Veterinary Microbiology 148 (2011) 8–17
Contents lists available at ScienceDirect
Veterinary Microbiology
journal homepage: www.elsevier.com/locate/vetmic
Research article
Protective immune responses induced by in ovo immunization
with recombinant adenoviruses expressing spike (S1) glycoprotein
of infectious bronchitis virus fused/co-administered with
granulocyte-macrophage colony stimulating factor
Basit Zeshan, Muhammad Hassan Mushtaq, Xinglong Wang, Wenliang Li, Ping Jiang *
Key Laboratory of Animal Diseases Diagnostic and Immunology, Ministry of Agriculture, College of Veterinary Medicine, Nanjing Agricultural University,
Nanjing 210095, China
A R T I C L E I N F O
A B S T R A C T
Article history:
Received 14 February 2010
Received in revised form 29 July 2010
Accepted 6 August 2010
Infectious bronchitis virus (IBV) causes tremendous economic losses associated with
production inefficiencies and mortality in poultry industry worldwide. In the present
report, the recombinant adenoviruses expressing chicken granulocyte-macrophage
colony stimulating factor (GM-CSF) and S1 gene of nephropathogenic IBV were
constructed and characterized. Then, the immunological efficacy and protection against
homologous IBV challenge were assessed in specific pathogen free (SPF) chickens. The
results showed that the chickens vaccinated in ovo with rAd-S1, rAd-GM-S1 (GM-CSF
fused with S1 using glycine linkers) and rAd-GM-CSF plus rAd-S1 (co-administered)
developed specific anti-IBV HI antibodies. Moreover, the fusion of the GM-CSF markedly
increased spleen cell proliferation and IFN-g production while mild increased in IL-4
production, which demonstrated the enhancement of cell-mediated immune responses.
Following challenge with IBV, the chickens in the group vaccinated with rAd-S1 fused or
co-administered with GM-CSF had fewer nephropathic lesions and showed 100%
protection as compared to that of rAd-S1 alone which showed 70% protection. It indicated
that the single dose in ovo vaccination of the GM-CSF fused or co-administered with S1 of
IBV could enhance significantly the humoral, cellular immune responses and provide
complete protection against nephropathogenic IBV challenge. This finding may provide
basic information for effective in ovo vaccines design against IBV.
ß 2010 Elsevier B.V. All rights reserved.
Keywords:
Infectious bronchitis virus
In ovo
S1
GM-CSF
Immune responses
1. Introduction
Infectious bronchitis virus, a member of Coronaviridae
virus family, is the causative agent of an acute, highly
contagious respiratory, renal, and urogenital disease of
chicken. Its 27.6-kb single-stranded RNA genome of
positive polarity encodes for four major structural
proteins, the nucleocapsid, membrane, envelope and spike
(S) proteins. The S glycoprotein is proteolitically processed
* Corresponding author. Tel.: +86 25 84395504; fax: +86 25 84396640.
E-mail address: jiangp@njau.edu.cn (P. Jiang).
0378-1135/$ – see front matter ß 2010 Elsevier B.V. All rights reserved.
doi:10.1016/j.vetmic.2010.08.003
into two non-covalently bound peptide chains known as S1
and S2 (Stern and Sefton, 1982). It is well known that the
spike (S) protein of IBV is the main inducer of antibodies for
virus neutralization and haemagglutination inhibition.
Furthermore, the amino-terminal S1 half is sufficient to
induce good protective immunity (Cavanagh, 2007). In
spite of the extensive use of vaccines, nephrotropic IBV
outbreaks are frequent in the world (Liu and Kong, 2004;
Liu et al., 2006). It is necessary to develop new vaccine to
control this disease. Recent years many studies have
demonstrated the efficacy of genetically engineered IBV
vaccine including, recombinant fowl adenovirus expressing
the S1 gene of IBV (Johnson et al., 2003), recombinant
B. Zeshan et al. / Veterinary Microbiology 148 (2011) 8–17
fowlpox virus co-expressing IBV S1 and ChIFN-g gene (Y.F.
Wang et al., 2009), DNA vaccines expressing multiepitopes of IBV (Tian et al., 2008) and S1 protein expressed
in plants (Zhou et al., 2003) and baculovirus system (Song
et al., 1998). And the efficiency of the genetically
engineered IBV vaccines was up-regulated by co-delivery
of cytokines to increase the immune response of vaccine
antigens (Y.F. Wang et al., 2009; Tarpey et al., 2007).
Granulocyte-macrophage colony stimulating factor
(GM-CSF) is a cytokine that enhances immune responses
by attracting macrophages and inducing their maturation,
thus resulting in increased antigen presentation (Shi et al.,
2006; Heufler et al., 1988). It has been noted to augment
the immunogenicity and therapeutic efficacy of tumor
vaccines (Mach et al., 2000; Chianese-Bullock et al., 2005;
Slingluff et al., 2003), hepatitis B vaccines (Kapoor et al.,
1999) and chimeric simian immunodeficiency virus-like
particles vaccine (Skountzou et al., 2007). Recently we
have reported that the recombinant adenovirus expressing
GM-CSF fused with VP1 antigens of foot-and-mouth
disease virus (Du et al., 2007) and GP3, GP5 of porcine
reproductive and respiratory syndrome virus (X. Wang et
al., 2009) enhanced immune responses and protection
against virulent challenges in pigs. The potency of Advectored vaccines in chickens was shown by stimulating
protective immune responses following intramuscular
(Gao et al., 2006) and in ovo (Toro et al., 2007)
administration in single dose regimen. Here, we firstly
constructed the recombinant adenoviruses expressing
chicken granulocyte-macrophage colony stimulating factor and S1 gene of IBV (rAd-GM-S1, rAd-S1, rAd-GM-CSF)
and found that rAd-S1 fused or co-administered with GMCSF could induce strong cellular, humoral immune
responses and provide complete protection against IBV
challenge in chickens.
