı́o Soto la Marina, Tamps.,
Mexico. In 1904, Meek synonymized H. teporatus
with H. cyanoguttatus. Álvarez (1970) considered
H. teporatus a subspecies of H. cyanoguttatus and
used the trinomen H. cyanoguttatus teporatus. In
2003, Kullander again synonymized Heros teporatus,
this time with Herichthys carpintis, but noted the need
for further analysis. Miller et al. (2005) mentioned that
H. cyanoguttatus and H. carpintis possibly hybridize
within sections of the Soto la Marina River Basin. Our
morphometric analysis places H. teporatus phenetically closer to H. cyanoguttatus than H. carpintis. We
recovered a low Cox1 mitochondrial divergence
average (Dp = 0.73 and 0.42%) separate H. teporatus
from H. carpintis and H. cyanoguttatus, respectively.
Morphometric proportions between H. teporatus and
H. cyanoguttatus are indistinguishable. Counts are
indistinguishable between the three. We detected two
mitochondrial haplotypes among the specimens surveyed, including haplotypes H4 (*17%), shared with
H. deppii, and the more common H10 (*80%), very
common in H. cyanoguttatus, less so in H. carpintis,
and uncommon in H. tepehua n. sp.
Herichthys minckleyi (Kornfield & Taylor, 1983)
(Figure 8)
Holotype UMMZ 209434, 93.4 mm SL male, Deep
bodied form, papilliform morph, Posos[sic] de la
Becerra, 15.7 km by road SSW of Cuatro Ciénegas de
Carranza, Coahuila, Mexico, R.R. Miller and family,
C.L. Hubbs, W.L. Minckley, D.R. Tindall, and J.E.
Craddock, April 6, 1961.
Remarks Kornfield & Taylor (1983) hypothesized
that H. minckleyi appears to be more closely related to
the cichlids described herein as Nosferatu new genus,
specifically N. labridens, N. bartoni, N. pame, and
N. steindachneri than to H. cyanoguttatus on the basis
of jaw dentition. Hulsey et al. (2004) recovered
Hydrobiologia
H. minckleyi as sister taxa to a clade shared with
H. cyanoguttatus, H. carpintis, and H. tamasopoensis.
Discussion
Taxonomic implications
Our molecular and morphologic analysis supports
Nosferatu new genus as distinct from true Herichthys.
Our results concur with De la Maza-Benignos &
Lozano-Vilano’s (2013) interpretation of the labridens
assemblage = Nosferatu new genus conformed with
N. steindachneri (restricted to Rı́o Tamasopo), N. labridens (restricted to Media Luna and its surroundings), N. pratinus (restricted to Rı́o el Salto, above
Micos cascades), N. pame (restricted to the Rı́o
Tamasopo), the polymorphic N. pantostictus that
includes a number of parapatric lotic and lentic forms
inhabiting the lower reaches of the Pánuco-Tamesi
River Basin and the Tamiahua and San Andres coastal
lagoon systems, and N. molango (restricted to Laguna
Azteca). This last species could correspond to a
phenomenon of secondary contact (Nosil et al. 2009)
between both genera, as N. molango exhibited mitochondrial DNA affinity to true Herichthys. Furthermore, phylogenetic studies, particularly using nuclear
DNA loci, are needed to clarify its taxonomic status.
It has been hypothesized, on the basis of morphological similarities between both species (Kornfield &
Taylor, 1983; Artigas-Azas, 2006), that N. pame and
N. steindachneri evolved sympatrically, and it was
inferred that these were analogous to the polymorphic
H. minckleyi in the Cuatro Ciénegas Basin (Kornfield
& Taylor, 1983). Furthermore, Artigas-Azas (2006)
stated on the basis of distributions of the two species
that N. pame is found upriver of the waterfalls of Rı́o
Tamasopo, whereas N. steindachneri is not, that
N. pame is the ancestral species of the two. However,
our results suggest both species together with allopatric N. pratinus form a paraphyletic group. This
hypothesis is supported by the presence of shared
haplotypes between N. steindachneri and N. pratinus
and not shared with N. pame, which could be the result
of incomplete lineage sorting in the marker used
(Nosil & Sandoval, 2008; Takahashi et al., 2001) or
secondary contact (Nosil et al., 2009) from H. pratinus
into the Tamasopo River Basin. This latter hypothesis
is supported by lower divergence between allopatric
species
than
between
sympatric
(average
Dp = 0.32 ± 000.15 and Dp = 000.87 ± 000.97,
respectively). Our analysis supports that N. labridens
and N. bartoni recently diverged from a common
ancestor, on the basis of all haplotypes being shared by
the two. Further analysis at the phylogenetic level may
help resolve their evolutionary history.
