Vol. 9, 3763–3772, September 1, 2003
Clinical Cancer Research 3763
Dexamethasone and Medroxyprogesterone Acetate Elevate Nm23-H1
Metastasis Suppressor Gene Expression in Metastatic Human
Breast Carcinoma Cells: New Uses for Old Compounds
Taoufik Ouatas, Douglas Halverson, and
Patricia S. Steeg1
Women’s Cancers Section, Laboratory of Pathology, Center for
Cancer Research, National Cancer Institute, Bethesda, Maryland
20892
ABSTRACT
Purpose: Long-term elevation of metastasis suppressor
gene expression in micrometastases represents a novel therapeutic strategy for breast and other cancers. We searched
for well-tolerated compounds that could elevate Nm23 metastasis suppressor expression in metastatic human breast
cancer cell lines.
Experimental Design: MDA-MB-435 and MDA-MB-231
human breast carcinoma cells were treated with dexamethasone or medroxyprogesterone acetate (MPA) in cultures
containing either charcoal-stripped serum or FCS. Aspects
of nm23 expression and function were determined.
Results: Previous investigation of the nm23-H1 promoter suggested that glucocorticoids may contribute to the
elevation of Nm23-H1 expression. Dexamethasone elevated
Nm23-H1 and Nm23-H2 protein levels in two metastatic
human breast carcinoma cell lines 2–3-fold over a 4-day
time course when cultured in steroid-free culture medium,
with high-dose inhibition, via a traditional transcriptional
mechanism. Elevation of Nm23-H1 expression was not observed using FCS-containing culture medium, which contains endogenous levels of corticosteroids, limiting the potential in vivo use of dexamethasone. MPA was investigated
as a glucocorticoid receptor agonist. MPA elevated breast
carcinoma Nm23-H1 protein expression 3-fold over a 10 nM
to 1 ␮M dose range when cultured in steroid-free or FCScontaining medium, with a shorter time course. Elevation of
Nm23-H1 expression in the presence of endogenous corticosteroids found in FCS involved a distinct, glucocorticoid
receptor-dependent, posttranscriptional mechanism of action. MPA had no effect on proliferation in vitro but reduced
the soft agar colonization of metastatic breast cancer cell
lines by ⬃50%.
Received 10/30/02; revised 2/24/03; accepted 3/16/03.
The costs of publication of this article were defrayed in part by the
payment of page charges. This article must therefore be hereby marked
advertisement in accordance with 18 U.S.C. Section 1734 solely to
indicate this fact.
1
To whom requests for reprints should be addressed, at Building 10,
Room 2A33, NIH, Bethesda, MD 20892. Phone: (301) 402-2732; Fax
(301) 402-8910; E-mail: steegp@mail.nih.gov.
Conclusions: MPA represents a first generation lead
agent for the elevation of Nm23-H1 metastasis suppressor
expression and the inhibition of metastatic colonization.
INTRODUCTION
Interruption of the metastastic process may represent an
important therapeutic target for breast and other cancers in the
adjuvant setting. Metastasis suppressor gene expression constitutes a new approach to cancer therapy. Metastasis suppressor
genes exhibit reduced expression levels and presumably protein
function in highly metastatic tumor cells. Eight metastasis suppressor genes have been confirmed in transfection studies to
date, nm23, MKK4, KAI-1, BRMS-1, KiSS-1, RhoGDI2, CRSP3,
and VDUP-1; in each case, re-expression of the metastasis
suppressor gene into a metastatic tumor cell line inhibited metastasis in vivo without a significant reduction in primary tumor
size (reviewed Refs. 1, 2). Both in vitro and in vivo data indicate
that metastasis suppressors inhibit metastatic colonization, the
outgrowth of tumor cells at a foreign site via nonangiogenic
mechanisms (2–7). Metastasis suppressors often use novel
mechanisms of action, including the induction of differentiation,
increased gap-junctional communication, and the modulation of
specific signal transduction pathways (2). For the KAI-1 and
nm23 metastasis suppressor genes, reduced expression rather
than mutation was observed in aggressive human cancer cohorts
(8, 9). From a cancer therapeutic perspective, a goal is the
identification of well-tolerated compounds that could be delivered chronically and would elevate the metastasis suppressor
expression of micrometastatic tumor cells.
The nm23 gene family was identified by its reduced expression in highly metastatic murine melanoma cell lines, as
compared with related, tumorigenic but less metastatic cell lines
(10) and now consists of eight family members (reviewed in
Ref. 11). The metastasis suppressor activity of nm23 cDNAs has
been demonstrated in multiple transfection experiments (7, 12–
20). Among the human breast carcinoma cell lines investigated,
transfection of nm23-H1 resulted in reduced colonization in soft
agar, both unstimulated and when TGF-␤2 was added to the
cultures (7), and reduced invasion and motility to a variety of
chemoattractants (14, 21–23). Nm23-H1 transfectants of the
MDA-MB-435 breast carcinoma cell line exhibited morphological (ascinus formation) and biosynthetic aspects of differentiation in three-dimensional culture (24); this finding is supported
The abbreviations used are: TGF-␤, transforming growth factor ␤; AR,
androgen receptor; CSS, charcoal-stripped serum; GR, glucocorticoid
receptor; GRE, glucocorticoid response element; MMTV, mouse mammary tumor virus; CAT, chloramphenicol acetyltransferase; MPA,
medroxyprogesterone acetate; PR, progesterone receptor.
