Name
Section
CONTRACTION OF GLYCERINATED MUSCLE WITH ATP
(Carolina Kit)
MECHANISM OF MUSCLE FIBER CONTRACTION
A whole skeletal muscle is made of many cells called muscle fibers (myofibrils) (Figure
13.7). Muscle fibers are striated—that is, they have alternating light and dark bands. These
striations can be observed in a light micrograph of muscle fibers in longitudinal section.
Electron microscopy has shown that striations are due to the placement of protein
filaments of myosin and actin. During contraction, actin filaments move past myosin filaments,
and units of the muscle, called sacromeres, shorten. ATP serves as the immediate energy source
for sacromere contraction. Potassium (K+) and magnesium (Mg2+) ions are cofactors for the
breakdown of ATP by myosin.
STORAGE OF MUSCLE TISSUE AND SOLUTIONS:
The glycerinated muscle preparations can be stored in a freezer at -20ºC to -10ºC indefinitely.
The ATP and salt solutions should be stored in a refrigerator between 4ºC and 10ºC, and should
be used within 10 days of receiving the kit. To minimize chemical activity loss, these solutions
are prepared as close to shipping as is practical. Remove the muscle preparations and
solutions from storage just before use.
PREPARATION:
Remove the skeletal muscle strips, which are each tied to a stick, from their test tubes. Each of
these strips contains hundreds of muscle fibers. Pour the glycerol from each test tube into a petri
dish. Cut the muscle strips into pieces about 2 cm in length, and drop these into the petri dishes.
One piece of muscle tissue is sufficient for each group of 2 students or more. For each group,
distribute some of the glycerol and one piece of the muscle tissue into a petri dish. Unused
muscle may be returned to the refrigerator in the 50% glyercol solution.
Provide for each group:
Teasing needle and forceps
Petri dish with glycerol and skeletal muscle tissue
Microscope slides and coverslips
Small rulers
Compound microscope
Dissecting Microscope
All glassware and dissecting tools should be cleaned thoroughly and well rinsed in distilled water
before use.
Note on student results:
The speed and extent of the muscle contractions students will observe are influenced by the
amount of glycerol on the slide, the concentration of active ATP, the ions present, and the width
of the dissected muscle strand. Under favorable conditions, myofibers can be expected to
contract to almost 50% of their starting length within 10 seconds.
Experimental Procedure: Contraction of Glycerinated Muscle with ATP
1. Place the petri dish containing a segment of skeletal muscle tissue on the stage of a
dissecting microscope. Use a teasing needle to gently tease the segment into very thin
strands. You will see optimal results with single muscle fibers, but these are difficult to
obtain. The thinnest strand that you will likely get is a group of two to four fibers.
Strands of muscle exceeding 0.2 mm in cross-sectional diameter are too thick to be used.
2. Mount a thin strand on a microscope slide with a coverslip. Examine the strand under
magnification. Note the striations in the myofibers.
3. Transfer three or more of the thinnest strands to a tiny amount of glycerol on a second
microscope slide. Lay the strands out straight and parallel to each other. Do not cover
them.
Note: The amount of glycerol needed depends on the heat of the microscope lamp and
the length of exposure to heat. With no appreciable heat, the glycerol that adheres to the
strand of fibers is sufficient. The less glycerol used, the easier the fibers are to measure.
4. Using your microscope, measure the length of the strands with a millimeter scale.
Record these lengths in Table 13.3.
5. Flood the strands with several drops of the solution containing ATP plus potassium and
magnesium ions. Observe the reaction of the fibers.
Note: It is essential to avoid cross-contamination between the ATP and the salt solutions.
Such contamination will lead to ambiguous experimental results.
6. After 30 seconds or more, re-measure the strands and calculate the degree of contraction.
Have the fibers changed in width?
7. Remove one of the contracted strands to another slide. Examine it under a compound
microscope and compare the fibers with those seen in Step 2. What difference do you
see?
8. Repeat steps 1-7 using clean slides, new myofibers, and the solutions of ATP alone and
salts alone. What conclusions may be drawn from your results?
Table 13.3 Glycerinated Muscle Contraction
Solution
(Length, mm) Before treatment After treatment
Glycerol alone
K+/Mg 2+ salt solution alone
ATP alone
Both salt solutions and ATP
Urinary System
The urinary system is composed of the paired kidneys and the urinary tract,
which includes two ureters, the bladder, and a urethra. (Figure 1.) The principal
function of the urinary system is to maintain the volume and composition of bodily fluids
by the kidneys filtering the blood to remove metabolic wastes, such as carbon dioxide
and nitrogenous wastes including urea, ammonium, creatinine, and uric acid, and then
modifying the resulting fluids. This in all provides homeostasis of electrolytes, acidbase, and blood pressure. The urinary system maintains the appropriate fluid volume in
the body by regulating the amount of water excreted in the urine. Thereby, the
concentrations of various electrolytes and normal pH of the blood is controlled.
Figure 1: Organs of the urinary system in a female.
The kidneys also play a role in the endocrine system in hormone secretion by
releasing the enzyme renin that leads to aldosterone, which is produced by the adrenal
glands that lie atop the kidneys. Aldosterone is involved in regulating the water-salt
balance in the blood. The kidneys further have a role in the endocrine system by
regulating the production of red blood cells by releasing the hormone erythropoietin.