None of the species within true Herichthys were
recovered as monophyletic. Nonetheless, our analysis
supports H. deppii ? H. tepehua n. sp. (i.e., south of
the Sierra de Tantima geomorphological group) as
distinct from the rest of the genus. This is on the basis
of high levels of divergence and the presence of
exclusive haplotypes to this group (Supplementary
Materials 5 and 7). Our molecular analysis, however,
does not support H. tamasopoensis, H. cyanoguttatus,
H. teporatus, and H. carpintis as distinct from each
other. These species exhibited very low (Dp \ 0.75%)
divergence values, and no differences in haplotypes
with the more genetically diverse H. carpintis. Our
findings concur with those of López-Fernández et al.
(2010), who reported divergence values of *0.1%
among the three. Nonetheless, our morphometric
analysis exhibited the three species as clearly divergent and diagnosable from H. carpintis ecologically,
chromatically, and morphologically.
True Herichthys currently includes seven morphologically distinct diagnosable species: H. deppii
(restricted to the Nautla-Misantla River basins) and
the allopatric H. tepehua n. sp. (restricted to the
Pantepec, Cazones, Tenixtepec, Tecolutla, and Solteros river systems); H. carpintis that includes a
number of parapatric lotic and lentic forms inhabiting
the Pánuco-Tamesı́ River Basin, except in the Rı́o
Tamasopo, and the Tamiahua and San Andres coastal
lagoon systems; H. tamasopoensis (restricted to the
Rı́o Tamasopo); H. teporatus restricted to the Rı́o Soto
La Marina; H. cyanoguttatus that includes a number of
allopatric forms inhabiting the Rı́o San Fernando, the
Rı́o Grande, and adjacent rivers in southeast Texas;
and the polymorphic H. minckleyi (endemic to the
Cuatro Ciénegas Valley).
Biogeographical patterns
Our estimated divergence time across the TMVB at
*7 Mya (*5–11 Mya 95% HPD) of the stem group
(Herichthys ? Nosferatu) from its sister clade corresponds with the formation of the Chiconquiaco-Palma
123
Hydrobiologia
Sola Massif. The Massif is located between the Gulf of
Mexico and the Sierra Madre Oriental (SMO). It is part
of the Eastern Alkaline Province (EAP), a volcanic-belt
that stretches 2,000 km in NNW–SSE direction from
northern Coahuila to Palma Sola, Veracruz, along the
GOM coastal plains (Ferrari et al., 2005; Avto et al.,
2007) and intersects the TMVB at the ChiconquiacoPalma Sola Massif (6.9–3.2 Mya) in central Veracruz
(Vasconcelos-Fernández & Ramı́rez-Fernández, 2004;
Ferrari et al., 2005; Avto et al., 2007).
Moreover, divergence time estimated for the split
between both genera was *5 Mya (3–8 Mya 95%
HPD). Our timing coincides with intense volcanism in
the Miocene-Pliocene that led to the formation of the
sedimentary Rı́o Verde Basin (Planer-Friedrich, 2000).
This is also reflected in other groups with similar
divergence times (Ornelas-Garcı́a et al., 2008). Sudden
subsidence of the graben structure in the basin during
the Quaternary created a drain-less depression filled by
shallow lakes that were subject to intensive evaporation
in a semiarid environment (Planer-Friedrich, 2000). It
was in some of these lakes that Nosferatu new genus
diverged into the bartoni (*3Mya), the steindachneri,
and the pantostictus clades (*2 Mya).