2
3764 MPA Elevation of Nm23 Expression
by similar differentiation studies in neural cells (25–31). In most
but not all human breast tumor cohort studies, low Nm23
expression was significantly correlated with an aspect of aggressive behavior (reviewed in Ref. 32). We hypothesize that elevation of Nm23-H1 expression in micrometastatic tumor cells
from breast cancer patients whose primary tumors were low
Nm23-H1 expressing, may inhibit additional colonization and
invasion, with a clinical benefit.
Although several compounds have been reported to elevate
Nm23 expression in vitro, none appear to be good clinical
candidates. All-trans-retinoic acid elevated Nm23-H1 expression in a human hepatocellular carcinoma cell line (33) and in
the metastatic MDA-MB-231 breast carcinoma cell line (unpublished observation). However, the clinically used fenretinide
failed to elevate Nm23-H1 expression (unpublished data). Estradiol increased Nm23-H1 expression in the nonmetastatic
MCF-7 and BT-474 human breast carcinoma cell lines (34).
Similarly, indomethacin elevated Nm23-H1 expression only in
less aggressive MCF-7 and MCF-12A cells but not in metastatic
MDA-MB-231 or MDA-MB-435 cell lines (35). ␥-Linolenic
acid elevated Nm23-H1 expression weakly in human cell lines
(36). We previously noted that the DNA methylation inhibitor
5-azadeoxycytidine altered the DNA methylation pattern of a
CpG island in the nm23-H1 promoter and increased the
Nm23-H1 expression of metastatic breast carcinoma cell lines;
however, these findings were only infrequently repeatable for
the same nm23-H1 promoter CpG island isolated from human
breast carcinomas (37).
We recently identified a 2.1-kb fragment of the nm23-H1
promoter, which directed high versus low reporter gene expression when transiently transfected into a series of four human
breast carcinoma cell lines of varying in vivo metastatic potentials (38). Restriction fragment deletion analysis identified a
248-bp region of the promoter as contributing to differential
expression, which contained three transcription factor binding
sites found in the MMTV-long terminal repeat (1) and other
mammary-specific gene promoters (Ets/MAF, CTF/NF1 halfsite, and ACAAAG enhancer). A pBT plasmid containing the
248-bp promoter fragment and an adjacent 195-bp fragment
containing both the transcription initiation site and two GREs
also mediated high versus low nm23-H1 reporter gene expression, and mutation of the mammary-specific sites established a
functional relationship. These sites, in a similar geographic
pattern, contribute to MMTV function: glucocorticoids bind to
the GR and the pair to the GRE, altering nucleosomal structure
and permitting transcription factor binding to the cassette of
transcription factor sites. We hypothesized that glucocorticoids
may elevate Nm23-H1 expression in metastatic breast carcinoma cell lines via a similar mechanism. This manuscript presents evidence that dexamethasone and pharmacological levels
of MPA elevate Nm23-H1 expression in vitro in metastatic
human breast carcinoma cells.
MATERIALS AND METHODS
Cell Culture and Drug Treatment. All cells were obtained from American Type Culture Collection. Cells were
maintained in RPMI 1640 supplemented with 10% FCS, 2 mM
glutamine, 100 units/ml penicillin, 100 ␮g/ml streptomycin, and
25 mM HEPES (Gemini, Woodland, CA). Depo-Provera was
purchased from Pharmacia & Upjohn and was diluted in 28.9
mg/ml polyethylene glycol (PEG, MW 3350), 0.15 M NaCl. All
other drugs were purchased from SIGMA (St. Louis, MO). 100
mM MPA stock solutions were prepared in 80% ethanol, 20%
chloroform.
For Western blot experiments, 8 ⫻ 104 cells were plated in
6-well plates 24 h before treatment. Cells were incubated in
serum-free medium supplemented with 0.5% CSS (Sigma) and
treated with either dexamethasone, MPA, Depo-Provera, progesterone, prolactin, indomycin, NS398, RU-486, or vehicle
(ethanol or polyethylene glycol) at the indicated concentrations.
Cells were harvested after 24 –96 h culture as indicated. Whole
cell lysates were prepared as described previously (37). Nuclear
extracts were prepared according to a modified Dignam’s procedure as described previously (38). For Northern blot experiments, 6 ⫻ 105 cells were seeded in 10-cm2 plates in complete
culture medium 24 h before treatment. Drug or vehicle was
added, and cells were cultured for an additional 24 –96 h. Cell
monolayers were rinsed in PBS, lysed in Trizol (Invitrogen,
Carlsbad, CA) and phenol/chloroform extracted. An equal volume of 70% ethanol was added to the extracted aqueous phase,
the solution was applied to an RNAeasy midi column (Qiagen,
Valencia, CA), which was washed and eluted in diethyl pyrocarbonate-H2O.
Western Blotting. Ten ␮g of cell or nuclear extracts
were electrophoresed on 8 –16% Tris Glycine gels (Invitrogen).