Kidney Structure:
Study a model of a kidney, and by using Figure 2, locate the following structures:
1. Nephron: functional unit of tubules that filters the blood and produces the urine
2. Renal cortex: outermost section of the kidney that contains most regions of
nephrons
1
3. Renal medulla: middle section of kidney that contains renal pyramids consisting of
the loops of nephrons and collecting ducts
4. Renal pelvis: where urine is received from the collecting ducts of nephrons
Figure 2: The longitudinal section of a human kidney. (a) This image is showing the distribution of the
renal vein and renal artery into smaller venules and arterioles, and how they surround the nephrons. (b)
An enlargement showing the placement of the nephron among the renal cortex and renal medulla of the
kidney in order for the urine to empty out into the renal pelvis by way of the collecting duct. (c) By a
combination view of (b) and (c) it can be seen where the nephron is located inside the kidney structure as
a whole and how the urine will be excreted out the ureter.
Nephron Structure:
Study a model of a nephron, and by using Figure 3, locate the following structures:
1. Glomerular capsule: a group of large pored capillaries that hold the
responsibility of glomerular filtration, where substances move from the blood to
inside the nephron
2. Proximal convoluted tubule: region of the nephron consisting of many microvilli
that allows for tubular reabsorption to occur, where substances move from the
nephron to the blood
2
3. Loop of nephron: portion of the nephron narrows in diameter and forms a Ushaped portion. Functions in water reabsorption.
4. Distal convoluted tubule: this region of nephron lacks microvilli and the
primary function is ion exchange. The process of tubular secretion is carried
out, where substances move from blood to inside nephron, specifically the
collecting duct.
5. Collecting duct: located in the renal medulla, carrying urine from distal
convoluted tubules of several nephrons to renal pelvis, and functions in water
reabsorption.
Figure 3: An overview of urine production. The three main processes in urine formation are described in
boxes and color-coded to arrows that show the movement of molecules into or out of the nephron at
specific locations. In the end, urine is composed of the substances within the collecting duct (see brown
arrow).
3
Experiment: Urinalysis
Urinalysis can indicate whether the kidneys, liver, or other urinary organs are
functioning properly or whether an illness such as diabetes mellitus is present.
Normal and abnormal components of urine:
Volume: One to 2 liters produced every 24 hours, but amounts vary considerably both
within and among individuals
Color: The color of urine is due to a pigment called urobilin (or urochrome). Urobilin is
the breakdown product of hemoglobin related to bile pigments. The color varies from
pale yellow to deeper amber depending on the concentration of urobilin. The deeper
amber color the urine, more concentrated the urobilin. Abnormal urinary color may be
due to certain foods, such as beets), vitamins, medications, bile, infection, or blood.
Odor: Normal, healthy urine does not have a strong smell, but with dehydration, urine
odor may have a stronger ammonia-like smell. Urine of urinary tract infection has an
ammonia-like odor or simply foul odor. Certain food and medication can affect the odor.
Urine of diabetics has a sweet, or fruity, odor.
pH: Normal urine pH tends to be 6.0 to 7.5, but can range from 4.5 to 8.0. pH may vary
based on diet. For example, a vegetarian diet usually results in an alkaline pH (higher
in number), whereas a high protein diets increases acidity (lower in number). A
bacterial infection, antacids, ulcers, and alkaline drugs. Alkaline urine is an indicator of
kidney stones produced by bacterial infection.
Specific gravity: Specific gravity is the ratio of the density of a substance compared to
a standard such as water. The specific gravity of urine gives a rapid indication of the
concentration of solutes present in the urine. The range of normal urine falls between
1.002 and 1.030 based on if the kidneys are functioning correctly, fluid intake, diet, and
medication. The higher the number, the more dehydrated the person may be, therefore
more solutes in the urine. Morning samples usually have the highest specific gravity.
Excessive amounts of water, use of diuretics, suffers from diabetes insipidus or chronic
renal failure may result in lower specific gravity.
Red blood cells: Normal, healthy urine should not contain red blood cells. Red blood
cells are too large to pass through glomerulus filtration. If red blood cells are present in
the urine, they may be indicating a condition called hematuria, where the urinary tract
has become irritated or kidney stones are present. There also could have been
physical trauma to the urinary organs. Or in healthy menstruating females, the urine
sample could have become contaminated with menstruation blood.
Hemoglobin: The presence of hemoglobin in the urine is a result of the
breakdown of red blood cells, and is released into the plasma of the blood where
it is filtered by the kidneys. Hemoglobin in the urine can cause urine to have a
4
purple color. Hemoglobinuria indicates hemolytic anemia, transfusion reactions,
or renal disease.
White blood cells: The presence of white blood cells indicates infection in the kidney or
other urinary organs. This infection is referred to as pyelonephritis.
Protein: The blood protein albumin is the most abundant and smallest of plasma
protein. It has the function of maintaining osmotic pressure of the blood. The urine has
small amounts regularly because it is too large to pass through the large pores in the
glomerulus capillaries, but in certain conditions, such as strong physical exertion and
diet extremely high in protein. These are nonpathological conditions. Causes of
pathological conditions of albuminuria are increased blood pressure, increase in the
permeability of filtration membrane due to injury or disease or irritation of kidney cells by
substances such as bacterial toxins, ether, or heavy metals.