2. Materials and methods
2.1. Embryonated eggs and chickens
The specific-pathogen-free (SPF) chicken embryos and
one 20-day-old white leghorn chicken (for bone marrow
proliferation assay) were purchased from Nanjing TechBank Bio-Industry Co. Ltd., Nanjing, China. Embryonated
chickens eggs were hatched in SPF environment and were
transferred to negative pressure isolators for the remainder of the experiments. A crumbled chick starter diet was
provided ad libitum during the course of the experiments.
10-Day-old SPF embryonated chicken eggs were used to
propagate XDC-2 strain of IBV in the allantoic cavities and
allantoic fluid was harvested 36 h post-inoculation.
The use of all laboratory animals and animal subjects
was approved by the Institutional Animal Care and Use
Committee of Nanjing Agricultural University.
2.2. Viruses and cells
Human embryo kidney cells (HEK-293A) were used to
generate recombinant and wild-type replication incompetent (E1/E3-defective) human adenoviruses serotype 5
(Ad5) as described by Luo et al. (2007). MARC-145 cells
9
were used to produce GM-CSF after infection of recombinant adenoviruses. HEK-293A and MARC-145 cells were
cultured in Dulbecco Modified Eagle Medium (DMEM)
supplemented with 10% fetal bovine serum (FBS), 2 mM Lglutamine, 100 U penicillin ml1 and 100 mg streptomycin
ml1. Chicken bone marrow cells were grown in RPMI-10
medium (RPMI 1640 medium supplemented with 5% fetal
bovine serum, 5% chicken serum). The nephropathogenic
IBV strain XDC-2 was isolated from the kidney of chicken
showing typical signs of IBV (Zhang et al., 2009) and was
stored at 70 8C after freeze-drying.
2.3. Amplification of mature peptide of chicken GM-CSF gene
The active mature peptide of GM-CSF gene was
amplified from, pCl-neo-GM-CSF (kindly provided by Dr.
Pete Kaiser, Division of Immunology, Institute for Animal
Health, Compton, UK) using forward and reverse primers
containing 5 glycine nucleotides or stop codon (Table 1).
The amplification was performed in a 50 ml reaction
mixture containing 1.5 mM MgCl2, 1 PCR buffer, 0.2 mM
of dNTP, 20 pM of each primer, 1.5 U of Taq DNA
polymerase (Promega, Madison, USA) and 1 ml of recombinant plasmid. The reaction was run in a thermocycler
(PTC-150) with the following program: preheat at 94 8C for
5 min, 35 cycles composed of denaturation at 94 8C for 45 s,
annealing at 58 8C for 45 s and extension at 72 8C for 45 s,
and was ended with a final extension at 72 8C for 10 min.
2.4. Amplification and cloning of the S1 gene of IBV
For amplification of S1 gene, a pair of primer (Table 1)
was designed based on S1 sequence published in GenBank
(accession no. AY427819). RNA was extracted from IBV
propagated allantoic fluid by using TRIzol1 102 reagent
(Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Reverse transcription PCR reaction
was performed as above. Complete S1 gene (1650 bp) was
amplified from cDNA and cloned into pMD18T vector
(TaKaRa Biotechnology Co. Ltd., Dalian, China) designated
as pMD18T-S1.
2.5. Construction and generation of recombinant
adenoviruses
PCR amplicon of GM-CSF was cloned into pAdTrack
vector using BglII and XhoI, resulting pAdTrack-GM-CSF
plasmid. To construct the recombinant transfer vectors,
complete S1 gene was digested from pMD18T-S1 with XhoI
and cloned into the pAdTrack and pAdTrack-GM-CSF
vectors using XhoI sites under transcriptional control of
the human cytomegalovirus (CMV) early promoter (Fig. 1).
As S1 could ligate in either direction; the successful
ligation and orientation were confirmed by restriction
digestion with HindIII (S1 gene contain HindIII site at
position 164) and sequencing.
The recombinant adenoviral vectors were generated by
homologous recombination of PmeI linearized transfer
vectors with the pAdEasy-1 in Escherichia coli BJ5183 and
confirmed by restriction enzyme digestion with PacI (New
England Biolabs). The recombinant adenoviruses were
B. Zeshan et al. / Veterinary Microbiology 148 (2011) 8–17
10
Table 1
Primer sequences for amplification of GMCSF and S1 gene of XDC-2 strain of IBV.
S no.
[(Fig._1)TD$IG]
1
2
3
4
5
6
7
Primer I.D.
GM-F
GM-R
GM-R
S1-F
S1-R
S1 D-F
S1 D-R
Sequence
0
5
50
50
50
50
50
50
0
GAGAGATCTATGACCACAACATACTC 3
GACCTCGAGACCGCCACCGCCACCGATGCAGTCTT 30
GACCTCGAG TTAGATGCAGTCTT 30
GCGCTCGAGATGTTGGGGAAGTCACTG 30
CGCCTCGAGTTACATTTTGGTCATAGAA 30
GCGGGATCCATGGATAGTTATGTTT 30
CACCACCTTTATTGCCTGCATTATT 30
Enzyme site
Gene (size)
BglII
XhoI
XhoI
XhoI
XhoI
BamH1
No site
GMCSF (405 bp)
S1 (1650 bp)
S1 D (150 bp)
Fig. 1. Schematic design of recombinant transfer vectors, the GM-CSF and S1 genes were cloned into pAdTrack-CMV tandem in frame. The linker between
these genes was 5 glycine.
generated by transfection of 1 mg plasmids (PacI linearized) using 3 ml of Trans FastTM Transfection Reagent
(Promega, Madison, USA) and the cells were monitored for
expression of green fluorescent protein (GFP). When 90% of
the cells showed cytopathic effect, adenoviruses was
released by three cycles of rapid freezing and thawing
and, purified by sedimentation through a cesium chloride
gradient (L8-M Ultracentrifuge; Beckman SW40 Ti rotor,
32,000 U/min, 20 8C, 20 h). Purified virus was dialyzed
extensively against virus storage buffer (137 mM NaCl,
5 mM KCl, 10 mM Tris, 1 mM MgCl2) and stored in small
aliquots at 70 8C after addition of 10% glycerol.