Regional faulting in the WNW–ESE direction during
the course of the Pleisteocene (*1.8 Mya) rejoined the
Rı́o Verde with the Rı́o Pánuco, draining most of the
lakes, as the Rı́o Verde cut its way through the valley
(Planer-Friedrich, 2000; CONAGUA, 2002), allowing
reinvasion of Nosferatu new genus into the Rı́o Pánuco,
this time with evolved mechanisms of reproductive
isolation that allowed sympatry of the two genera.
In the coastal plains, true Herichthys did not begin
speciation until *1 Mya, despite the significant
volcanic activity that occurred over the Tampico–
Misantla Structural Basin during the Miocene–Quaternary Period. Volcanic activity in the area is well
represented by the Sierra de Tantima and the Alamo
volcanic field (7.6–6.6 Mya); the Tlanchinol flows
(7.3–5.7 Ma), Molango (7.4–6.5 Mya) (Ferrari et al.,
2005); the Huejutla lava fields (7.3–2.87 Mya); the
lava fields around Palma Sola (6.9–3.2 Mya) (Avto
et al., 2007); the Huautla flow (*2.82 Mya); Metlaltoyuca (1.6–1.3 Mya) (Ferrari et al., 2005); and the
Poza Rica lavas (1.3–1.62 Mya) (Avto et al., 2007).
These events filled paleovalleys and redefined catchment delimitations in the Pánuco, Cazones, Pantepec,
Tecolutla, and Solteros river systems. Moreover, there
were repeated raising and lowering of sea level during
123
the Pleistocene, which would have allowed ancestral
Herichthys to bypass any terrestrial boundary to
dispersal (Hulsey et al. 2004).
North of the Rı́o Pánuco Basin, over the Burgos
Structural Basin, the EAP is represented by the CandelaMonclova belt (3.4–1.8 Mya) (Aranda-Gómez et al.
2005), the Villa Aldama volcanic complex
(1.8–0.250 Mya) (Camacho, 1993; Vasconcelos-Fernández & Ramı́rez-Fernández, 2004; Gary & Sharp,
2006), and the Plio-quaternary sections of the Sierra de
San Carlos-Cruillas and Sierra de Tamaulipas (Demant
& Robin, 1975; Bryant et al. 1991). Similar to the Sierra
de Tantima, the Sierra de Tamaulipas has functioned as
a biogeographic barrier to the dispersal of N. pantostictus, and consequently to the modern H. carpintis, into
the Pantepec and the Soto la Marina basins, respectively.
Climate change in the last 4 million years includes
the end of the warm period (5–3 Mya) and significant
intensification of Northern Hemisphere glaciations
*2.75 Mya (Ravelo et al., 2004). Higher winter
precipitation with significantly cooler and wetter
conditions than today prevailed in northern Mexico
during the Pleistocene and early Holocene. Quaternary
glacial sequences in central Mexico indicated that
there were at least five glacial advances in the late
Pleistocene and in the Holocene (Metcalfe et al., 2000;
Metcalfe, 2006). We hypothesize that these events
devastated cichlid populations north of parallel 24°N
and possibly farther South, except for localized
refuges with warm springs such as Cuatro Ciénegas.
In a recent study, Řičan et al., (2012) dated to 5.6 Mya
the cladogenetic event that created H. minckleyi. Our
demographic history analysis of all the other species of
true Herichthys exhibited a contraction during the
lower Pleistocene that coincides with some of the
glacial advances in North America during that period.
These advances would have forced the range contraction of Herichthys (except H. minckleyi, which
remained in the warm springs of Cuatro Ciénegas) to
the Rı́o Pánuco Basin as the climate deteriorated. In
more recent times, around 65,000 years ago, some
populations of Herichthys would have expanded once
more from the Rı́o Pánuco and reinvaded the rivers to
the north.
Acknowledgments The authors wish to thank Marco Arroyo,
Hazzaed Ochoa, Alejandro Espinosa, Emanuel Pimentel, Jesús
Maria Leza Hernández, and Anarbol Leal for their most
valuable and enthusiastic help throughout the collection
period. We thank Carlos Pedraza for his helpful suggestions
Hydrobiologia
on an early version of the manuscript, and Aslam Narváez-Parra
for the technical drawings of the lower pharyngeal plates and
frontal teeth in Figs. 9 and 10, and two anonymous reviewers
which advice helped improving crucial parts of the manuscript.