Nitrite: Bacterial infections of the urinary tract are typically caused by Gram negative
bacteria, which convert dietary nitrate to nitrite.
Glucose: Glucose is not normally present in the urine except for trace amounts.
Glycosuria, the presence of glucose in the urine, usually indicates diabetes mellitus in
which the body cells are unable to absorb glucose from the blood by exceeding over the
glucose threshold of the kidneys. This is when the glucose blood level is over 160 ml/
100 ml. Glycosuria also occurs from excessive carbohydrate intake.
Ketones: Ketonuria is high levels of ketones, such as acetone, in the urine that may
indicate diabetes mellitus, anorexia, starvation, or simply too little carbohydrates in the
diet. When the body does not have or use glucose due to starvation or diabetes
mellitus (lacks insulin), the body breaks down fat instead of glucose for energy and that
results in ketones. Ketones are acidic, so if too many accumulate, blood pH becomes
acidic, which is dangerous.
Urobilinogen & Bilirubin: The presence of urobilinogen and bilirubin in the urine in
high concentrations indicates liver disease such as cirrhosis or gall stones. If there is
little to no urobilinogen in the urine, it can mean that the liver isn’t working correctly.
Nitrogenous waste compounds: Urea, uric acid, and creatinine are the most
important nitrogenous waste found in urine. Urea composes 60-90% of nitrogenous
material in urine, and is derived from ammonia produced during protein breakdown.
Uric acid is a metabolite of nucleic acid breakdown. Because of its insolubility, uric acid
tends to crystallize and is a common component of kidney stones. Creatinine, a normal
constituent of blood, is derived from the breakdown of creatinine phosphate in muscle
tissue.
Inorganic compounds: Sodium ions appear in relatively high concentration in the urine
because of reduced urine volume, not because large amounts are being secreted.
Sodium is the major positive ion in the blood plasma; under normal circumstances, most
5
Name
Section
of it is actively reabsorbed. Much smaller but highly variable amounts of calcium,
magnesium, and bicarbonate ions are also found in the urine. Abnormally high
concentrations of any of these urinary constituents may indicate a pathological
condition.
Carry out urinalysis on the three urine samples that are provided by following the
procedure:
1. Determine the color and transparency of each sample and record data in Table
3.
2. pH test: Obtain a strip of wide range pH paper to determine the pH of each
sample. Use a fresh strip of pH paper for each sample. Dip the strip into the
urine to be tested two or three times before comparing the color obtained with the
chart on the pH dispenser. Do not wait too long because the color will change.
Record data in Table 3.
3. Ketone Test: Open each urine sample cup, and using a wafting motion, (pulling
your hand over the cup without bringing the cup directly to your nose), notice the
odor of each urine sample. Do any samples smell like nail polish remover
(acetone/ ketone)? Record in Table 3.
4. Glucose Test: Label test tubes: one test tube A, one test tube B, and the other
test tube C. Place the test tubes into a test tube rack. Add 5 ml of the
corresponding urine sample to each test tube (Example: Add 5 ml of urine
sample A goes into test tube A). Add 10 drops of Benedict’s solution to each test
tube. Then, place all test tubes into a hot water bath (beaker on a hot plate). Let
them sit for 3 minutes. Using a test tube holder, remove from hot water bath, and
return to test tube rack. Record the color change in the below table. Then
record overall results in Table 3: In general, blue to blue-green or yellow-green is
negative, yellowish to bright yellow is a moderate positive for glucose, and bright
orange (or red) is a very strong positive for glucose.
Urine Sample
A
B
C
Color Before Hot Water Bath
Color After Hot Water Bath
6
Name
Section
5. Protein Test: Label test tubes: one test tube A, one test tube B, and the other
test tube C. Place the test tubes into a test tube rack. Add 5 ml of the
corresponding urine sample to each test tube (Example: Add 5 ml of urine
sample A goes into test tube A). Then, add 25 drops of Biuret’s reagent into
each test tube. Grab each tube, one at a time, out of the test tube rack and swirl
it around to mix the Biuret’s reagent with into the urine sample. Record the color
change in the below table. Then record the overall results in Table 3: In general,
if there is no color change and remains blue, it is negative; if the solution, turns
from blue to violet (deep purple) or blue to pink, then it is positive for proteins.
Urine Sample
A
B
C
Color Before Biuret’s Reagent
Color After Biuret’s Reagent
6. Chloride Test: Label test tubes: one test tube A, one test tube B, and the other
test tube C. Place the test tubes into a test tube rack. Add 5 ml of the
corresponding urine sample to each test tube (Example: Add 5 ml of urine
sample A goes into test tube A). Add 4 drops of silver nitrate (AgNO 3 ). Record
data in Table 3: If a white precipitate forms, it is positive for chloride.
Table 3: Record the results of each urine sample by stating whether they show normal or abnormal
results in each urine sample. (i.e., pH of 3, glucose present, no ketone, etc.)