2.6. Identification of recombinant viruses
2.6.1. Western blot assay
The Wt-Ad-infected 293 cells were used as negative
control. The cells lysate was separated by 10% SDS-PAGE,
transferred to nitrocellulose membrane (Pall Corporation,
Pensacola, FL, USA) and placed in 10% fat-free milk at room
temperature overnight. The expressions of S1 and GM-S1
proteins were confirmed by mouse anti-S1 antiserum
[made in our laboratory by inoculation of mice with
purified truncated Sf200 [containing five antigenic sites of
S1 glycoprotein on amino acid residues (aa) 24–61 (S1D),
(aa) 291–398 (S1CAB) and (aa) 497–543 (S1F) (Koch et al.,
1990; Kant et al., 1992) was cloned into pET-32a (+) vector
and expressed in E. coli BL21 (DE3)]. Unbound antibodies
were washed with PBST followed by incubation with
horseradish peroxidase-conjugated goat anti-mouse IgG
(Boster Bio-Tech. Co. Ltd., Wuhan, China) for 1 h at the
dilution of 1:2000. Detection was performed using
chemiluminescence luminol reagents (SuperSignal West
PicoTrial kit, Pierce, Rockford, USA).
2.6.2. Immunofluorescence assay (IFA)
The expression of the S1, GM-CSF and the GM-S1
proteins was demonstrated by an immunofluorescence
assay in 293A cells infected with recombinant adenovirus
stocks as described (Li et al., 2009). Briefly, Wt-Ad and rAd
infected HEK-293A cells were washed and fixed for 30 min
at 4 8C followed by incubation with mouse anti-S1 or antiGM-CSF antisera (Both prepared and kept in our laboratory) for 1 h at 37 8C. The cells were rinsed with PBS and
incubated with fluorescein isothiocynate (FITC)-conjugated goat anti-mouse antibody (Boster Bio-Tech. Co. Ltd.,
Wuhan, China) for half an hour at 37 8C. The cells were
washed with PBS and visualized under an inverted
microscope (Axiovert 200; Carl Zeiss, Oberkochen, Germany).
2.6.3. Bone marrow proliferation assay
The bioactivity of the expressed GM-CSF and GM-CSFS1 proteins was performed as described by Du et al. (2007)
and X. Wang et al. (2009). Briefly, the bone marrow cells
from tibia and femur of 20-day-old SPF white leghorn
B. Zeshan et al. / Veterinary Microbiology 148 (2011) 8–17
chicken were collected, washed with HBSS medium,
centrifuged and re-suspended in RPMI-10 medium (RPMI
1640 medium supplemented with 5% fetal bovine serum,
5% chicken serum, 100 mg/ml streptomycin, 100 U/ml
penicillin). The cells were then seeded in triplicate at
7.5 104 cells per well in a 96-well tissue culture plate,
along with various dilutions of supernatant fluid taken
from MARC-145 cells infected with the rAd-GM-CSF, rAdGM-CSF-S1 and incubated at 37 8C with 5% CO2. Cell
proliferation was measured on 5th day by MTT (3-(4, 5dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide)
assay. The stimulation index (SI) was calculated as the ratio
of the average OD570 nm value of wells containing
supernatant fluid from recombinant adenoviruses or WtAd-infected MARC-145 cells to the average OD570 nm value
of wells containing only culture media.
2.7. Animal experiments
2.7.1. Vaccination of chickens with recombinant
adenoviruses
In ovo vaccination was carried out on 18-day-old SPF
white leghorn embryonated chicken eggs as described by
Toro et al. (2007). Two hundred and forty SPF eggs were
candled for viability and divided randomly into six groups.
Groups 1–6 were individually inoculated with 300 ml (108
TCID50) of purified rAd-S1, rAd-GM-S1, rAd-S1 plus rAdGM-S1, rAd-GM-CSF, Wt-Ad, PBS into the amnion-allantoic
cavity with a 21 gauge needle followed by sealing the hole
and continued incubation. The chickens were allowed to
hatch in separate Hatcher. Because 80–90% chicks in each
group were hatched out, the number of chicks was kept as
30 per group (n = 30 chicks) after hatching.
2.7.2. Detection of anti-IBV specific antibodies
At the age of 7, 14, 21, and 28 days, five chickens of each
group were selected randomly, respectively, and the sera
were isolated. The anti-IBV specific antibodies were
detected by hemagglutination inhibition (HI) assay which
was performed as described by the Office of International
des Epizooties (OIE, 2008). For this purpose, the virus was
grown in embryonated eggs and was kept at 4 8C from
harvesting to treatment with enzyme. The HI titer of each
serum sample was expressed as a reciprocal of the serum
dilution. The maximum dilution of each serum sample
causing inhibition of HA was used as the endpoint and the
results were recorded as the geometric mean titers (GMT)
of log2.
2.7.3. T lymphocyte proliferation assay
After the selection of the chicks as above, the
lymphocytes were isolated from the same chicken
heparinized blood (n = 5) on 28-day-old and suspended
to 5 106 ml1 with RPMI complete medium (RPMI 1640
containing 10% FCS). Each cells sample was plated in
triplicate in 96-well flat-bottom plates at 100 ml per well.
The culture was stimulated with purified IBV virus antigen
at a final concentration of 10 mg/ml or unstimulated,
respectively. Meanwhile phyto-hemagglutinin (20 mg/ml)
was used as a positive control. After incubation for 45 h at
37 8C with 5% CO2, the proliferation responses were
11
detected by a standard MTT method. T lymphocyte
proliferation was expressed as stimulation index (SI),
which is the ratio of OD570 nm of stimulated well to that of
unstimulated one.