After electrotransfer, polyvinylidene difluoride membranes
were divided based on molecular weight markers and incubated
with anti-Nm23-H1 antibody 11 (1:500; Lab Vision/Neomarker,
Fremont, CA), anti-␣-tubulin antibody (1:2000; Oncogene, Boston, MA) or anti-GR antibody (1:1000; BD Transduction Laboratories, San Diego, CA) for 1 h at room temperature. After
incubation in secondary antibody per the manufacturer’s directions, blots were processed for chemiluminescence using the
enhanced chemiluminescence detection system (Amersham,
Piscataway, NJ).
Northern Blotting. Ten ␮g of total RNA were used for
Northern blotting with Ambion Northern Max kit (Ambion,
Austin, TX). Detection of nm23-H1 transcripts was performed
using a full-length nm23-H1 double-stranded DNA probe, labeled with [32P]␥-dATP (Amersham) using the Prime It Kit
(Stratagene, La Jolla, CA). Filters were exposed to autoradiography film using intensifying screens at ⫺70°C for typically
24 –72 h.
Promoter Mutagenesis. The pBA and pBT plasmids
containing nm23-H1 promoter fragments, as well as the CTF/
NF1 mutant of pBT were described previously (38). To generate
the pBTmGRE plasmid, which contained mutated GREs, the
Quickchange site-directed mutagenesis kit (Stratagene) was
used on the pBT construct. The following primers showing
the mutated sites in bold were used: mGRE-5, 5⬘-CTGCAGAAAGTACTTAGCTAGAATGACTGCC (wild type, CTGCAGAAAGTTGTTCCCTAGAATGACTGCC); and mGRE-3, GTGGGCGAGCGGACTTAGGCAAAATGGGCTCT (wild type,
GTGGGCGAGCGGTGTTCTGCAAAATGGGCTCT). The generated mutants were sequence verified.
Transfections and Transcriptional Analysis. Cells
(8 ⫻ 104) were seeded in 6-well plates 24 h before transfection
Clinical Cancer Research 3765
with 1 ␮g of pBT construct or variants thereof and 0.3-␮g
pRL-TK (encoding Renilla luciferase; Promega, Madison, WI)
using the Effectene reagent (Qiagen). After 24 h, the transfected
cells were treated with the indicated doses of MPA, dexamethasone, or vehicle in serum-free medium supplemented with 0.5%
CSS. Cells were harvested at the times indicated and assayed for
dual-luciferase activity using the Dual Luciferase Assay System
according to the manufacturer’s instructions (Promega). Results
are representative of two to three independent experiments in
triplicate. Transient transfection of the pBA plasmid and cell
culture was performed as described above. CAT and ␤-galactosidase assays were performed as described previously (38).
Data represent triplicate determinations of duplicate experiments.
Soft Agar Colonization Assays. Cells (2 ⫻ 104) were
plated in 0.5 ml of culture medium containing 0.3% (w/v) top
agar in 24-well plates as described previously (7). At the time of
seeding, the culture was supplemented with the indicated doses
of MPA or vehicle. After 14 days of culture, colonies (⬎50
cells) were counted. Results are representative of three independent experiments in triplicate.
Proliferation Assays. Cells were seeded in 96-well
plates at 5000 cells/well and allowed to grow for 24 h. The
medium was changed and supplemented with the indicated
drugs or vehicle, and the proliferation assay was performed
72–96 h later using the cell titer 96 nonradioactive cell proliferation assay from Promega, according to the manufacturer’s
instructions. Data are representative of three independent experiments in quintuplicate.
Statistical Analysis. Differences between paired samples were calculated using a two-tailed student’s t test, using the
Prism 3.0 software or using ANOVA. Densitometry was performed using the ␣ Innotech ChemiImager 4400, normalizing
Nm23-H1 bands to the tubulin control.
Fig. 1 Dexamethasone elevated Nm23-H1 expression levels in metastatic human breast carcinoma cell lines. Cells were grown in serum-free
medium supplemented with 0.5% CSS and treated for 96 h with the
indicated concentrations of dexamethasone. Equal amounts of total
protein from each cell line were processed as a Western blot using
anti-Nm23 antibody 11 or anti-␣-tubulin antibody for normalization.
The position of Nm23-H1, Nm23-H2, and ␣-tubulin are indicated.
Dexamethasone elevated the Nm23-H1 expression of the metastatic
MDA-MB-231 and MDA-MB-435 cell lines but not the poor nonmetastatic MCF-7 or ZR-75 cell lines.
RESULTS
Dexamethasone Elevation of Nm23-H1 Expression in
Metastatic Breast Carcinoma Cell Lines in Vitro. In the
experiment shown in Fig. 1, four human breast carcinoma cell
lines were incubated for 4 days in CSS-containing culture medium supplemented with varying concentrations of the glucocorticoid dexamethasone. Nm23-H1 expression was determined on Western blots using an antitubulin hybridization as a
loading control. The MDA-MB-231 cell line is metastatic in
vivo (14, 39). A 2-fold elevation of Nm23-H1 expression was
observed in response to 100 nM dexamethasone, and an additional elevation to 3-fold was observed at 1–10 ␮M dexamethasone, with a high-dose inhibition. For metastatic MDA-MB-435
cells (39), the dose response showed 2.6-fold elevation at ⬎10
nM, with inhibition at ⬎1 ␮M dexamethasone. Similar trends
were observed for Nm23-H2. No change in Nm23-H1 or
Nm23-H2 expression was observed in the MCF-7 or ZR-75 cell
lines in response to dexamethasone treatment. These cell lines
are virtually nonmetastatic to the lungs in vivo (40) and express
high endogenous Nm23-H1 levels (38).