Test
Color
pH
Ketone
Glucose
Protein
Chlorides
Urine Sample A
Urine Sample B
Urine Sample C
7. Obtain three urine test strips. Label the longer end of the test strips: one test
strip A, one test strip B, and the other test strip C. Dip test strip A in urine sample
A. Be sure that the chemically treated patches on the test strip are totally
immersed briefly (no longer than 1 second).
a. Draw the edge of the strip along the rim of the specimen container to
remove excess urine.
b. Turn the test strip on its side and tap once on a piece of paper towel to
remove any remaining urine to prevent any possible mixing of the
chemicals.
c. After 60 seconds, reads the results of the test strips by comparing it to the
following diagnostic color chart. Record results in Table 4.
d. Test the other two urine samples according to the previous directions.
7
Name
Section
Table 4: Record Urine test strip results by checking if the constituent is present or not. In most cases, a
negative result is normal urine.
Test
Urine Sample A
Negative Positive
Urine Sample B
Negative Positive
Urine Sample C
Negative Positive
Leukocytes
Nitrite
Urobiinogen
Protein
pH
Blood
Specific
Gravity
Ketone
Bilirubin
Glucose
8
Name
Section
Questions:
1. By analyzing the results of urinalysis and reading the background information of
this procedure, determine if the urine samples are normal urine or indicators of
what particular conditions (urinary tract infection, proteinuria, diabetes mellitus,
kidney failure or disease, dehydration, starvation, ketonuria, etc).
a. Urine Sample A result:
b. Urine Sample B result:
c. Urine Sample C result:
2. The hormone insulin promotes the uptake of glucose by cells. When glucose is
in the urine, either the pancreas is not producing insulin (diabetes mellitus type I)
or cells are resistant to insulin (diabetes mellitus type 2). Ketones (acids) are
also in the urine because the cells are metabolizing fat instead of glucose.
Explain why cells are metabolizing fat.
Why is the pH of urine lower than normal?
3. If you were a doctor and a patient’s urinalysis came back with an alkaline pH and
high levels of albumin (protein), what diagnosis would you immediately look into?
Laboratory Review:
1. Number the following structures to indicate their respective positions in relation to
the nephron. Assign number 1 to the part attached to the glomerular capsule.
loop of nephron
collecting duct
distal convoluted tubule
proximal convoluted tubule
renal pelvis
2. Name a substance that is in the glomerular filtrate but not in the urine.
3. Name the process by which molecules move from the proximal convoluted tubule
into the blood.
9
4. Does urinalysis prove the presence of disorders/ conditions or diseases?
Explain.
References
Amerman, Erin. C. (2016). Human Anatomy & Physiology. New York: Pearson.
Bono MJ, and Reygaert WC. Urinary Tract Infection. [Updated 2018 Nov 15]. In: StatPearls [Internet].
Treasure Island (FL): StatPearls Publishing; 2018 Jan-. Available from:
https://www.ncbi.nlm.nih.gov/books/NBK470195/
Desroches, Danielle, PhD. (2011). General Anatomy and Physiology II Laboratory Manual: Section C.
Wayne, NJ: William Paterson University.
Lab Manual Introductory Anatomy & Physiology. (2009). Retrieved from eScience Lab, Inc:
http://esciencelabs.com/files/product_pdfs/AandP-SampleLab.pdf
Leonard, Claire. PhD. (n.d.). Laboratory Manual for General Biology. Wayne, NJ: William Paterson
University.
Mader, Sylvia. S. (2018). Laboratory Manual for Human Biology (15th edition). New York: McGraw Hill
Education.
Onaivi, Emmanuel, PhD. and Donna R. Potacco, MS., MBA. (2005). Applied Anatomy and Physiology
Laboratory Manual (2nd Edition). New York: McGraw Hill Learning Solutions.
10
NAME
CLASS______________DATE____________
Reaction Time Experiment
A reaction is a voluntary response to the reception of a stimulus. Voluntary means that your
conscious mind initiates the reaction. An example is swatting a fly once it has landed in an
accessible spot. Because neurons must carry the sensory message to the cerebral cortex and the
message to the motor neuron to react, a reaction takes more time than a reflex. Reaction time
has the following components:
1.
2.
3.
4.
5.
6.
The time it takes for the stimulus to reach the receptive unit.
The time it takes for the receptor to process the message.
The time it takes for a sensory neuron to carry the message to the integration center.
The time it takes for the integration center to process the information.
The time it takes for a motor neuron to carry the response to the effector.
The time it takes for the effector to respond.
Visual reaction time can easily be measured with a reaction-time ruler. This device makes use of
the principle of progressive acceleration of a falling object. The acceleration of Gravity (g) is 9.8
m/s/s. That means that in freefall, at 1 second after release the object’s speed is 9.8
meters/second. But this speed increases by 9.8 seconds per second, so that by two seconds the
object is moving twice as fast, at 19.6 meters per second. How fast is it moving at 3 seconds?
You can see from the Reaction Time stick that the distance travelled by the stick increases the
longer it takes to catch it. (The intervals get larger as you go up the stick.)
How fast can you catch the Reaction Time stick? The measurments are in milliseconds
(thousandths of a second) and the labels range from 50 mSec to 400 mSec. So each “test” will
take no more than half a second.
Your reaction to the dropped stick is being measured. Your nervous system must sense and
respond to the stimulus, a dropped stick. Does your environment affect the way your nervous
system works? Will you have different reaction times under different conditions? Follow the
directions to design and conduct the experiments.
