Lecture25 27

advertisement
12/10/18
Lectures 25-27
Goals:
1. The human Genome Project
2. Evolutionary Genetics
3. Evolution of genes within populations
4. Evolutionary forces:
Selection and drift
5. Measuring sequence evolution
The Human Genome Project Reveals Many Important Aspects of
Genome Organization in Humans
Variations and Mutations
Identification of about 3 million locations where single-base DNA
differences (SNPs) occur in humans
•  The Human Genome Project (HGP)
was a coordinated effort to sequence
and identify all the genes of the human
genome.
This information promises to revolutionize the processes of
finding chromosomal locations for disease-associated
sequences
andPrograms,
tracing
U.S.
Department of Energy Genome
Genomicshuman
and Its Impact onhistory
Science and Society, 2003
1
12/10/18
Comparative genomics (intra- or inter-species) can answer
many of these questions
U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003
2
12/10/18
Comparative genomics has been valuable in identifying members
of multigene families including nonfunctional pseudogenes.
A group of related multigene families is called a superfamily.
We care to identify how the sequences changed
through time
So where are we now? And where do we want to be?
So where are we now? And where do we want to be?
3
12/10/18
So where are we now? And where do we want to be?
So where are we now? And where do we want to be?
HapMap
An NIH program to chart genetic
variation
within the human genome
The Art and Science of Personalized Medicine
M Piquette-Miller and D M Grant
4
12/10/18
Genome wide associations between DNA changes
and phenotypes
1000 Genomes Project
So where are we now? And where do we want to be?
ELSI: Ethical, Legal, and Social Issues
• Privacy and confidentiality of genetic information.
• Fairness in the use of genetic information by insurers,
employers, courts, schools, adoption agencies, and the military,
among others.
• Psychological impact, stigmatization, and discrimination
due to an individual’s genetic differences.
• Reproductive issues including adequate and informed consent
and use of genetic information in reproductive decision making.
• Clinical issues including the education of doctors and other
health-service providers.
U.S. Department of Energy Genome Programs, Genomics and Its Impact on Science and Society, 2003
5
12/10/18
Genetic Information Nondiscrimination Act
An act to prohibit discrimination on the basis of
genetic information with respect to health
insurance and employment (May 21, 2008)
Populations
Population: a group of individuals with a common
set of genes that lives in the same geographic
area and can or does interbreed.
Evolution
Genetic variation
Adaptation
6
12/10/18
Allele frequency: the proportions of an allele
within a gene pool (A vs. a)
Genotype frequency: the proportion of a
genotype within a population (AA, Aa, or aa)
Gene pool: all alleles at all loci
within all individuals in a
population
Evolution: change in allele
frequency (genetic make up) over
time within a population
40% A
60% a
60% A
40% a
Calculating Genotypic Frequencies
Calculating Allelic Frequencies
7
12/10/18
Calculating Allelic Frequencies
The Hardy-Weinberg Law Describes the Effect of
Reproduction on Genotypic and Allelic Frequencies
If a population is large, randomly mating, and not
affected by mutation, migration, or natural
selection, then:
1. the allelic frequencies of a population do not change
Calculating Allelic Frequencies from genotypic frequencies
The sum of the allelic frequencies always equals 1
(p + q = 1)
The Hardy–Weinberg law indicates that, when the
assumptions are met, reproduction alone does
not alter allelic or genotypic frequencies and the
allelic frequencies determine the frequencies of
genotypes.
When genotypes are in the expected
proportions of p2, 2pq, and q2, the population
is said to be in Hardy–Weinberg equilibrium.
2. the genotypic frequencies stabilize (will not change)
after one generation in the proportions p2 (the
frequency of AA), 2pq (the frequency of Aa), and q2
(the frequency of aa), where p equals the frequency of
allele A and q equals the frequency of allele a.
Genotypic frequencies at HW equilibrium
The multiplication rule of probability can be used to determine
the probability of various gametes pairing.
8
12/10/18
Implications of the H-W law
1.  a population cannot evolve if it meets the H-W
assumptions (reproduction alone will not bring
about evolution).