Additional characterization of glucocorticoid-induced
Nm23-H1 expression is shown using MDA-MB-231 cells in
Fig. 2. Another glucocorticoid, prednisolone, elevated
Nm23-H1 expression in vitro in the 500 nM to 10 ␮M dose range
(Fig. 2A). Nm23-H1 expression was not elevated by incubation
with 100 –250 nM prolactin, a hormone that contributes to
MMTV regulation via a distinct set of transcription factors (Fig.
2B). Dexamethasone possesses both anti-inflammatory and glucocorticoid properties. To determine whether an anti-inflammatory compound could influence Nm23-H1 expression, MDAMB-231 cells were incubated in FCS-containing culture
medium with two Cox inhibitors, indomethacin or NS398 (41).
Neither agent altered Nm23-H1 expression as determined by
Western blots (Fig. 2C), and similar effects were observed when
these agents were added to CSS-containing culture medium
supplemented with glucocorticoids (data not shown), in agreement with Natarajan et al. (35). The data are consistent with a
glucocorticoid-based mechanism of action. Time course experiments indicated that dexamethasone elevation of Nm23-H1
expression required 4 days of exposure (data not shown).
The high-dose inhibition of the dexamethasone effect (Fig.
1) suggested that pharmacological dexamethasone concentrations may be ineffective at elevating Nm23-H1 expression.
Additional support for this conclusion is provided in the experiment shown in Fig. 3 in which dexamethasone failed to elevate
3766 MPA Elevation of Nm23 Expression
Fig. 2 Glucocorticoids elevate Nm23-H1 expression in MDA-MB-231
human breast carcinoma cells independently of their Cox-mediated
anti-inflammatory activity. MDA-MB-231 cells were cultured for 96 h
in serum-free medium supplemented with 0.5% CSS and prednisolone
(A) or prolactin (B). C, cells were cultured for 96 h in FCS-containing
cultures, with or without the Cox inhibitors Indomycin and NS398.
Equivalent amounts of total protein from cell lysates were processed for
Western blots as described in the legend to Fig. 1.
Nm23-H1 expression in FCS-containing cultures, which contain
endogenous levels of corticosteroids. As this finding limited the
potential in vivo usage of dexamethasone as a Nm23-H1 elevating agent, we searched for a GR agonist with a different mechanism of action.
MPA Elevation of Nm23-H1 Expression. MPA is well
known as a PR agonist, but also has been reported to bind GR
and the AR. MPA also affects glucocorticoid responses through
a posttranscriptional mechanism involving GR, independent of
GRE binding (42– 44). On the basis of this mechanistic diversity, we asked if MPA elevated Nm23-H1 expression and if it
did so with an altered dose response or serum requirement.
MDA-MB-231 and MDA-MB-435 breast carcinoma cell lines
were determined to be PR⫺ by both Western and reverse
transcription-PCR analyses (data not shown). In the experiments
shown in Fig. 4 MDA-MB-231 and MDA-MB-435 cells were
incubated for 3 days in varying doses of MPA in either CSS- or
FCS-containing medium, and the Nm23-H1 expression of the
cell lysates determined on Western blots. MPA elevated
Nm23-H1 expression in both cell lines under both culture conditions in contrast to dexamethasone (Figs. 1 and 3). Elevation
of Nm23-H1 expression was observed at higher MPA concentrations in FCS-containing cultures, ⱖ3-fold at 10 nM to 10 ␮M
for MDA-MB-435 cells and 3-fold at 1 ␮M for MDA-MB-231
cells. MPA had no effect on the Nm23-H1 expression of MCF-7
and ZR-75 cells (data not shown). Both MPA and clinical grade
Depo-Provera elevated Nm23-H1 expression with comparable
dose response curves (data not shown).
Mechanistic Studies. Transiently transfected reporter
gene constructs were used to determine the transcriptional effects of dexamethasone and MPA on nm23-H1 expression using
MDA-MB-231 breast carcinoma cells. In the experiment shown
in Fig. 5A, MDA-MB-231 cells were transiently transfected
Fig. 3 Dexamethasone fails to elevate Nm23-H1 expression in the
presence of FCS in metastatic human breast carcinoma cell lines. Cells
were cultured for 96 h in medium supplemented with 10% FCS and the
indicated doses of dexamethasone. Equivalent amounts of total protein
from cell lysates were processed for Western blots as described in the
legend to Fig. 1.
with pBT, a plasmid containing a 443-bp nm23-H1 promoter
tethered to Firefly luciferase and cultured 4 days in 0.5% CSScontaining medium. Transfection efficiency was normalized by
cotransfection of a Renilla luciferase plasmid. MDA-MB-231
cells cultured in the presence of 10 nM dexamethasone showed
an 80% increase in reporter gene expression as compared with
vehicle controls or cells cultured with 50 ng/ml prolactin, in
agreement with Western blot data (Figs. 1 and 2). Mutation of
two GREs in pBT abolished the dexamethasone response (Fig.