MATERIALS:
Per student group (4):
• Reaction Time Kit (Carolina Biological Supply Company)
• Chair or stool
• Calculator (optional)
PROCEDURE:
The following instructions are modified from the Reaction Time Kit Instructions booklet.
Decide what kind of distraction you will be testing. Set up the conditions for undistracted and
distracted testing. Some examples of distractions can include. Once you have decided on the
distraction, be consistent about it through the ten “distracted” tests:
Choose (and describe) what distraction you are testing:
___ Facebook
___ Instagram
___Watching a video (what video – website?)____________________
___Playing Candy Crush or other game (name of game?)______________
___Texting a friend
___Reading email
___Writing email
___Listening to music
___Eating a bag of candy or popcorn
___Other distraction (explain)_______________________________
You will complete two sets of 10 tests, with one set of tests undistracted and the other with
distracted conditions. You must alternate undistracted with distracted tests/trials, doing a
undistracted trial, followed by distracted, then undistracted, then distracted, and so on, until you
complete 10 of both.
Why would you want to design the experiment in that way, rather than just doing all ten of one
condition followed by all ten of the other condition?__________________________________
_____________________________________________________________________________
Test protocol:
1. The subject sits on a chair or stool.
2. The investigator stands facing the subject and holds the release end of the reaction-time
ruler with the thumb and forefinger of the dominant hand, at eye level or higher.
3. The subject positions the thumb and forefinger of the dominant hand around the thumb
line on the ruler. The space between the subject’s thumb and forefinger should be about
1 inch.
4. The subject tells the investigator when he or she is ready to be tested.
5. Once the investigator is told the subject is ready, at any time during the next 10 seconds,
the investigator lets go of the ruler.
6. The subject catches the ruler between the thumb and forefinger as soon as it starts to fall.
The line under his or her thumb represents visual reaction time in milliseconds.
7. The subject reads the reaction time from the ruler out loud, and the investigator records
the data in Table 1.
8. Repeat steps 1 through 7 ten times and calculate the average reaction time from the ten
trials.
9. Repeat steps 1 through 8 for each member of the group.
10. The reaction times of most of ten trials should be similar, but perhaps the first few or one
at random may be relatively different from the others. If this is true for your data,
suggest some reasons for this
variability.
Use these tables to record your data.
Describe the distraction: _____________________________________________________
Table 1: Recorded data for Reaction Time Experiment (mSec.)
Trial number
Undistracted reaction time
Distracted reaction time
1
2
3
4
5
6
7
8
9
10
Total
Average (Total/10)
Run the experiment again with a different distraction from the list:
Describe the distraction: ______________________________________________________
Table 2: Recorded data for Reaction Time Experiment (mSec.)
Trial number
Undistracted reaction time
Distracted reaction time
1
2
3
4
5
6
7
8
9
10
Total
Average (Total/10)
What real-life experiences where reaction time is critical could be affected by distractions?
Explain why you think this is the case, and why distracted reaction times differ from undistracted
times.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Name
Section
The Eye
Additional Exercises
Vision
1.Visual Acuity.
a. Visual acuity refers to the “sharpness” of your vision, or how well you can see detail.
Determine your visual acuity using a Snellen chart as directed by your instructor. If you wear
eyeglasses, perform this test both with and without them. Record your results in the table below.
A normal eye can read the line of letters marked 20 at 20 feet (red line) and is designated 20/20.
If the eye can read only the letter marked 200, it is designated 20/200, and so on. Such an eye
has myopia and is nearsighted. It is possible for an eye to be farsighted (hyperopia). These
conditions are usually the result of an elongated (myopia) or shortened (hyperopia) eyeball.
Visual Acuity
Without Corrective Lenses
With Corrective Lenses
Right Eye
Left Eye
b. Acuity can also be reduced by astigmatism. Astigmatism is caused when one of the
transparent surfaces (i.e., cornea or lens) of the eye is not uniformly curved in all planes.
Astigmatism may be detected by viewing a series of radiating lines on an astigmatism chart from
a distance of 10 feet. To astigmatic individuals some lines will look different, appearing sharper,
thicker, or darker than the other lines. Determine whether your right and/ or left eye is
astigmatic. If you wear eyeglasses, perform this test them and then without them. Note the
numbers of any lines that appear sharper, thicker, or darker in the table below. You can also
detect the correction for astigmatism in your eyeglasses by looking at the chart after rotating the
lenses 90⁰.
Astigmatism
Without Corrective Lenses
Right Eye
Left Eye
With Corrective Lenses
2. Color Vision
Color blindness is the inability to see colors in the usual way. It occurs when there is a problem
with the color-sensing granules (pigments) in certain nerve cells in the eye. These cells are
called cones. They are found in the retina, the light-sensitive layer of tissue that lines the back of
the eye. If just one pigment is missing, you may have a trouble telling the difference between
red and green. This is the most common type of color blindness. If a different pigment is
missing you may have trouble seeing blue-yellow colors. People with blue-yellow color
blindness usually have difficulty seeing reds and greens too. Color blindness can be tested with
Ishihara’s tests for Color Deficiency plates. The plates are held 30 inches from the subject and
tilted so the plane of the paper is at right angles to the line of vision. The numbers which are
seen on the plates are stated, and each answer should be given without more than 3 seconds
delay.