We also thank the funding support derived from the projects
CGL2006-1235-BOS and CGL2010-15231-BOS. Samples were
collected under permit number DGOPA/13323/007015/.-6943
issued to MLLV and vouchered at Colección Ictiológica de la
Facultad de Ciencias Biológicas de la UANL.
References
Álvarez, J., 1970. Peces Mexicanos (Claves). Servicio de Investigaciones Pesqueras Nacional. Instituto Nacional de
Investigaciones Biológicas, Mexico: 166 pp.
Aranda-Gómez, J. J., J. F. Luhr, T. B. Housh, G. Valdez-Moreno
& G. Chávez-Cabello, 2005. El volcanismo tipo intraplaca
del Cenozoico tardı́o en el centro y norte de Mexico: una
revisión. Boletı́n de la Sociedad Geológica Mexicana,
Volumen Conmemorativo del Centenario, Temas Selectos
de la Geologı́a Mexicana 3: 187–225.
Antoine, J. W., 1972. Structure of the Gulf of Mexico. In Rezak,
R., & V. J. Henry (eds), Contributions on the Geological
and Geophysical Oceanography of the Gulf of Mexico,
Texas A&M University Oceanographic Studies, Vol. 3.
Gulf Publishing Co., Houston, TX: 1–34.
Artigas-Azas, J. M., 1993. Herichthys tamasopoensis n. sp., a
new cichlid from Mexico (Pisces, Cichlidae). In Konings,
A. (ed.), Cichlids Yearbook 3. Cichlid Press, El Paso, TX:
65–70.
Artigas-Azas, J. M., 2006. Herichthys steindachneri. Cichlid
News 15: 15–22.
Avto, G., A. M. Petronille, B. Henry, L. A. Valdivia, J. Morales
& J. Urrutia-Fucugauchi, 2007. Paleomagnetism of the
Eastern Alkaline Province (Mexico): contribution to the
time-averaged field global database and geomagnetic
instability time scale. Earth Planets Space 59: 775–783.
Bandelt, H. J., P. Forster & A. Rohl, 1999. Median-joining
networks for inferring intraspecific phylogenies. Molecular
Biology and Evolution 16: 37–48.
Baird, S. F. & C. F. Girard, 1854. Descriptions of new species of
fishes collected in Texas, New Mexico and Sonora, by Mr.
John H. Clark, on the U. S. and Mexican Boundary Survey,
and in Texas by Capt. Stewart Van Vliet, USA. Proceedings of the Academy of Natural Sciences of Philadelphia 7:
24–29.
Bean, T. H., 1892. Notes on fishes collected in Mexico by Prof.
Alfredo Dugès, with descriptions of new species. Proceeding of the U. S. National Museum: 283–287.
Bryant, W. R., J. Lugo, C. Córdova & A. Salvador, 1991.
Physiometry and Bathymetry. The Geology of North
America, Vol. J, The Gulf of Mexico Basin. The Geological Society of America, Boulder, CO: 13–30.
Byerly, G. R., 1991. Igneous activity. In Salvador, A. (ed.), The
Gulf of Mexico Basin: The Geology of North America. The
Geological Society of America, Boulder, CO: 91–108.
Camacho, A. F., 1993. Compilación geológica de la Vertiente
del Golfo de México, Area 1. Comisión Federal de Electricidad, Subdirección Técnica, Gerencia de Estudios de
Ingenierı́a Civil, Subgerencia de Estudios Geológicos:
Departamento de Geologı́a 43: 123–130.
Chakrabarty, P., 2007. A Morphological Phylogenetic Analysis
of Middle American Cichlids with Special Emphasis on the
Section ‘Nandopsis’ sensu Regan, Vol. 198. Miscellaneous
Publications, Museum of Zoology, University of Michigan,
Ann Arbor, MI: 1–31.
CONAGUA, 2002. Determinación de la disponibilidad de agua
en el Acuı́fero Rı́o Verde, estado de San Luis Potosı́,
Comisión Nacional del Agua Subdirección General Técnica,
Gerencia de Aguas Subterráneas, Subgerencia de Evaluación y Modelación Hidrogeológica. Retrieved 20 December,
2011. http://www.conagua.gob.mx/CONAGUA07/Noticias/
DR_2415.pdf.