2.7.4. Cytokine assays
The chickens from each group (n = 5) were killed to
collect spleens under sterile conditions on day 28 posthatch. The collected spleens were minced with dissecting
scissors into pieces, followed by further grinding and
filtering through sterilized nylon membranes and washed
in Hank’s solution (pH 7.2) by two cycles of centrifugations
at 2000 g for 5 min followed by isolation of the
lymphocytes with lymphocyte separation medium
(Boshide, Wuhan, China). The lymphocytes were resuspended to 2 106 ml1 with RPMI complete medium and
seeded to 96-well flat-bottom plates at 100 ml per well in
triplicate. The isolated lymphocytes were stimulated at the
final concentration of 10 mg/ml with purified IBV antigen
that made as previous description (Neuman et al., 2008).
After 72 h, the cells were centrifuged and the supernatant
was collected to examine the level of the Th1-type
cytokine IFN-g and Th2-type cytokine IL-4 using commercial cytokine quantitative ELISA (R&D Minneapolis,
MN, USA) according to the manufacturer’s instructions.
2.7.5. Protection against virulent challenge
All the chickens were challenged with 105.6 EID50 of
nephrotropic IBV XDC-2 strain by intranasal route on the
29th day post-hatch and were examined daily for the
clinical signs of IBV till 14 days. Dead chicks were
necropsied immediately while the live chickens in each
group were euthanized 14 days post-challenge (dpc). The
kidney tissues were collected for histopathological
changes and the detection of virus by RT-PCR.
2.7.6. Detecting of virus in kidney tissues by RT-PCR
The kidney tissues were incised individually from both
the dead and euthanized chickens after 14 dpc. Total RNA
was extracted using TRIzol1 reagent (Invitrogen, Carlsbad,
USA) according to the manufacturer’s instructions. RT-PCR
was performed using primers directed to amplify 150 bp
(S1 D) fragment of S1 gene (Table 1). Reverse transcription
and amplification were carried out as described above. The
PCR reaction was run in a thermocycler (PTC-150) with the
following program: denaturation at 94 8C for 5 min, 30
cycles composed of denaturation at 94 8C for 45 s,
annealing at 60 8C for 30 s, extension at 72 8C for 30 s
and final extension at 72 8C for 10 min.
2.7.7. Pathological examination
The collected kidney tissues were fixed in 10% neutral
buffered formalin. The tissues were processed by standard
histological procedures, embedded in paraffin, and cut in
5 mm sections. All the sections were stained with
hematoxylin and eosin.
2.8. Statistics
The statistical analysis was performed using SPSS
17.0 and the differences in the level of humoral and
12
B. Zeshan et al. / Veterinary Microbiology 148 (2011) 8–17
3. Results
biological activity of GM-CSF was examined by bone
marrow proliferation assay. Chicken bone marrow cells
proliferation in response to rAd-GM-CSF and rAd-GM-S1
was assessed on 5th day, while no responses occurred with
rAd-S1 and Wt-Ad (Fig. 3). Optimal proliferation was
observed with dilution 103 of supernatants. The bioactivity of GM-CSF-S1 fusion protein was lower than that of
GM-CSF alone.
3.1. Construction and characterization of recombinant
viruses
3.3. Induction of immune responses
cellular immune responses between different groups
were analyzed by one-way repeated measurement
ANOVA and least significance difference (LSD). The
values were considered statistically significant when
P < 0.05.
The shuttle vectors individually containing the S1,
GM-CSF and the GM-CSF-S1 under the control of CMV
early promoter were constructed as shown in Fig. 1. The
sequencing analysis showed that the nucleotide
sequence and the open reading frame of the insert
genes in recombinant plasmids were identical as in the
original sequences. After homologous recombination
between the shuttle plasmids and vector backbone
pAdEasy-1 in BJ5183 cells, three adenoviral plasmids
pAd-S1, pAd-GM-CSF and pAd-GM-S1 were obtained.
Subsequently, by transfection of HEK-293A cells with
these plasmids, three recombinant adenoviruses rAd-S1,
rAd-GM-CSF and rAd-GM-S1, were produced. The titer of
all the recombinant adenoviruses was 108 TCID50/ml.
3.2. Expression of recombinant proteins
[(Fig._2)TD$IG]
To determine the expression of foreign proteins, the
HEK-293A cells were infected with recombinant adenoviruses and detected by western blot and IFA with anti-S1
antibodies. The results of western blotting showed that
two proteins bands of 51 kDa and 63 kDa (consistent
with the predicted size of the S1 and GM-S1) were clearly
observed in cells infected with rAd-S1 or rAd-GM-S1,
whereas no specific protein band was found in cells
infected by Wt-Ad (Fig. 2a). Meanwhile, the results of IFA
showed that the recombinant adenoviruses infected HEK293A cells could be stained with IBV specific antibodies
and SPA-FITC or goat anti-mouse Ig-G-FITC, but the cells
infected by Wt-Ad could not be stained (Fig. 2b). The
3.3.1. Humoral immune responses
Fig. 4 shows the changes in anti-IBV antibody levels
following vaccination of SPF embryos with rAd-S1, rAdGM-S1 (fused), rAd-S1 plus rAd-GM-CSF (co-administered), rAd-GM-CSF, Wt-Ad, and PBS. Titers in chickens
immunized in ovo with rAd-S1 rose from 3.8 log2 [GMT] on
days 7–5 on day 14. The antibody titers of chickens
vaccinated in ovo with rAd-S1 fused or co-administered
with GM-CSF rose from 4 log2 [GMT] on days 7–8 log2
[GMT] on day 14. The titer of HI antibodies in groups
inoculated with rAd-GM-S1 or rAd-S1 plus rAd-GM-CSF,
induced highest level of 10.6 log2 [GMT] on day 28. The
levels of HI antibodies in groups vaccinated with rAd-GMS1 or rAd-S1 plus rAd-GM-CSF on 21st and 28th days posthatch were significantly higher than that of chicks
inoculated with rAd-S1 (P < 0.05). No specific antibody
responses to IBV were induced by immunization of
chickens with Wt-Ad or PBS.