Note: It is not necessary in all cases to use the whole series of plates. Plates 12, 13, and 14 may
be omitted.
Do you have normal color vision or red-green color blindness?
Pupillary Reflex
1. The investigator shines the penlight into one of the subject’s eyes. Does the size of the pupil (the
opening into the eye that is surrounded by the iris, the pigmented part of the eye) get larger or
smaller?
2. Now turn off the penlight. Does the size of the pupil get larger or smaller?
3. Repeat steps 1 and 2 and note which is faster, constriction of the iris (which makes the pupil
smaller) or dilation of the iris (which makes the pupil larger).
is faster.
4. Ask if the subject is aware of the pupil’s changing diameter.
(yes or no)
5. The pupillary reflex is an autonomic reflex because it involves an autonomic motor neuron and,
in this case, smooth muscle. Can you deliberately inhibit the pupillary reflex?
(yes or no)
Optional
Sheep Eye Dissection
Bio 1200 Human Biology
Page 1 of 4
Name
Section
Handout: Family Pedigree and Virtual Babies Exercise
In this exercise you and a partner will use the principles of genetics to predict what traits your
offspring would have. The genotype (set of alleles) determines the phenotype for many traits.
Part 1: Determination of Phenotype and Genotype
For each of the following traits, record the phenotype (the trait’s appearance) of each of your
parents and yourself. Then determine your genotype for each trait.
Trait
Father’s
Phenotype
Mother’s
Phenotype
Your
Phenotype
Your possible
Genotypes
(circle them)
UU
Uu
uu
WW
Ww
ww
DD
Dd
dd
FF
Ff
ff
MM
Mm
mm
BB
Bb
bb
Earlobe
attachment
Widow’s
peak
Dimples
Freckles
Early-onset
myopia
Eye color
Trait Descriptions
Earlobes
The dominant trait is for lobes to hang free, a bit of lobe hanging down prior to the point where
the bottom of the ear attaches to the head. With the recessive phenotype, the lobes are attached
directly to the head.
Alleles: U, u
Dominant phenotype: Unattached (free) lobes
Recessive phenotype: attached earlobes
Bio 1200 Human Biology
Page 2 of 4
Hairline
Widow's Peak (below) is dominant over a straight hairline.
Alleles: W, w
Dominant phenotype: widow’s peak
Recessive phenotype: straight hairline
Facial Dimples
If you aren’t sure if you have them, smile! Dimples are easiest to see when smiling. With
dominant phenotype, you may have a dimple only on one side, or on both.
Alleles: D, d
Dominant phenotype: dimples present
Recessive phenotype: dimples absent
Bio 1200 Human Biology
Page 3 of 4
Freckles
The presence of freckles (any at all) is dominant over their absence.
Alleles: F, f
Dominant phenotype: Freckles
Recessive phenotype: no freckles
Early Onset Myopia (childhood)
Nearsightedness, or myopia, is a complex trait with at least 4 gene loci involved, however the
heritability of myopia is very high and shows a dominant pattern.
Alleles: M, m
Dominant phenotype: nearsightedness
Recessive phenotype: normal vision
Eye Color
We’re kind of cheating here. Eye color, as well as hair and skin color, is a complex trait. Not a
case of simple inheritance. The main pigment is melanin, and the more melanin, the darker the
color. Although the genetics of eye color is complex, alleles for the production of melanin
dominate those for lack of melanin. So if we evaluate eye color as being blue (recessive) or nonblue (dominant) we can treat it as a characteristic of simple inheritance.
Alleles: B, b
Dominant phenotype: non-blue eyes
Recessive phenotype: blue eyes
A. Choose one of these traits and draw a pedigree (family tree) of your family members,
showing the traits in each individual on the pedigree. Include as many family members as
you can: siblings, parents, grandparents, aunts, uncles, cousins. (See Lab Exercise 16,
pages 227-229, for how to draw a pedigree.)
Bio 1200 Human Biology
Page 4 of 4
B. Exchange genes with your lab partner virtually. To do so, fill out the following table.
Draw a sketch of your most likely first child that includes each of the traits.
Trait
Earlobe
attachment
Widow’s
peak
Dimples
Freckles
Early-onset
myopia
Eye color
Your
Genotype
Partner’s
Genotype
Children’s
Genotypic Ratio
Children’s
Phenotypic Ratio
Most likely
phenotype of first
child
Name
Section
Restriction Digestion of DNA Samples
The line through the base pairs represents the sites where bonds will break if the
restriction endonuclease EcoRI recognizes the site GAATTC.
Materials Required
Material
DNA Fingerprinting Kit
Distilled or deionized water
1-20 μl adjustable pipettes
Gel Electrophoresis Chamber w/ tray
Power Supply
Pipette tips (1-200 μl)
37ºC Waterbath
Ready Agarose Precast Mini Gels
Number Required
1
3.5 liters
1
1
1
1 rack
1
1
Instructors Advanced Preparation
1.1x TAE buffer and agarose gels will be made for you prior to your lab.
2.Each DNA sample will be prepared for you by rehydrating in sterile water.