5B). In experiments not shown, mutation of the CTF/NF1 halfsite in the nm23-H1 promoter also abolished dexamethasone
stimulation of reporter gene expression, in agreement with its
contributory role in nm23 expression (38) and crucial role in
mediating glucocorticoid responses in MMTV (45). Also, cotransfection of a GR plasmid did not alter the effect of dexamethasone on nm23-H1 transcription, indicating that maximum
functional GR was present endogenously (data not shown).
Similar conclusions were obtained when using MPA over a
shorter time course (Fig. 5C). MPA stimulated reporter gene
expression by 88% at 48 h of culture, a time point when
dexamethasone was inactive. Mutation of the GREs abolished
this response. Both dexamethasone and MPA also stimulated
reporter gene expression using a different reporter construct
containing a longer (2.1 kb) fragment of the nm23-H1 promoter
(Fig. 5D). These data are consistent with a transcriptional elevation of nm23-H1 expression by dexamethasone and MPA for
cells cultured in CSS-containing medium, with MPA exerting a
more rapid effect over time. In contrast, no elevation of
nm23-H1 reporter gene expression was observed in FCScontaining cultures using constructs containing either the 2.1- or
443-bp promoter fragments, in response to 1 nM to 1 ␮M MPA
over a period of 1–5 days of culture (data not shown). In
agreement with these data, no elevation of nm23-H1 mRNA
levels was observed in response to 1 nM to 1 ␮M MPA treatment
of MDA-MB-231 cells cultured in FCS-containing medium on
Northern blots (data not shown). These data suggest that dexamethasone and MPA can increase Nm23-H1 expression transcriptionally, but in the presence of endogenous levels of corticosteroids, additional posttranscriptional mechanisms must be
operative for MPA.
Clinical Cancer Research 3767
Fig. 4 MPA elevates the Nm23-H1 expression of
metastatic human breast carcinoma cell lines in the
presence or absence of FCS. MDA-MB-231 (A)
and MDA-MB-435 (B) cells were cultured in 0.5%
CSS-supplemented medium (left panels) or 10%
FCS-supplemented medium (right panels) and the
indicated doses of MPA for 72 h. Equivalent
amounts of total protein from cell lysates were
processed for Western blots as described in the
legend to Fig. 1.
If MPA elevation of Nm23-H1 expression in FCS-containing cultures used a different mechanism of action, was it still
GR-dependent? Incubation of MDA-MB-231 cells with MPA in
FCS-containing culture medium resulted in nuclear accumulation of GR (Fig. 6A). In the experiment shown in Fig. 6B, the
effect of the GR/PR antagonist RU-486 was determined on
MPA elevation of Nm23-H1 expression. MDA-MB-231 cells
were incubated with MPA in FCS-containing culture medium,
with or without a 10⫻ molar excess of RU-486. RU-486 inhibited MPA elevation of Nm23-H1, 58% at 100 nM MPA, and to
control levels at 1 ␮M MPA, according to densitometric analysis. These data are consistent with a GR-based mechanism of
action for MPA elevation of Nm23-H1 expression, because the
cells were PR⫺. The time course of MPA elevation of
Nm23-H1 expression required 72 h of culture (Fig. 6C). Removal of MPA from the culture medium for an additional 24 h
resulted in minimal loss of Nm23-H1 expression but declined to
baseline levels after 48 h (data not shown).
Effects on Colonization in Vitro. Colonization of metastatic tumor cells at a distant site may be partially modeled in
soft agar assays. Transfection of nm23-H1 into MDA-MB-435
cells had no significant effect on anchorage-dependent growth;
nm23-H1 transfection inhibited the anchorage-independent colonization of MDA-MB-435 cells in soft agar (7). In experiments
not shown, MPA had no effect on the anchorage-dependent
proliferation of MDA-MB-231 or MDA-MB-435 breast carcinoma cells. The effect of MPA on anchorage-independent colonization of MDA-MB-231 cells in FCS-containing culture
medium is shown in Fig. 7. MPA inhibited soft agar colonization by 40 –50%. The inhibitory doses of MPA overlapped those
doses that elevated Nm23-H1 expression in FCS-containing
cultures. Similar effects were observed using MDA-MB-435
breast carcinoma cells (data not shown).
DISCUSSION
We provide the first demonstration that the GR agonists
dexamethasone, prednisolone, and MPA elevate the Nm23-H1
metastasis suppressor expression of two metastatic human
breast carcinoma cell lines in vitro. The hypothesis that long-
term pharmacological elevation of metastasis suppressor expression can function to limit metastastic colonization in vivo is
attractive but requires lead agents for testing. Of the three
steroids tested herein, MPA was capable of elevating Nm23-H1
expression in culture medium containing the endogenous corticosteroids present in FCS and is therefore hypothesized to be
effective in the bloodstream. MPA also inhibited the soft agar
colonization of the human breast carcinoma cell lines in vitro.