Concheiro-Pérez, G. A., I. Oldlich, G. Ortı́, E. Bermingham, I.
Doadrio & R. Zardoya, 2006. Phylogeny and biogeography
of 91 species of heroine cichlids (Teleostei: Cytochrome b
gene). Molecular Phylogenetics and Evolution 43: 91–110.
Contreras-Balderas, S., H. Obregón & M. L. Lozano-Vilano,
1996. Punta del Morro, una interesante barrera de los patrones de distribución de los peces continentales en el norte
y centro de Veracruz, México. Acta Biológica 16: 37–42.
De la Maza-Benignos, M. & M. L. Lozano-Vilano, 2013.
Description of three new species of the genus Herichthys
(Perciformes: Cichlidae) from eastern Mexico, with redescription of H. labridens, H. steindachneri, and H. pantostictus. Zootaxa 3734: 101–129.
Demant, A. & C. Robin, 1975. Las fases del vulcanismo en
México: una sı́ntesis en relación con la evolución geodinámica desde el Cretácico. Revista del Instituto de
Geologı́a de la UNAM 1: 66–79.
Doadrio, I. & O. Dominguez, 2004. Phylogenetic relationships
within the fish family Goodeidae based on cytochrome b
sequence data. Molecular Phylogenetics and Evolution 31:
416–430.
Doadrio, I. & A. Perdices, 2005. Phylogenetic relationships
among the Ibero-African cobitids (Cobitis, cobitidae)
based on cytochrome b sequence data. Molecular Phylogenetics and Evolution 37: 484–493.
Drummond, A. & A. Rambaut, 2007. BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evolutionary
Biology 7: 214.
Elliott, N. G., K. Haskard & J. A. Koslow, 1995. Morphometric
analysis of orange roughy (Hoplostethus atlanticus) off the
continental slope of southern Australia. Journal of Fish
Biology 46: 202–220.
Eschmeyer, W. N. (ed). 2013 Catalog of fishes: genera, species.
(http://research.calacademy.org/research/ichthyology/
catalog/fishcatmain.asp). Electronic version accessed 26
December, 2013 .
Farias, I. P., G. Ortı́, I. Sampaio, H. Schneider & A. Meyer,
1999. Mitochondrial DNA phylogeny of the family Cichlidae: monophyly and fast molecular evolution of the
Neotropical assemblage. Journal of Molecular Evolution
48: 703–711.
Farias, I. P., G. Ortı́ & A. Meyer, 2000. Total evidence, molecules, morphology, and the phylogenetics of cichlid fishes.
Journal of Experimental Zoology 288: 76–92.
Farias, I. P., G. Ortı́, I. Sampaio, H. Schneider & A. Meyer,
2001. The Cytochrome b gene as a phylogenetic marker:
123
Hydrobiologia
the limits of resolution for analyzing relationships among
cichlid fishes. Journal of Molecular Evolution 53: 89–103.
Ferrari, L., M. López-Martinez, G. Aguirre-Dı́az & G. CarrascoNuñez, 1999. Space–time patterns of Cenozoic arc volcanism in central Mexico. From the Sierra Madre Occidental
to the Mexican Volcanic Belt. Geology 27: 303–306.
Ferrari, L. T., M. Tagami, M. Eguchib & M. T. Orozco-Esquivela, 2005. Geology, geochronology and tectonic setting of
late Cenozoic volcanism along the southwestern Gulf of
Mexico: The Eastern Alkaline Province revisited. Journal
of Volcanology and Geothermal Research 146: 284–306.
Fowler, H. W., 1903. Life colors of Poecilia limantouri and
description of a new Heros from Mexico. Proceedings of
the Academy of Natural Sciences of Philadelphia 63:
493–520.
Garman, S., 1881. New and little-known reptiles and fishes in
the museum collections. Bulletin of the Museum of Comparative Zoology 8: 85–93.
Gary, M. O. & J. M. J. Sharp, 2006. Volcanogenic karstification
of Sistema Zacatón, Mexico. Geological Society of
America Special Papers 404: 79–89.