3. Lyophilized EcoR1/ Pst I enzyme mix will be rehydrated in sterile water and stored on ice for
you.
4. Set up bulk digests
a. 6 colored microtubes will be labeled as follows:
green tube
blue tube
orange tube
violet tube
red tube
yellow tube
CS
S1
S2
S3
S4
S5
=crime scene
= suspect 1
= suspect 2
= suspect 3
= suspect 4
= suspect 5
b. DNA will be aliquoted into the following for you:
20 μl of Crime Scene DNA to the green tube
20 μl of Suspect 1 DNA to the blue tube
20 μl of Suspect 2 DNA to the orange tube
20 μl of Suspect 3 DNA to the violet tube
20 μl of Suspect 4 DNA to the red tube
20 μl of Suspect 5 DNA to the yellow tube
c. Then using a fresh tip for each tube add 2 μl of enzyme (ENZ) to each tube. Pipet up and down
to mix the DNA with the enzyme and discard the tip after each addition and firmly close the tube
lids.
d. Incubate the 6 tubes for 1 hour at 37°C water bath to allow the enzymes to digest the DNA.
e. After the digestion is complete, using a fresh tip for each tube, add 3 μl of DNA sample loading
dye (labeled LD) to each tube and mix by pipetting up and down.
5.DNA size marker (labeled M) will be prepared for you as follows:
a. 3 μl of DNA sample loading dye added to 15 μl of the HindIII lambda digest. This is the DNA
size marker. SAVE THIS TUBE WITH YOUR SAMPLES FOR NEXT LAB.
END of DNA and Biotechnology Part I
BEGINNNING of DNA and Biotechnology Part II (from this point on)
Gel Electrophoresis Procedure
1. If a centrifuge is available, pulse spin your colored microtubes to bring the contents to the
bottom of the tube. Otherwise, gently tap the tubes on the table top.
2. Place the casting tray with the solidified gel in it, into the platform in the electrophoresis
chamber. The wells should be at the (-) cathode end of the chamber, where the black lead is
connected. If necessary, very carefully, remove the comb from the gel by gently pulling it straight
up.
3. Pour ~ 275 ml of electrophoresis buffer into the electrophoresis chamber. Pour buffer in the
chamber until it just covers the wells of the gel by 1–2 mm.
4. Using a fresh pipet tip load 15 μl of the DNA size marker (M) from the clear tube into lane 1 of
your agarose gel. (The whole contents of the clear tube will be added to the gel well.) Gels are
read from left to right. The first sample is loaded in the well at the top left hand corner of the gel.
5. Then using a fresh pipet tip for each sample load 15 μl of each of the samples from the crime
scene and suspects into the other lanes in the following order:
Lane 2: CS, green, 15 μl
Lane 3: S1, blue, 15 μl
Lane 4: S2, orange, 15 μl
Lane 5: S3, violet, 15 μl
Lane 6: S4, red, 15 μl
Lane 7: S5, yellow, 15 μl
(Please note there will be extra contents in each tube.)
6. Secure the lid on the electrophoresis chamber. The lid will attach to the base in only one
orientation: red to red and black to black. Connect electrical leads to the power supply.Turn on
the power supply. Set it for 100 V and electrophorese the samples for 40 minutes.
7. When the electrophoresis is complete, turn off the power supply and remove the lid from the
chamber. Carefully remove the gel tray and the gel from the electrophoresis chamber. Be careful,
the gel is very slippery!
8. Instructions for staining your gel are as follows:
Please note that although Fast Blast DNA Stain is non-toxic it can stain skin, clothing and
furniture so care must be taken when using this stain. WEAR GLOVES.
NOTE: You may want to increase destaining time from 5 minutes to 10 minutes each rinse.
DNA Fingerprinting Lab – Student Questions
1. What can you assume is contained within each band?
2. What would be a logical explanation as to why there is more than one band of DNA
for each of the samples?
3. What caused the DNA to become fragmented?
4. Which of the DNA samples have the same number of restriction sites for the restriction
endonucleases used? Write the lane numbers.
5. What determines where a restriction endonuclease will “cut” a DNA molecule?
6. Which sample has the smallest DNA fragment?
7. Do any of your suspect samples appear to have EcoRI or PstI recognition sites at the
same location as the DNA from the crime scene?
8. Based on the above analysis, do any of the suspect samples of DNA seem to be from
the same individual as the DNA from the crime scene? Describe the scientific evidence
that supports your conclusion.
How to Use a Pipetman
1. Smaller volumes of a liquid can be measured more accurately with devices other than
graduated cylinders, such as pipettes. Pipettes can measure milliliters or microliters.
Pipettes come in different volumes, such as 1 ml, 5 ml, 10 ml or 25 ml. You can also use
Pipetman that can measure different volumes in microliters. A P20 measures volumes
between 0 μl and 20 μl. A P200 measures volumes between 20 μl and 200 μl. A P1000
measures volumes between 200 μl and 1000 μl (1000 μl = 1 ml). (Figure 1.2.) Set the
P20 onto 12.5 μl by adjusting the volume adjustment knob clockwise until the volume
indicator shows 12 (in black) and 5 (in red) (Figure 1.3). Attach a disposable tip to the
pipette shaft. Press the plunger to the FIRST STOP. Holding the Pipetman vertically,
immerse the tip into the sample. Allow the pushbutton to return slowly to the UP
position. Never let it snap up. Pause briefly to ensure that the full volume of sample is
drawn into the tip. Withdraw the tip from the sample liquid. To dispense sample, touch
the tip end against the side wall of the receiving vessel and depress the plunger slowly to
the first stop. Then press the plunger to the second stop, expelling any residual liquid in
the tip. With the plunger fully pressed, withdraw the Pipetman from the vessel carefully,
tip against the vessel wall. Allow the plunger to return to the up position. Discard the tip
by depressing the tip ejector button.
