A rare
b
Anti-In
Amanda Wiley1, Matthew Anderson1, Jason Beveridge1, Ina Messig2,
Annette Le Viellez1
1. Transfusion Medicine, Fiona Stanley Hospital, PathWest LMWA
2. Blood Group Reference Laboratory, ARCBS, WA.
Tues 14/04/15
23:15
•
•
•
•
34 yo female
C section cat 3
History 3 previous C sect
No history of blood
transfusion on TM Ultra
and ticked ‘no’ in patient
history notes.
• Blood group AB Rh(D)pos
• Previous GAS = pos (x3),
antibody not identified
 Group, Screen, DAT
Antibody panel
Antibody panel – 2nd
What now?
C-Section underway, not possible to delay
 Phone the on-call
 Yes
haematologist?
 Avoid Blood Transfusion?
 Yes
 Give “least incompatible”
 Avoid this strategy when
AHG xmatch blood?
 Send to the WA Blood Group
Reference Laboratory?
 And Baby?
DAT/auto neg
 Yes – only open Mon to
Fri 08:00 – 17:00
 Baby: cord DAT not sent
for testing, Hb 138 (gas
Hb)
ARCBS – BGRL Report:
9 days later
 Anti-Inb weakly detected by DiaMed LISS IAT and PEG IAT.
 No reaction by enzyme or with AET* treated cells
 Patient phenotype In(b-) – tested against single available
example of human anti-Inb
Notes:
 The In(b-) phenotype is extremely rare in our population.
 There are currently only 4 In(b-) donors in Australia.
 Recommend discussion for future blood requirements
including possibility of testing siblings
*AET: 2-aminoethylisothiouronium bromide
This image cannot currently be displayed.
What blood group does In(b) belong to?
This image cannot currently be displayed.
 Indian blood group system ISBT:023
 4 antigens: Ina, Inb, INFI, INJA,
 CD44 glycoprotein, 3 disulphide bonds
• Chromosome (11p13), 50-60kb DNA, 20 exons
This image cannot currently be displayed.
This image cannot currently be displayed.
• Ina/Inb snp exon 2
Xu Q. The Indian Blood Group System. Immunohem 2011; 27(3):89-93
DNA Sequencing
This image cannot currently be displayed.
This image cannot currently be displayed.
Source: Alamut version 2.3 (Interactive Biosoftware, Rouen, France)
 Sequencing of Exon 2 of CD44 gene on Chr 11
Sequencing Primers Used:
Forward 5'– TGTTAACCAGGCTGGTCTTGAG–3'
Reverse 5'– AGTTCTAAGCCCAGCTGCCTG–3‘
Poole, J, et al. (2007). Two missense mutations in the CD44 gene encode two new antigens of the Indian blood
group system. Transfusion, 47, 1306-1311. doi: 10.1111/j.1537-2995.2007.01275.x
 Sanger sequencing using 3730 sequencer
 Analysis using Chromas Lite software
Sequencing performed by: Molecular Haematology,
PathWest Fiona Stanley, Department of Haematology, WA
This image cannot currently be displayed.
CCG
Patient
IN1 (Ina)
CCG
Proline
This image cannot currently be displayed.
CGG
“Neg” control
IN2 (Inb)
CGG
Arginine
A 252G>C substitution was detected in the patient’s CD44 Exon 2
sequencing, indicating a Homozygous IN A/A genotype
The “negative” control gave a discrete Guanine peak, indicating
Homozygous IN B/B genotype
Sequencing performed by: Molecular Haematology,
PathWest Fiona Stanley, Department of Haematology, WA
Incidence of In
Incidence:
Pakistani ????
Xu Q. The Indian Blood Group System. Immunohem 2011; 27(3):89-93
Clinical Significance?
 Anti-Ina is not reported to cause HDFN or haemolytic transfusion reactions –
although associated with high clearance of In(a+) transfused cells
 Anti-Inb is associated with immediate, severe HTR. To date, not reported to
cause HDFN but this may be attributed to adsorbtion of antibody to CD44 on
placental tissue. Positive DAT on neonate has been reported.
 For our patient:




No blood in inventory would have been compatible
Iron infusion post natal recommended
In hindsight, baby DAT would have been interesting
 Hb 138 at birth
Further discussion with patient and family re future transfusion plan, potential
donors, family plan.
 Conclusion:


DNA sequencing for genotype confirmation of rare blood groups is a useful addition
to an investigation where there is limited availability of anti-sera.
DNA sequencing could be used for screening of family members as potential blood
donors.
Xu Q. The Indian Blood Group System. Immunohem 2011; 27(3):89-93
Poole, J, et al. Two missense mutations in the CD44 gene encode two new antigens of the Indian
blood group system. Transfusion 2007; 47:1306-1311. doi: 10.1111/j.1537-2995.2007.01275.x