2.  the genotypic frequencies are determined by the
allelic frequencies.
Hardy-Weinberg Equation
p2 + 2pq + q2 = 1
frequency of genotypes
The H-W principle has a similar function to the Punnet
square, but for populations: can be used to calculate the
frequency of particular alleles
frequency of genotypes
Gene with two alleles: A and a
Three genotypes are possible: AA, Aa, and aa
Example: single locus with A or a allele. Frequency of A and a
within the population is 0.7 and 0.3, respectively. Applying
p + q = 1, we find 0.7 + 0.3 = 1, indicating all alleles are
accounted for. To determine is the offspring are in HW
equilibrium:
The frequency of allele A in a population is p The frequency of allele a in a population is q
p+q=1
The resulting frequency of the genotypes in the new generation will be: p2 + 2pq + q2 = 1
AA = p2
aa = q2
Aa = 2pq
9
12/10/18
The Hardy-Weinberg principle serves as a null
hypothesis for determining whether evolution is
acting on a particular gene (allele) in a population.
Nonrandom mating
nonrandom mating alters the frequencies of the
genotypes but the the frequencies of the alleles
When genotype frequencies do not conform to
Hardy-Weinberg proportions, evolution or
nonrandom mating is occurring in that population.
Inbreeding increases the percentage of homozygous
individuals in a population
Evolution
Several evolutionary forces change the allelic
frequencies
1. Mutation
2. Migration (gene flow)
3. Genetic drift
4. Natural selection
F=inbreeding coefficient
10
12/10/18
Mutation Creates New Alleles in
a Gene Pool
Recurrent mutation changes allelic frequencies
Mutation: a change in an organism’s
DNA
ATCGGCGCGCGCAGAAGGAGAGC
ATCGGCGCGAGCAGAAGGAGAGC
Forward and reserve mutations eventually lead to a stable
equilibrium
Migration (Gene Flow) Can Alter Allele
Frequencies by introducing alleles from
other populations
Migration decreases the genetic differentiation
between populations
and
increases the genetic differentiation within populations
The magnitude of
change depends
on:
1.  Extend of migration
2.  Difference in allelic
frequencies
between the two
populations
11
12/10/18
Genetic Drift: a change in a population’s
allele frequency due to chance
Main causes of drift
a. The Bottleneck Effect: genetic drift due to a
reduction in population size
Populations diverge in allelic
frequency and become fixed
for one allele due to drift
b. The Founder Effect: genetic drift in a new colony
12
12/10/18
The effects of drift
2. Within: reduce of genetic variation within populations
1. Within: changes the allelic frequencies within a population
3. Between: different populations diverge genetically with time
Natural selection (the differential
reproduction of genotypes):
adapts a population to its environment
i. stabilizing selection:
when individuals
with intermediate
traits
reproduce more
than others,
thereby
maintaining
intermediate
phenotypes in a
population.
13
12/10/18
ii. directional selection:
the genotypes
conferring
phenotypic
extremes are
selected, resulting
in change in the
population
mean over time.
After decrease in
insect population
iii. disruptive selection:
occurs when
intermediate
phenotypes are
selected against
and extreme
phenotypes are
favored.
Disruptive
selection maintains
genetic variation.
14
12/10/18
iv. overdominance
selection:
heterozygote
genotypes are favored
Heterozygote
advantage: Sickle
Cell Anemia
Evolutionary change
and speciation
15
12/10/18
Calculating evolutionary change
Calculating evolutionary change
Calculating evolutionary change
16
12/10/18
Calculating evolutionary change
Calculating evolutionary
change
The simplest is:
The number of nucleotide (or amino
acid) differences (nd) between two
sequences (of equal size n)
More convenient is:
The proportion of differences (p)
between two sequences (of
variable size)
p distance
pˆ = nd / n
Calculating
evolutionary change
Calculating evolutionary change
17
12/10/18
Assuming that the rate is constant (true only for very small
evolutionary time)= molecular clock
Sequence Divergence can be transformed in divergence time
THANK YOU
The end
18
Download
Related flashcards
Create Flashcards