These experiments identify MPA as a lead agent for the elevation of breast carcinoma Nm23-H1 metastasis suppressor expression and the inhibition of metastasis in vivo in mouse
xenograft systems, ongoing in our laboratory.
Elevation of Nm23-H1 expression by MPA in FCScontaining cultures was generally ⱖ3-fold. The phenotypic effects of low-level overexpression of Nm23 have been studied in
several systems. For MDA-MB-435 breast carcinoma cells, we
reported that 4-fold overexpression of Nm23-H1 produced
lymph node or pulmonary metastases in 19% of injected mice,
as compared with 50 –59% of control transfectants (7). Similarly, 4-fold overexpression of Nm23-H1 in MDA-MB-231
breast carcinoma cells resulted in metastases in 38% of injected
mice, as compared with 71% of controls (14). In another study,
metastasis suppressed nm23 transfectants exhibited ⬍2-fold elevation of Nm23’s nucleoside diphosphate kinase enzymatic
activity (15). Thus, although additional study of the phenotypic
effects of low-level Nm23-H1 overexpression is warranted, the
literature to date suggests that expression levels associated with
in vivo-phenotypic effects are described herein.
Dexamethasone elevated Nm23-H1 expression over a
4-day time course in the absence of endogenous steroids via a
transcriptional, GR-based mechanism. MPA exhibited a more
rapid time course of transcriptional stimulation using similar
culture conditions. Additionally, in the presence of endogenous
corticosteroids in FCS, MPA elevated Nm23-H1 expression via
a posttranscriptional mechanism. This finding is consistent with
a small but diverse body of literature describing nonclassical
effects of MPA in other model systems. Bamberger et al. (44)
initially reported a dissociative activity for MPA. MPA transre-
3768 MPA Elevation of Nm23 Expression
Fig. 5 Dexamethasone and MPA elevate nm23-H1 promoter activity in MDA-MB-231 human breast carcinoma cells in CSS-containing culture
medium. A–C, the pBT plasmid containing 443 bp of the nm23-H1 promoter tethered to Firefly luciferase was transiently cotransfected into
MDA-MB-231 cells with a pRL-TK normalization vector containing Renilla luciferase. The promoter activities are expressed as the relative light units
(RLUs) of Firefly versus Renilla luciferase activities. Each point represents the mean ⫾ SEM of three replicates, and the data are normalized to either
pBT or pB2 in control medium as 100%. A, MDA-MB-231 cells were cultured for 96 h in control vehicle (V), 10 nM dexamethasone (Dex) or 50
ng/ml prolactin. Reporter gene expression in dexamethasone-treated cultures significantly different from control, P ⫽ 0.0014. B, the pBT plasmid was
mutated to alter the sequence of two GREs, resulting in the pBTmGRE plasmid. Cells were transiently transfected with either pBT or pBTmGRE and
cultured for 96 h with or without 10 nM dexamethasone. Reporter gene expression significantly different in dexamethasone and control cultures, P ⫽
0.0024. C, MDA-MB-231 cells were transiently transfected with either pBT or pBTmGRE and cultured for 48 h in the presence or absence of 10 nM
dexamethasone or 1 nM MPA. Reporter gene expression in 1 nM MPA culture significantly different from control, P ⫽ 0.0006. D, a pB2 plasmid
containing 2.1 kb of the nm23-H1 promoter tethered to CAT was transiently cotransfected with a p-SV-␤-galactosidase normalization construct.
MDA-MB-231 cells were cultured for 96 h in the presence of absence of 10 nM dexamethasone or 10 nM MPA. Each point represents the mean ⫾
SEM of three replicate CAT activity measurements, with cells in vehicle normalized to 100%. Reporter gene expression of the control culture was
significantly different from 10 nM dexamethasone, P ⫽ 0.0047, and 10 nM MPA, P ⫽ 0.0026.
pressed the interleukin 2 promoter via a GR-related mechanism
in T lymphocytes, without demonstrable stimulation of a GRE
reporter construct. In another cytokine model system, MPA
decreased uterine smooth muscle cell production of interelukin-1␣ without affecting the transcriptional activation of
its promoter construct (46). Finally, MPA up-regulated p27Kip1
expression in human endometrial cells, without an increase in
p27 mRNA, similar to data presented herein. Decreased degradation of p27 protein in response to MPA was observed (47).
The glucocorticoid literature identifies additional potential
points of posttranscriptional regulation that could be applicable,
including the modulation of interacting cyclic AMP, nuclear
factor-␬B, Grb2, and G-protein-mediated pathways (48 –51),
and intracellular redistribution of signaling components (52).
Our data indicate that MPA elevation of breast carcinoma
Nm23-H1 expression was GR dependent and PR-independent
because the cell lines used herein were PR⫺ and GR⫹ by
Northern and Western blot analyses.