3.3.2. Th1-type and Th2-type cytokine responses
The ELISA kits were employed to detect the production
of IFN-g and IL-4 in splenocytes on day 28 post-hatch. The
results showed that the mean level of IFN-g and IL-4 were
significantly higher in chickens inoculated with rAd-S1,
rAd-GM-S1, rAd-S1 plus rAd-GM-CSF (Fig. 5) as compared
to that of Wt-Ad and PBS groups (P < 0.05). The level of
IFN-g in chickens inoculated with rAd-GM-S1 was
significantly higher (P < 0.05) than that of rAd-S1 administered alone or in combination with GM-CSF. Meanwhile, IL-4 product was mild increased in these groups of
Fig. 2. Identification of in vitro expressed S1 and GM-CSF. (a) Western blot analysis of cell lysates infected with wild-type adenovirus (lane 1), rAd-GM-S1
(lane 2), rAd-S1 (lane 3), respectively, by using mouse anti-S1 of IBV serum. (b) IFA analysis of 293 cell monolayers infected with the recombinant
adenoviruses by using mouse anti-S1 of IBV.
[(Fig._3)TD$IG]
[(Fig._5)TD$IG]
B. Zeshan et al. / Veterinary Microbiology 148 (2011) 8–17
Fig. 3. Bone marrow proliferation response; chicken bone marrow cells
were isolated from tibia and femur of one 20-day-old SPF white leghorn
chicken and cultured with serial dilutions of supernatant fluids collected
from recombinant adenoviruses or Wt-Ad-infected MARC-145 cells.
Proliferation was determined by MTT method. Each dilution was
performed in triplicate. Data were shown as mean SD.
rAd-GM-S1 and rAd-S1 plus rAd-GM-CSF as compared to
that of rAd-S1 (Fig. 5).
[(Fig._4)TD$IG]
3.3.3. S1-protein-specific T cell proliferation
T cell proliferation assay was performed to determine
GM-CSF influenced cell-mediated immunity. As shown in
Fig. 6, T cell proliferative response to S1 was clearly
observed in the groups immunized with rAd-S1 alone or
fused/co-administered with GM-CSF. The level of the T cell
proliferative response in chickens immunized with rAdGM-S1 on 28-day post-hatch was significantly higher than
that of rAd-S1 alone or co-administered with GM-CSF
(P < 0.05).
13
Fig. 5. The concentrations (pg/ml) of Th1-type cytokine of IFN-g and Th2type cytokine of IL-4 in the supernatants. Lymphocytes (5 106 ml1,
100 ml/well) isolated from the chicken blood at 28 days after hatch before
challenge and were stimulated with purified IBV virus antigen. After 72 h,
the supernatants were collected to examine the levels of the Th1-type
cytokine IFN-g and Th2-type cytokine IL-4 using commercially available
chicken cytokine ELISA-kits. An asterisk (*) indicates the concentration of
IFN-g in recombinant adenovirus group is significantly higher than the
Wt-Ad or PBS groups (P < 0.05). Data were shown as mean SD for five
chickens per group.
3.4. Protection of chickens against IBV challenge
Mortality, kidney infection and percent protection of
chickens after challenge are summarized in Table 2.
Chickens inoculated with rAd-GM-CSF, Wt-Ad or PBS
were not protected from IBV challenge and developed
sneezing, nasal discharge, and dyspnea or death from viral
infection. The mortality rate in these groups on day 14
post-challenge was 60–65%. All the vaccinated chickens in
rAd-S1, rAd-GM-S1 and rAd-S1 plus rAd-GM-CSF survived, except one in rAd-S1 group. The gross lesions in
these groups were markedly mild than those in Wt-Ad and
PBS groups.
Fig. 4. Humoral immune responses in chickens inoculated with the recombinant adenoviruses. Serum samples (n = 5) were collected at various time-points
and antibodies to IBV antigen were detected using hemagglutination inhibition (HI) test. The titers of antibodies were expressed as the reciprocal of the
highest serum dilution causing complete inhibition of chicken RBCs agglutination. An asterisk (*) indicates the level of HI antibodies in rAd-GM-S1 or and
rAd-GM-CSF plus rAd-S1 inoculated groups is significantly higher than that of rAd-S1 or Wt-Ad groups (P < 0.05). Data were shown as mean SD.
[(Fig._6)TD$IG]
B. Zeshan et al. / Veterinary Microbiology 148 (2011) 8–17
14
kidney samples by RT-PCR. The results indicated that 75–
100% of the chickens in rAd-GM-CSF, Wt-Ad and PBS, while
30% of the chickens vaccinated with rAd-S1 were positive for
the presence of virus in the kidney. 100% protection was
found in the groups vaccinated with the rAd-GM-S1 and
rAd-S1 plus rAd-GM-CSF following virulent IBV challenge
whereas in the group vaccinated with rAd-S1 alone was 70%.
4. Discussion
In ovo vaccination to the 18 days old embryo by
automated vaccination method minimizes labor, time and
costs by allowing administration of a uniform vaccine dose
into hundreds of eggs per minute (Ahmad and Sharma,
1993; Avakian et al., 2007). To date this objective has been
achieved in Marek’s disease. In addition, HVT vector
expressing the protective infectious bursoal disease virus
(IBDV) VP2 gene administered in ovo or subcut at hatchery
displayed excellent safety and broad efficacy against IBD
(Bublot et al., 2007; Le Gros et al., 2009). However, the
development of in ovo-compatible modified live vaccine
against IBV is difficult as it causes acute pathogenicity to
the embryo and there is no currently licensed embryo-safe
vaccine against IBV.
The efficiency of the genetically engineered IBV vaccines
was up-regulated by co-delivery of cytokines to increase the
immune response of vaccine antigens (Y.F. Wang et al., 2009;
Tarpey et al., 2007). GMCSF is a pleiotropic cytokine and has
been used as adjuvant to enhance the immune responses of
many vaccine antigens (Skountzou et al., 2007). In this
study, recombinant adenoviruses expressing GMCSF/S1
individually or in fusion protein form were firstly constructed, and the immune responses were detected in
chicken. The results indicated that the animals vaccinated
with rAd-GM-S1 or rAd-S1 plus Ad-GM-CSF developed
antibodies to IBV. The levels of the antibodies detected by HI
were significantly higher in rAd-GM-S1 or rAd-S1 plus AdGM-CSF than that in rAd-S1. It indicated that the vaccination
of the GM-CSF fused or co-administered with S1 of IBV in ovo
could enhance significantly humoral immune responses in
chicken.
