12/10/18 Lectures 25-27 Goals: 1. The human Genome Project 2. Evolutionary Genetics 3. Evolution of genes within populations 4. Evolutionary forces: Selection and drift 5. Measuring sequence evolution The Human Genome Project Reveals Many Important Aspects of Genome Organization in Humans Variations and Mutations Identification of about 3 million locations where single-base DNA differences (SNPs) occur in humans • The Human Genome Project (HGP) was a coordinated effort to sequence and identify all the genes of the human genome. This information promises to revolutionize the processes of finding chromosomal locations for disease-associated sequences andPrograms, tracing U.S. Department of Energy Genome Genomicshuman and Its Impact onhistory Science and Society, 2003 1 12/10/18 Comparative genomics (intra- or inter-species) can answer many of these questions U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003 2 12/10/18 Comparative genomics has been valuable in identifying members of multigene families including nonfunctional pseudogenes. A group of related multigene families is called a superfamily. We care to identify how the sequences changed through time So where are we now? And where do we want to be? So where are we now? And where do we want to be? 3 12/10/18 So where are we now? And where do we want to be? So where are we now? And where do we want to be? HapMap An NIH program to chart genetic variation within the human genome The Art and Science of Personalized Medicine M Piquette-Miller and D M Grant 4 12/10/18 Genome wide associations between DNA changes and phenotypes 1000 Genomes Project So where are we now? And where do we want to be? ELSI: Ethical, Legal, and Social Issues • Privacy and confidentiality of genetic information. • Fairness in the use of genetic information by insurers, employers, courts, schools, adoption agencies, and the military, among others. • Psychological impact, stigmatization, and discrimination due to an individual’s genetic differences. • Reproductive issues including adequate and informed consent and use of genetic information in reproductive decision making. • Clinical issues including the education of doctors and other health-service providers. U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003 5 12/10/18 Genetic Information Nondiscrimination Act An act to prohibit discrimination on the basis of genetic information with respect to health insurance and employment (May 21, 2008) Populations Population: a group of individuals with a common set of genes that lives in the same geographic area and can or does interbreed. Evolution Genetic variation Adaptation 6 12/10/18 Allele frequency: the proportions of an allele within a gene pool (A vs. a) Genotype frequency: the proportion of a genotype within a population (AA, Aa, or aa) Gene pool: all alleles at all loci within all individuals in a population Evolution: change in allele frequency (genetic make up) over time within a population 40% A 60% a 60% A 40% a Calculating Genotypic Frequencies Calculating Allelic Frequencies 7 12/10/18 Calculating Allelic Frequencies The Hardy-Weinberg Law Describes the Effect of Reproduction on Genotypic and Allelic Frequencies If a population is large, randomly mating, and not affected by mutation, migration, or natural selection, then: 1. the allelic frequencies of a population do not change Calculating Allelic Frequencies from genotypic frequencies The sum of the allelic frequencies always equals 1 (p + q = 1) The Hardy–Weinberg law indicates that, when the assumptions are met, reproduction alone does not alter allelic or genotypic frequencies and the allelic frequencies determine the frequencies of genotypes. When genotypes are in the expected proportions of p2, 2pq, and q2, the population is said to be in Hardy–Weinberg equilibrium. 2. the genotypic frequencies stabilize (will not change) after one generation in the proportions p2 (the frequency of AA), 2pq (the frequency of Aa), and q2 (the frequency of aa), where p equals the frequency of allele A and q equals the frequency of allele a. Genotypic frequencies at HW equilibrium The multiplication rule of probability can be used to determine the probability of various gametes pairing. 8 12/10/18 Implications of the H-W law 1. a population cannot evolve if it meets the H-W assumptions (reproduction alone will not bring about evolution). 2. the genotypic frequencies are determined by the allelic frequencies. Hardy-Weinberg Equation p2 + 2pq + q2 = 1 frequency of genotypes The H-W principle has a similar function to the Punnet square, but for populations: can be used to calculate the frequency of particular alleles frequency of genotypes Gene with two alleles: A and a Three genotypes are possible: AA, Aa, and aa Example: single locus with A or a allele. Frequency of A and a within the population is 0.7 and 0.3, respectively. Applying p + q = 1, we find 0.7 + 0.3 = 1, indicating all alleles are accounted for. To determine is the offspring are in HW equilibrium: The frequency of allele A in a population is p The frequency of allele a in a population is q p+q=1 The resulting frequency of the genotypes in the new generation will be: p2 + 2pq + q2 = 1 AA = p2 aa = q2 Aa = 2pq 9 12/10/18 The Hardy-Weinberg principle serves as a null hypothesis for determining whether evolution is acting on a particular gene (allele) in a population. Nonrandom mating nonrandom mating alters the frequencies of the genotypes but the the frequencies of the alleles When genotype frequencies do not conform to Hardy-Weinberg proportions, evolution or nonrandom mating is occurring in that population. Inbreeding increases the percentage of homozygous individuals in a population Evolution Several evolutionary forces change the allelic frequencies 1. Mutation 2. Migration (gene flow) 3. Genetic drift 4. Natural selection F=inbreeding coefficient 10 12/10/18 Mutation Creates New Alleles in a Gene Pool Recurrent mutation changes allelic frequencies Mutation: a change in an organism’s DNA ATCGGCGCGCGCAGAAGGAGAGC ATCGGCGCGAGCAGAAGGAGAGC Forward and reserve mutations eventually lead to a stable equilibrium Migration (Gene Flow) Can Alter Allele Frequencies by introducing alleles from other populations Migration decreases the genetic differentiation between populations and increases the genetic differentiation within populations The magnitude of change depends on: 1. Extend of migration 2. Difference in allelic frequencies between the two populations 11 12/10/18 Genetic Drift: a change in a population’s allele frequency due to chance Main causes of drift a. The Bottleneck Effect: genetic drift due to a reduction in population size Populations diverge in allelic frequency and become fixed for one allele due to drift b. The Founder Effect: genetic drift in a new colony 12 12/10/18 The effects of drift 2. Within: reduce of genetic variation within populations 1. Within: changes the allelic frequencies within a population 3. Between: different populations diverge genetically with time Natural selection (the differential reproduction of genotypes): adapts a population to its environment i. stabilizing selection: when individuals with intermediate traits reproduce more than others, thereby maintaining intermediate phenotypes in a population. 13 12/10/18 ii. directional selection: the genotypes conferring phenotypic extremes are selected, resulting in change in the population mean over time. After decrease in insect population iii. disruptive selection: occurs when intermediate phenotypes are selected against and extreme phenotypes are favored. Disruptive selection maintains genetic variation. 14 12/10/18 iv. overdominance selection: heterozygote genotypes are favored Heterozygote advantage: Sickle Cell Anemia Evolutionary change and speciation 15 12/10/18 Calculating evolutionary change Calculating evolutionary change Calculating evolutionary change 16 12/10/18 Calculating evolutionary change Calculating evolutionary change The simplest is: The number of nucleotide (or amino acid) differences (nd) between two sequences (of equal size n) More convenient is: The proportion of differences (p) between two sequences (of variable size) p distance pˆ = nd / n Calculating evolutionary change Calculating evolutionary change 17 12/10/18 Assuming that the rate is constant (true only for very small evolutionary time)= molecular clock Sequence Divergence can be transformed in divergence time THANK YOU The end 18