Heckel, J. J., 1840. Johann Natterer’s neue Flussfische Brasilien’s nach den Beobachtungen und Mittheilungen des
Entdeckers beschrieben (Erste Abtheilung, Die Labroiden). Annalen des Wiener Museums der Naturgeschichte
2: 325–471.
Hernández-Rolón, A., 1990. Un nouveau cichlidé du système du
Rio Balsas, Mexique (Pisces, Teleostei). Revue Française
des Cichlidophiles 11: 4–13.
Hrbek, T., J. Seckinger & A. Meyer, 2007. A phylogenetic and
biogeographic perspective on the evolution of poeciliid
fishes. Molecular Phylogenetics and Evolution 43: 986–998.
Huelsenbeck, J. P. & F. Ronquist, 2001. MrBayes: Bayesian
inference of phylogeny. Bioinformatics 17: 754–755.
Hulsey, C. D., F. J. Garcı́a de León & Y. Sánchez-Jo, 2004.
Temporal diversification of Mesoamerican cichlid fishes
across a major biogeographic boundary. Molecular Phylogenetics and Evolution 31: 754–764.
Jordan, D. S. & J. O. Snyder, 1899. Notes on a Collection of
Fishes from the Rivers of Mexico, with Description of
Twenty New Species. Proceedings of the Academy of
Natural Sciences of Philadelphia 19: 115–147.
Kornfield, I. & J. N. Taylor, 1983. A new species of polymorphic fish Cichlasoma minckleyi, from Cuatro Ciénegas,
Mexico (Teleostei: Cichlidae). Proceedings of the Biological Society of Washington 96: 253–269.
Kullander, S. O., 1996. Heroina isonycterina, a new genus and
species of cichlid fish from Western Amazonia, with
comments on Cichlasomine systematics. Ichthyological
exploration of freshwaters 7: 149–172.
Kullander, S. O., 1998. A phylogeny and classification of the
South American Cichlidae (Teleostei: Perciformes). In
Malabarba, L. R., R. E. Reis, R. P. Vari, Z. M. Lucena & C.
A. S. Lucena (eds), Phylogeny and Classification of Neotropical Fishes. EdiPUCRS, Porto Alegre: 461–498.
Kullander, S. O., 2003. Check List of the Freshwater Fishes of
South and Central America. In Reis, E., S. O. Kullander &
C. J. Ferraris (eds), Check List of the Freshwater Fishes of
South and Central America. EdiPUCRS, Porto Alegre:
635–636.
123
Kullander, S. O., M. Norén, G. B. Friðriksson & C. A. Santos de
Lucena, 2010. Phylogenetic relationships of species of
Crenicichla (Teleostei: Cichlidae) from southern South
America based on the mitochondrial cytochrome b gene.
Journal of Zoological Systematics and Evolutionary
Research 48: 248–258.
Librado, P. & J. Rozas, 2009. DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25: 1451–1452.
López-Fernández, H., K. O. Winemiller & R. L. Honeycutt,
2010. Multilocus phylogeny and rapid radiations in Neotropical cichlid fishes (Perciformes: Cichlidae). Molecular
Phylogenetics and Evolution 55: 1070–1086.
López-Fernández, H., R. L. Honeycutt & K. O. Winemiller,
2005a. Molecular phylogeny and evidence for an adaptive
radiation of geophagine cichlids from South America
(Perciformes: Labroidei). Molecular Phylogenetics and
Evolution 34: 227–244.
López-Fernández, H., L. R. Honeycutt, M. L. J. Stiassny & K.
O. Winemiller, 2005b. Morphology, molecules, and character congruence in the phylogeny of South American
geophagine cichlids (Perciformes, Labroidei). Zoologica
Scripta 34: 627–651.
Martin, A. P. & E. Bermingham, 1998. Systematics and evolution
of Lower Central American Cichlids inferred from analysis
of Cytochrome b gene sequences. Molecular Phylogenetics
and Evolution 9: 192–203.
Mateos, M., O. I. Sanjur & R. C. Vrijenhoeck, 2002. Historical
biogeography of the live bearing fish genus Poeciliopsis
(Poeciliidae: Cyprinodontiformes). Evolution 56: 972–984.