The serological immune response against IBV has not
been correlated with protection (Davelaar et al., 1982;
Holmes, 1973). Cellular immune response may play an
Fig. 6. Lymphocyte proliferative responses in chickens immunized with
recombinant adenoviruses. The lymphocytes were isolated (n = 5) on day
28 after hatch and were stimulated with purified IBV virus antigen at a
final concentration of 10 mg/ml in triplicate. After 45 h of stimulation,
MTT was added and the proliferation responses were detected by a
standard MTT method. The PHA control sample showed a stimulation
index of 6–8. Data were shown as mean standard error.
Necropsies revealed typical pathology of acute infectious bronchitis in PBS and Wt-Ad inoculated groups which
were restricted to the kidneys and upper respiratory tract
such as swollen kidney in mud-like gray with piebalds,
suffusion of mucus in the upper respiratory tract. IBV
lesions were visible in all chickens examined on days 5 and
14 post-challenge, with severe lesions in the kidney. The
kidney microscopic lesions of the chickens in the control
groups were characterized by epithelial degeneration,
mild, moderate or profound lymphoid accumulation in the
epithelial tissue, focal necrosis and increased amounts of
exudates (Fig. 7).
To further evaluate the level of protective response after
challenge, RNA of the IBV was detected from the collected
Table 2
The incidence of gross lesions, mortality, hatchability, and detection of IBV by RT-PCR in the kidneys of chickens in different groups challenged with virulent
IBV XDC-2 strain.
Vaccination
rAd-S1
rAd-GM-S1
rAd-S1 + rAd-GMCSF
rAd-GMCSF
Wt-Ad
PBS
a
b
c
d
Numbers of chickens
challengeda
20
20
20
20
20
20
Numbers of chickens
with gross lesions
Positive numbers of
chickens with RTPCR
5 dpc
14 dpc
5 dpcd
14 dpc
0
0
0
6
5
8
0
0
0
5
7
7
2
0
0
7
8
10
4
0
0
8
10
10
Mortalityb (%)
Protectionc (%)
15
0
0
65
60
55
70
100
100
0
10
0
The chickens were challenged with IBV XDC-2 strain at 29 days post-hatch.
Mortality was recorded for each day after challenge and is presented as total number of dead chickens in each group.
Percent protection was determined by the number of unaffected chickens/total number of chickens.
Days post-challenge.
[(Fig._7)TD$IG]
B. Zeshan et al. / Veterinary Microbiology 148 (2011) 8–17
15
Fig. 7. Examination of histological lesions in kidney of the chickens in Wt-Ad (a), rAd-S1 (b), rAd-S1 plus, rAd-GM-CSF (c) and rAd-GM-S1 (d) groups at 14
dpc. It indicated that (a) and (b) had more severe nephritis as compared to (c) and (d). Hematoxylin and eosin staining (HE). Magnification, 400.
important role in clearing the virus and preventing of IBV
infection (Fulton et al., 1993; Seo et al., 1997). Here, the
results indicated that the level of IFN-g in the supernatants
of lymphocytes was markedly enhanced in groups vaccinated with rAd-GM-S1 and rAd-S1 plus rAd-GM-CSF, while
mild increase in IL-4 was observed in these groups as
compared to that of rAd-S1. It suggested that the Th1-type
immune response was preferentially enhanced by GM-CSF.
The activation and the proliferation of lymphocytes play a
critical role in both the humoral and cellular immune
responses induced by vaccination. Therefore, we also
evaluated whether vaccination with rAd-S1 in the presence
or the absence of GM-CSF expressed by recombinant
adenovirus could influence the antigen-specific T cell
proliferation response. The results indicated that the
proliferative response of T cells of chickens immunized
with rAd-S1 alone was evident. And rAd-GM-S1 could
significantly enhance the level of proliferative response of T
cells compared to that of rAd-S1 vaccination alone. But coadministration of rAd-S1 with rAd-GMCSF could not
enhance T cells proliferative responses. These results were
consistent with previous findings, which showed that fusion
of GM-CSF enhances humoral and T lymphocyte proliferation responses (Du et al., 2007; Qiu et al., 2007).
To investigate the level of protection elicited by the
recombinant adenoviruses, all the chickens were chal-
lenged by a homologous XDC-2 strain of IBV on day 28 after
hatch. The results of the gross and histological examination
of the kidneys and the use of a PCR to detect IBV nucleic
acid in homogenized kidney tissue showed that the rAdGM-S1 and rAd-S1 plus rAd-GM-CSF vaccines provided
excellent protection against challenge. The virus challenge
assay indicated that the protection efficacy in the group
immunized with rAd-S1 fused or co-administered with
GM-CSF was 100%, whereas, only 70% of chickens
inoculated with rAd-S1 alone were protected from IBV
challenge. In the present work, only one IBV strain known
to be capable of inducing nephritis was used. Therefore, it
is not known whether similar protection would be
achieved against challenge with other nephrotropic IBVs.
The adenoviral vector used in this work is replication
defective, and it is highly unlikely to spread within
individuals or different hosts and disseminate in the
environment but the recombination between modified and
wild-type adenoviruses may occur depending on the
particular gene of interest used. Thus, it should need to
assess the safety of these recombinant adenoviruses. In the
present study, we attempted to use GM-CSF as in ovo
molecular adjuvant either fused or co-administered with
IBV S1 expressing recombinant adenovirus and evaluated
its role in the immune response. As mentioned above that
there was no currently licensed embryo-safe vaccine
16
B. Zeshan et al. / Veterinary Microbiology 148 (2011) 8–17
against IBV, we could not compare or add any positive
control group in our experiments. However, The results
indicated that these recombinant adenoviruses might be
attractive candidates for preventing and control of
nephropathogenic IBV infections in chickens.