Figure 1.2 Components of a Pipetman.
Figure 1.3 Volume Indicator on a Pipetman P20. On
the actual Pipetman, the 5 is red.
Name
Section
Extract your own DNA
Have you ever wanted to see what makes you, you?
DNA is a complex molecule that is found in the nucleus of the cells in the human body and
other living organisms. Nearly every cell in a person’s body has the same DNA. You cannot
see DNA with the naked eye, but it can become visible in large volume. In this experiment, you
will collect some skin cells from the inside of your mouth, break apart the cells, and release the
DNA. The DNA will be concentrated in a liquid of dish soap, table salt, and ethanol.
Materials:
•
•
•
•
•
•
•
Small tube – 1.5 ml
Large graduated tube with cap – 15 ml
Saliva
Clear dish detergent
A pinch of table salt
Contact lens cleaning solution
Ethanol
Methods:
1.
2.
3.
4.
5.
6.
7.
Add approximately 1 mL of saliva to the test tube.
Add 2 drops of dish detergent to your tube of saliva.
Add 3 drops of contact lens cleaning solution.
Add a pinch of table salt to the soapy saliva.
Mix the solution in the tube for a minute by gently flicking or inverting the tube.
Transfer the salted soapy saliva into a large tube.
Add 5-6 mL of the ethanol and gently invert the tube to mix (make sure you have the
cap on). Do not shake the tube.
8. Let the tube sit for 5 minutes.
These white clumps and strings are your DNA!
What happened?
Your cells are broken open by the dish detergent, which disrupts the cell membranes, releasing
out the contents of cells into the saliva solution. These contents are proteins, sugars, DNA,
and RNA.
The contact lens cleaning solution contains protease (an enzyme that degrades protein). A few
drops of this cleaning solution should decrease the amount of protein that precipitates out with
your DNA.
The salt helps aggregate and clump DNA molecules together due to the positively-charged ions
in the salt and the negative charge of DNA.
DNA is not soluble in alcohol, so it forms a solid where the alcohol and salt water layers meet.
It will appear as white, cloudy clumps which are thousands of DNA molecules grouped
together. Single DNA molecules are far too small to see with the naked eye.
Questions:
1. What is DNA? Where is it found?
2. What material causes DNA to be released from a cell?
3. What does DNA look like after it has been extracted?
4. If DNA is so small it fits into one cell, how are we able to see it with our eyes after
extraction?
NC DNA Day. (2011). 5-Minute DNA Extraction. Retrieved 10 December 2018. http://ncdnaday.org/ondemand/wpcontent/uploads/2011/08/5-minute-DNA-Extraction.pdf.
PBS: NOVA. (2012) Extract Your Own DNA. Retrieved 10 December 2018. http://www.planetscience.com/categories/experiments/biology/2012/03/extract-your-own-dna.aspx.
Washington University School of Medicine. (n.d.) DNA Extraction: Teacher Handout. Retrieved 30 December 2018.
http://ysp.wustl.edu/KitCurriculum/DNAExtraction/DNA%20Extraction-Teachers.pdf
Name
Section
Genes and Gene Expression: Replication, Transcription & Translation
1. Define:
DNA Replication –
Transcription –
Translation –
2. Below is a picture of DNA “unzipping” in preparation for mRNA transcription.
a. Show how the mRNA is created by writing in the appropriate complementary base pairs within the
DNA fork depicted. Note that only one strand is a “coding strand.”
(coding strand)
b.
Where is this process taking place within a cell? How is this different from DNA replication?
3. You will now practice translation of the mRNA code into chains of amino acids (polypeptides/proteins). Use the
tables on the next page to translate each codon to the appropriate amino acid.
Example - Translate the following mRNA sequence:
AUGGAAAAUUGGCUUCUGUGUAGGUAUACCUAUGAUUAG
Answer - Divide the sequence into triplets:
AUG-GAA-AAU-UGG-CUU-CUG-UGU-AGG-UAU-ACC-UAU-GAU-UAG
And assign the correct amino acid for each triplet based on the table below:
Met (START)-Glu-Asn-Trp-Leu-Leu-Cys-Arg-Tyr-Thr-Tyr-Asp-STOP
When you reach a terminator triplet (UAA, UAG, or UGA), you need to end the amino acid chain and start
a new one if there is a new start codon (AUG).
Try translating the following mRNA sequences yourself:
a. AUG/GAU/AGU/UGU/CCU/CUG/CAU/CGA/UCG/GGG/UGA
b.
AUGGACGUAUAGAUGACAGGUAGAUGCUGAAUGGGGAUUUAUCGAUAG
c.
Where is the process of translation taking place within a cell?
Table of Standard Genetic Code