McMahan, C. D., A. D. Geheber & K. R. Piller, 2010. Molecular
systematics of the enigmatic Middle American genus Vieja
(Teleostei: Cichlidae). Molecular Phylogenetics and Evolution 57: 293–300.
Meek, S. E., 1904. The Freshwater Fishes of Mexico North of
the Isthmus of Tehuantepec. Zoological Series, Field
Columbian Museum, Chicago, IL: 210–212.
Metcalfe, S. E., 2006. Late Quaternary environments of the
northern deserts and Central Transvolcanic Belt of Mexico.
Annals of the Missouri Botanical Garden 93: 258–273.
Metcalfe, S. E., S. L. O’Hara & M. Caballero, 2000. Late
Quaternary climate change in Mexico. Quaternary Science
Reviews 19: 699–721.
Miller, R. R., W. L. Minckley & S. M. Norris, 2005. Freshwater
fishes of Mexico. Museum of Zoology, University of
Michigan/University of Chicago Press, Ann Arbor, MI/
Chicago, IL: 490 pp.
Murphy, W. J., J. E. Thomerson & G. E. Collier, 1999. Phylogeny
of the Neotropical killifish family Rivulidae (Cyprinodontiformes, Aplocheiloidei) inferred from mitochondrial DNA
sequences. Molecular Phylogenetics and Evolution 13:
289–301.
Musilová, Z., O. Řičan, K. Janko & J. Novák, 2008. Molecular
phylogeny and biogeography of the Neotropical cichlid
fish tribe Cichlasomatini (Teleostei: Cichlidae: Cichlasomatinae). Molecular Phylogenetics and Evolution 46:
659–672.
Nosil, P. & C. P. Sandoval, 2008. Ecological niche dimensionality and the evolutionary diversification of stick
insects. PLoS One 3: 1907.
Hydrobiologia
Nosil, P., L. Harmon & O. Seehausen, 2009. Ecological explanations for (incomplete) speciation. Trends in Ecology &
Evolution 24: 145–156.
Ornelas-Garcı́a, C. P., O. Dominguez-Dominguez & I. Doadrio,
2008. Evolutionary history of the fish genus Astyanax
Baird & Girard (1854) (Actinopterygii, Characidae) in
Mesoamerica reveals multiple morphological homoplasies. BMC Evolutionary Biology 8: 340.
Pellegrin, J., 1903. Description de Cichlidés nouveaux de la
collection du Muséum. Bulletin du Musée National
d’Histoire Naturelle: 120–125.
Perdices, A., E. A. M. Bermingham & I. Doadrio, 2002. Evolutionary history of the genus Rhamdia (Teleostei: Pimelodidae) in Central America. Molecular Phylogenetics and
Evolution 25: 172–189.
Perdices, A., I. Doadrio & E. A. M. Bermingham, 2005. Evolutionary history of the synbranchid eels (Teleostei: Synbranchidae) in Central America and the Caribbean islands
inferred from their molecular phylogeny. Molecular Phylogenetics and Evolution 37: 460–473.
Planer-Friedrich, B., 2000. Hydrogeological and hydrochemical
investigations in the Rio Verde Basin, Mexico. Freiberg
Online Geoscience 3: 1–145.
Posada, D., 2008. jModelTest: phylogenetic model averaging.
Molecular Biology and Evolution 7: 1253–1256.
Rambaut, A. & A. Drummond, 2007. Tracer [computer program]. http://tree.bio.ed.ac.uk/software/tracer.
Ravelo, A. C., D. H. Andreasen, M. Lyle, A. Olivarez-Lyle & M.
W. Wara, 2004. Regional climate shifts caused by gradual
global cooling in the Pliocene epoch. Nature 429: 263–267.
Regan, C. T., 1905. A revision of the fishes of the American
cichlid genus Cichlosoma [sic] and of the allied genera.
Annals and Magazine of Natural History (Series 7): 436.
Regan, C. T., 1906–1908. Pisces. In Godman, F. D., O. Salvin
(eds), Biologia Centrali Americana, London: 203 pp.