Acknowledgments
This work was supported by grants from the National
Natural Science Foundation (30471288), National Key
Genomic Engineering Program (2009ZX08009-143B), and
Partly National Key Technology R&D Program (2006AA1
0A203). Financial support to Basit Zeshan from Higher
Education Commission (HEC) Islamabad, Pakistan is highly
acknowledged.
References
Ahmad, J., Sharma, J.M., 1993. Protection against hemorrhagic enteritis
and Newcastle-disease in turkeys by embryo vaccination with monovalent and bivalent vaccines. Avian Dis. 37, 485–491.
Avakian, A.P., Poston, R.M., Kong, F.K., Kampen, K.R.V., Tang, D.C., 2007.
Automated mass immunization of poultry: the prospect for nonreplicating human adenovirus-vectored in ovo vaccines. Expert Rev.
Vaccine 64, 57–65.
Bublot, M., Pritchard, N., Le Gros, F.X., Goutebroze, S., 2007. Use of a
vectored vaccine against infectious bursal disease of chickens in the
face of high-titrated maternal derived antibody. J. Comp. Pathol. 137,
S81–S84.
Cavanagh, D., 2007. Coronavirus avian infectious bronchitis virus. Vet.
Res. 38, 281–297.
Chianese-Bullock, K.A., Pressley, J., Garbee, C., Hibbitts, S., Murphy, C.,
Yamshchikov, G., Petroni, G.R., Bissonette, E.A., Neese, P.Y., Grosh,
W.W., Merrill, P., Fink, R., Woodson, E.M., Wiernasz, C.J., Patterson,
J.W., Slingluff, C.L., 2005. MAGE-A1-, MAGE-A10-, and gp100-derived
peptides are immunogenic when combined with granulocyte-macrophage colony-stimulating factor and montanide ISA-51 adjuvant and
administered as part of a multipeptide vaccine for melanoma. J.
Immunol. 174, 3080–3086.
Davelaar, F.G., Noordzij, A., van der Donk, J.A., 1982. A study on the
synthesis and secretion of immunoglobulins by the Harderian gland
of the fowl after eyedrop vaccination against infectious bronchitis at 1
day old. Avian Pathol. 11, 63–79.
Du, Y., Jiang, P., Li, Y., He, H., Jiang, W., Wang, X., Hong, W., 2007. Immune
responses of two recombinant adenoviruses expressing VP1 antigens
of FMDV fused with porcine granulocyte macrophage colony-stimulating factor. Vaccine 25, 8209–8219.
Fulton, R.M., Reed, W.M., Thacker, H.L., 1993. Cellular response of the
respiratory tract of chickens to infection with Massachusetts 41 and
Australian T infectious bronchitis viruses. Avian Dis. 37, 951–960.
Gao, W., Soloff, A.C., Lu, X., Montecalvo, A., Nguyen, D.C., Matsuoka, Y.,
Robbins, P.D., Swayne, D.E., Donis, R.O., Katz, J.M., Barratt-Boyes, S.M.,
Gambotto, A., 2006. Protection of mice and poultry from lethal H5N1
avian influenza virus through adenovirus-based immunization. J.
Virol. 80, 1959–1964.
Heufler, C., Koch, F., Schuler, G., 1988. Granulocyte/macrophage colonystimulating factor and interleukin 1 mediate the maturation of murine epidermal langerhans cells into potent immunostimulatory dendritic cells. J. Exp. Med. 167, 700–705.
Holmes, H.C., 1973. Neutralizing antibody in nasal secretions of chickens
following administration of avian infectious bronchitis virus. Arch.
Gesamte Virusforsch. 43, 235–241.
Johnson, M.A., Pooley, C., Ignjatovic, J., Tyack, S.G., 2003. A recombinant
fowl adenovirus expressing the S1 gene of infectious bronchitis virus
protects against challenge with infectious bronchitis virus. Vaccine
21, 2730–2736.
Kant, A., Koch, G., Roozelaar van, D.J., Kusters, J.G., Poelwijk, F.A.J., Zeijst
van der, B.A.M., 1992. Location of antigenic sites defined by neutralizing monoclonal antibodies on the S1 avian infectious bronchitis virus
glycopolypeptide. J. Gen. Virol. 73, 591–596.
Kapoor, D., Aggarwal, S.R., Singh, N.P., Thakur, V., Sarin, S.K., 1999.
Granulocyte-macrophage colony-stimulating factor enhances the
efficacy of hepatitis B virus vaccine in previously unvaccinated haemodialysis patients. J. Viral Hepatitis 6, 405–409.
Koch, G., Hartog, L., Kant, A., Roozelaar van, D.J., 1990. Antigenic domains
on the peplomer protein of avian infectious bronchitis virus: correlation with biological functions. J. Gen. Virol. 71, 1929–1935.
Le Gros, F.X., Dancer, A., Giacomini, C., Pizzoni, L., Bublot, M., Graziani, M.,
Prandini, F., 2009. Field efficacy trial of a novel HVT-IBD vector
vaccine for 1-day-old broilers. Vaccine 27, 592–596.
Li, J., Jiang, P., Li, Y., Wang, X., Cao, J., Wang, X., Zeshan, B., 2009. HSP70
fused with GP3 and GP5 of porcine reproductive and respiratory
syndrome virus enhanced the immune responses and protective
efficacy against virulent PRRSV challenge in pigs. Vaccine 27, 825–
832.
Liu, S., Kong, X., 2004. A new genotype of nephropathogenic infectious
bronchitis virus circulating in vaccinated and non-vaccinated flocks
in China. Avian Pathol. 33, 321–327.
Liu, S., Zhang, Q., Chen, J., Han, Z., Liu, X., Feng, L., Shao, Y., Kong, X., Rong, J.,
Tong, G., 2006. Genetic diversity of avian infectious bronchitis coronavirus strains isolated in China between 1995 and 2004. Arch. Virol.
151, 1133–1148.