MPA inhibited the soft agar colonization of both metastatic
breast carcinoma cell lines by ⬃50%. Although soft agar colonization may be representative of several aspects of tumor
progression in vivo, we suggest that it may model the colonization of single metastatic cells in a distant organ, independent of
primary tumor cell:cell, cell:extracellular matrix, and cell:local
cytokine interactions (2). We previously reported that the colonization of MDA-MB-435 breast carcinoma cells was stimulated by addition of TGF-␤ and that nm23-H1 transfectants
continued to colonize poorly under these conditions (7). Our
recent experiments showed variability in TGF-␤ stimulation of
colonization: of 10 experiments conducted using 1–10 ng/ml
TGF-␤, 2 resulted in ⱖ2-fold stimulation of colonization, 3
resulted in 40 –50% stimulation of colonization, and the rest
Clinical Cancer Research 3769
Fig. 7 MPA inhibits the anchorage-independent growth of metastatic
human MDA-MB-231 breast carcinoma cells. MDA-MB-231 cells were
cultured in 10% FCS supplemented medium containing 0.3% (w/v) agar
and the indicated doses of MPA for 14 days. The number of colonies
(⬎50 cells) per culture was counted. Data represent the mean ⫾ SEM of
triplicate determinations from a single experiment, representative of
three conducted. Vehicle control was significantly different from MPA,
P ⬍ 0.01 (ⴱⴱ) and P ⬍ 0.001 (ⴱⴱⴱ) by ANOVA.
Fig. 6 MPA elevation of MDA-MB-231 human breast carcinoma cell
line Nm23-H1 expression in the presence of FCS is associated with
binding to and translocation of GR. A, MDA-MB-231 cells were cultured for 72 h in medium containing 10% FCS and supplemented with
the indicated doses of MPA. Cell lysates were fractionated into cytoplasmic and nuclear compartments, and equivalent amounts of total
protein from each compartment processed as a Western blot, probed
with anti-GR. Translocation of GR to the nucleus was observed in all
MPA-treated cells. Control rehybridizations of the Western blot with
antibodies to the nuclear protein H2B and to cytoplasmic protein tubulin
are shown to demonstrate relative purity. B, cells were cultured for 72 h
in medium containing 10% FCS and supplemented with the indicated
doses of MPA or the GR/PR antagonist RU-486. Equivalent amounts of
total protein from cell lysates were processed for Western blots using
anti-Nm23 antibody as described in the legend to Fig. 1. RU-486
partially inhibited MPA elevation of Nm23-H1 expression. C, time
course of MPA elevation of Nm23-H1 expression. FCS-containing
cultures of cells treated or untreated with MPA were harvested on days
1–3, and Western blots of Nm23-H1 expression were prepared.
were negative. For those experiments where TGF-␤ stimulated
colonization, addition of MPA at the doses shown on Fig. 7
inhibited colonization by 50%. The reason for this variability is
unknown but included multiple lots and doses of TGF-␤.
An obvious drawback of MPA as a lead agent for elevation
of metastasis suppressor expression is its multiplicity of known
activities. In cellular model systems, MPA has been reported to
be growth inhibitory, alone or in combination with other hormones or chemotherapeutic agents (53–56). MPA is also known
to affect insulin-like growth factor binding protein levels (57),
angiogenic factors (58, 59), and apoptosis (55, 60). Clearly,
MPA effects may be cell type specific and within a cell type
may be affected by the relative expression of the AR, PR, and
GR. Effects on both the host and tumor cells have been reported.
We plan to study the effects of MPA in vivo using a defined
PR⫺, GR⫹ carcinoma xenografts, which may be applicable to
only a subset of high-risk patients. We note herein that other
proposed therapeutic agents, originally identified for their mo-
lecular specificity, have subsequently been found to exert additional activities, which may be beneficial or adverse (61, 62).
Second generation, more specific metastasis suppressor elevating agents would represent a potential advance.
In mouse breast cancer model systems, two distinct effects
of MPA have been reported. In vivo, MPA inhibited rat 7,12dimethylbenz(a)anthracene mammary tumor formation (63) and
suppressed the proliferation and differentiation of MCF-7 tumor
cells (64). In contrast, MPA-induced murine mammary tumors
have been reported previously (65, 66). MPA has been reported
to stimulate growth factor production via the PR in breast
explants, suggesting that the stimulatory effect may be PR
driven (67). In humans, MPA is used at low doses in the oral
contraceptive Depo-Provera, with a long-term record of low
toxicity (68). On the basis of the reports of stimulatory effects of
MPA on cancer in rodents, an analysis of pooled case-control
studies of Depo-Provera in humans concluded that the relative
risk for breast cancer among women was insignificant (relative
risk, 1.1; 95% confidence interval, 0.97–1.4; Ref. 69). At higher
doses, MPA has been tested in clinical trials against metastatic
breast and uterine cancers. Although clinical responses were
reported in breast cancer trials, no maximum-tolerated dose or
optimal schedule was agreed upon (reviewed in Ref. 70). As our
translational hypothesis concerning elevation of Nm23-H1 expression would entail the chronic administration of MPA or a
similar agent, we have examined two recently reported clinical
trials using longer term dosing. A randomized trial, including
270 node-positive patients with median 13 years of follow-up,
was reported (71). Node-positive patients were given cyclophosphamide, methotrexate, 5-fluorouracil chemotherapy and randomized to 6 months of placebo or MPA, consisting of a
1-month induction schedule followed by a maintenance dose.