Řı́čan, O., R. Zardoya & I. Doadrio, 2008. Phylogenetic relationships of Middle American cichlids (Cichlidae, Heroini)
based on combined evidence from nuclear genes, mtDNA,
and morphology. Molecular Phylogenetics and Evolution
49: 941–957.
Řı́čan, O., L. Piálek, R. Zardoya, I. Doadrio & J. Zrzavy, 2012.
Biogeography of the Mesoamerican Cichlidae (Teleostei:
Heroini): colonization through the GAARlandia land
bridge and early diversification. Journal of Biogeography:
1–15.
Roe, K. J., D. Conkel & C. Lydeard, 1997. Molecular systematics of Middle American Cichlid fishes and the evolution
of trophic-types in ‘Cichlasoma (Amphilophus)’ and
‘C. (Thorichthys)’. Molecular Phylogenetics and Evolution
7: 366–376.
Ruiz-Campos, G., F. Camarena-Rosales, A. Varela-Romero, S.
Sánchez-Gonzáles & J. De La Rosa-Vélez, 2003.
Morphometric variation of wild trout populations from
northwestern Mexico (Pisces: Salmonidae). Reviews in
Fish Biology and Fisheries 13: 91–110.
Sambrook, J., E. Fritsch & T. Maniatis, 1989. Molecular
Cloning: A Laboratory Manual. Cold Spring Laboratory,
New York.
SEMARNAT 2010 (Secretarı́a del Medio Ambiente y Recursos
Naturales). Norma Oficial Mexicana NOM–059–ECOL–
2001, protección ambiental–especies nativas de Mexico y
de flora y fauna silvestres–categorı́as de riesgo y especificaciones para su inclusión, exclusión o cambio–lista de
especies en riesgo.
Shapiro, B., A. Rambaut & A. J. Drummond, 2006. Choosing
appropriate substitution models for the phylogenetic analysis of protein-coding sequences. Molecular Biology and
Evolution 23: 7–9.
Schmitter-Soto, J. J., 2007. Phylogeny of species formerly
assigned to the genus Archocentrus (Perciformes: Cichlidae). Zootaxa 1618: 1–50.
Sides, J. & C. Lydeard, 2000. Phylogentic utility of the tyrosine
kinase gene X-src for assessing relationships among representative cichlid fishes. Molecular Phylogenetics and
Evolution 41: 51–74.
Snoeks, J., 1994. The Haplochromines (Teleostei, Cichlidae) of
Lake Kivu (East Africa). Annales-Musée Royale de l’Afrique Centrale. Sciences Zoologiques 270: 1–221.
Stamatakis, A., 2006. RAxML-VI-HPC: maximum likelihoodbased phylogenetic analyses with thousands of taxa and
mixed models. Bioinformatics 22: 2688–2690.
Stawikowski, R. & U. Werner, 1998. Die Buntbarsche Amerikas, Vol. 1. Eugen Ulmer, Stuttgart: 540.
Takahashi, K., Y. Terai, M. Nishida & N. Okada, 2001. Phylogenetic relationships and ancient incomplete lineage
sorting among Cichlid fishes in Lake Tanganyika as
revealed by analysis of the insertion of retroposons.
Molecular Biology and Evolution 18: 2057–2066.
Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei & S.
Kumar, 2011. MEGA5: molecular evolutionary genetics
analysis using maximum likelihood, evolutionary distance,
and maximum parsimony methods. Molecular Biology and
Evolution 28: 2731–2739.
Taylor, J. N. & R. R. Miller, 1983. Cichlid fishes (Genus Cichlasoma) of the Rio Panuco Basin, Eastern Mexico, with
description of a new species. Museum of Natural History,
University of Kansas, Kansas 104: 1–24.
Vasconcelos-Fernández, J. M. & J. A. Ramı́rez-Fernández,
2004. Geologı́a y petrologı́a del complejo volcánico de
Villa Aldama, Tamaulipas. Ciencia 7: 40–44.
Ward, R. D., T. S. Zemlak, B. H. Innes, P. R. Last & P. D. N.
Hebert, 2005. DNA barcoding Australia’s fish species.
Philosophical Transactions of the Royal Society of London
Series B, Biological Sciences 360: 1847–1857.
123