Luo, J., Deng, L.Z., Luo, X., Tang, N., Song, X.W., Chen, J., Sharff, A.K., Luu,
H.H., Haydon, C.R., Kinzler, W.K., Vogelstein, B., He, C.T., 2007. A
protocol for rapid generation of recombinant adenoviruses using
the AdEasy system. Nat. Protoc. 2, 1236–1247.
Mach, N., Gillessen, S., Wilson, S.B., Sheehan, C., Mihm, M., Dranoff, G.,
2000. Differences in dendritic cells stimulated in vivo by tumors
engineered to secrete granulocyte-macrophage colony-stimulating
factor or Flt3-ligand. Cancer Res. 60, 3239–3246.
Neuman, B.W., Adair, B.D., Yeager, M., Buchmeier, M.J., 2008. Purification
and electron cryomicroscopy of coronavirus particles. Methods Mol.
Biol. 454, 129–136.
Office International des Epizooties (O.I.E.), 2008. Manual of Standards for
Diagnostic Tests and Vaccines, 6th ed. Avian Infectious Bronchitis, pp.
443–455.
Qiu, J.T., Changa, H.C., Lin, C.T., Chen, Y.M., Li, F.Q., Soong, Y.K., Lai, C.H.,
2007. Novel codon-optimized GM-CSF gene as an adjuvant to
enhance the immunity of a DNA vaccine against HIV-1 Gag. Vaccine
25, 253–263.
Seo, S.H., Wang, L., Smith, R., Collisson, E.W., 1997. The carboxyl-terminal
120-residue polypeptide of infectious bronchitis virus nucleocapsid
induces cytotoxic T lymphocytes and protects chickens from acute
infection. J. Virol. 71, 7889–7894.
Shi, Y.F., Liu, C.H., Roberts, A.I., Das, J., Xu, G., Ren, G., Zhang, Y., Zhang, L.,
Yuan, Z.R., Tan, H.S., Das, G., Devadas, S., 2006. Granulocyte-macrophage colony-stimulating factor (GM-CSF) and T-cell responses: what
we do and don’t know. Cell Res. 16, 126–133.
Skountzou, I., Quan, F.S., Gangadhara, S., Ye, L., Vzorov, A., Selvaraj, P.,
Jacob, J., Compans, R.W., Kang, S.M., 2007. Incorporation of glycosylphosphatidy-linositol anchored granulocyte-macrophage colony-stimulating factor or CD40 ligand enhances immunogenicity
of chimeric simian immunodeficiency virus-like particles. J. Virol.
81, 1083–1094.
Slingluff Jr., C.L., Petroni, G.R., Yamshchikov, G.V., Barnd, D.L., Eastham,
S., Galavotti, H., Patterson, J.W., Deacon, D.H., Hibbitts, S., Teates,
D., Neese, P.Y., Grosh, W.W., Chianese-Bullock, K.A., Woodson,
E.M., Wiernasz, C.J., Merrill, P., Gibson, J., Ross, M., Engelhard,
V.H., 2003. Clinical and immunologic results of a randomized
phase II trial of vaccination using four melanoma peptides either
administered in granulocyte-macrophage colony-stimulating factor in adjuvantor pulsed on dendritic cells. J. Clin. Oncol. 21,
4016–4026.
Song, C.S., Lee, Y.J., Lee, C.W., Sung, H.W., Kim, J.H., Mo, I.P., Izumiya, Y.,
Jang, H.K., Mikami, T., 1998. Induction of protective immunity in
chickens vaccinated with infectious bronchitis virus S1 glycoprotein expressed by a recombinant baculovirus. J. Gen. Virol. 79,
719–723.
Stern, D.F., Sefton, B.M., 1982. Coronavirus protein: biogenesis of avian
infectious bronchitis virus virion proteins. J. Virol. 44, 794–803.
Tarpey, I., Loon, A.A., Haas, N., Davis, P.J., Orbell, S., Cavanagh, D.,
Britton, P., Casais, R., Sondermeijer, P., Sundick, R., et al., 2007.
Recombinant turkey herpesvirus expressing chicken interleukin-2
increases the protection provided by in ovo vaccination with
infectious bursal disease and infectious bronchitis virus. Vaccine
25, 8529–8535.
Tian, L., Wang, H., Lu, D., Zhang, Y., Wang, T., Kang, R., 2008. The
immunoreactivity of a chimeric multi-epitope DNA vaccine against
IBV in chickens. Biochem. Biophys. Res. Commun. 377, 221–225.
Toro, H., Tang, D.C., Suarez, D.L., Sylte, M.J., Pfeiffer, J., Van Kampen, K.R.,
2007. Protective avian influenza in ovo vaccination with non-replicating human adenovirus vector. Vaccine 25, 2886–2891.
Wang, X., Li, J., Jiang, P., Li, Y., Zeshan, B., Cao, J., Wang, X., 2009. GMCSF fused with GP3 and GP5 of porcine reproductive and respiratory
B. Zeshan et al. / Veterinary Microbiology 148 (2011) 8–17
syndrome virus increased the immune responses and protective efficacy
against virulent PRRSV challenge. Virus Res. 143, 24–32.
Wang, Y.F., Sun, Y.K., Tian, Z.C., Shi, X.M., Tong, G.Z., Liu, S.W., Zhi, H.D.,
Kong, X.G., Wang, M., 2009. Protection of chickens against infectious
bronchitis by a recombinant fowlpox virus co-expressing IBV-S1 and
chicken IFN-g. Vaccine 27, 7046–7052.
17
Zhang, Lili., Cao, G.L., Basit, Li, W., Jiarong, X., Wang, X., Jiang, P., 2009.
Identification of one strain of nephropathogenic avian infectious
bronchitis virus. Anim. Husb. Vet. Med. 41, 11–15.
Zhou, J.Y., Wu, J.X., Cheng, L.Q., Zheng, X.J., Gong, H., Shang, S.B., Zhou,
E.M., 2003. Expression of immunogenic S1 glycoprotein of infectious
bronchitis virus in transgenic potatoes. J. Virol. 77, 9090–9093.