No difference was noted in the overall clinical course of the
node-positive patients. However, when patients were dichotomized by age, older patients (ⱖ50 years) showed a significantly
prolonged relapse-free (P ⫽ 0.01) survival on the MPA arm; the
3770 MPA Elevation of Nm23 Expression
reverse was true of younger patients. A similar conclusion was
reached by a second group with 12 years of follow-up (72). A
total of 409 patients was treated with adjuvant cyclophosphamide, doxorubicin, 5-fluorouracil chemotherapy and randomized to a 6-month course of MPA, also given as an induction and
maintenance schedule. No difference in survival was noted for
the group as a whole, but subset analysis again noted better
metastasis-free (P ⫽ 0.01) and overall (P ⫽ 0.02) survival for
older patients (⬎60 years). These trends suggest a beneficial
effect of long-term MPA dosing in a postmenopausal patients. It
may be of interest to determine whether patients with low
Nm23-H1, GR⫹, PR⫺ tumors responded better.
ACKNOWLEDGMENTS
We thank Dr. Barbara Vonderhaar, National Cancer Institute, for
assays of progesterone and androgen receptors and Dr. George Chrousos, National Institute of Child Health and Human Development, for
helpful discussion.
REFERENCES
1. Yoshida, B., Sokoloff, M., Welch, D., and Rinker-Schaeffer, C.
Metastasis-suppressor genes: a review and perspective on an emerging
field. J. Natl. Cancer Inst. (Bethesda), 92: 1717–1730, 2000.
2. Steeg, P. Metastasis suppressors alter the signal transduction of
cancer cells. Nat. Cancer Rev., 3: 55– 63, 2003.
3. Chekmareva, M., Kadkhodaian, M., Hollowell, C., Kim, H., Yoshida, B., Luu, H., Stadler, W., and Rinker-Schaeffer, C. Chromosome
17-mediated dormancy of AT6.1 prostate cancer micrometastases. Cancer Res., 58: 4963– 4969, 1998.
4. Goldberg, S., Harms, J., Quon, K., and Welch, D. Metastasis suppressed C8161 melanoma cells arrest in lung but fail to proliferate. Clin.
Exp. Metastasis, 17: 601– 607, 1999.
5. Lee, J., and Welch, D. Suppression of metastasis in human breast
carcinoma MDA-MB-435 cells after transfection with the metastasis
suppressor gene. Kiss-1. Cancer Res., 57: 2384 –2387, 1997.
6. Robinson, V., Hickson, J., Griend, D. V., Dubauskas, Z., and RinkerSchaeffer, C. MKK4 and metastasis suppression: a marriage of signal
transduction and metastasis research. Clin. Exp. Metastasis, 20: 25–30,
2003.
7. Leone, A., Flatow, U., VanHoutte, K., and Steeg, P. S. Transfection
of human nm23–H1 into the human MDA-MB-435 breast carcinoma
cell line: effects on tumor metastatic potential, colonization, and enzymatic activity. Oncogene, 8: 2325–2333, 1993.
8. Cropp, C., Lidereau, R., Leone, A., Liscia, D., Cappa, A., Campbell,
G., Barker, E., Doussal, V. L., Steeg, P., and Callahan, R. NME1 protein
expression and loss of heterozygosity mutations in primary human
breast tumors. J. Natl Cancer Inst. (Bethesda), 86: 1167–1169, 1994.
9. Miyazaki, T., Kato, H., Shitara, Y., Yoshikawa, M., Tajima, K.,
Masuda, N., Shouji, H., Tsukada, K., Nakajima, T., and Kuwano, H.
Mutation and expression of the metastasis suppressor gene KAI1 in
esophageal squamous cell carcinoma. Cancer (Phila.), 89: 955–962,
2000.
10. Steeg, P. S., Bevilacqua, G., Kopper, L., Thorgeirsson, U. P.,
Talmadge, J. E., Liotta, L. A., and Sobel, M. E. Evidence for a novel
gene associated with low tumor metastatic potential. J. Natl. Cancer Inst.
(Bethesda), 80: 200 –204, 1988.
11. Lacombe, M-L., Milon, L., Munier, A., Mehus, J., and Lambeth, D.
The human Nm23/nucleoside diphosphate kinases. J. Bioenerg. Biomembr., 32: 247–258, 2000.
12. Leone, A., Flatow, U., King, C. R., Sandeen, M. A., Margulies,
I. M. K., Liotta, L. A., and Steeg, P. S. Reduced tumor incidence,
metastatic potential, and cytokine responsiveness of nm23-transfected
melanoma cells. Cell, 65: 25–35, 1991.
13. Bhujwalla, Z., Aboagye, E., Gilles, R., Chack, V., Mendola, C., and
Backer, J. Nm23-transfected MDA-MB-435 human breast carcinoma
cells form tumors with altered phospholipid metabolism and pH: a 31P
nuclear magnetic resonance study in vivo and in vitro. Magn. Res. Med.,
41: 897–903, 1999.
14. Russell, R., Pedersen, A., Kantor, J., Geisinger, K., Long, R.,
Zbieranski, N., Townsend, A., Shelton, B., Brunner, N., and Kute, T.
Relationship of nm23 to proteolytic factors, proliferation, and motility in
breast cancer tissues and cell lines. Br. J. Cancer, 78: 710 –717, 1998.
15. Fukuda, M., Ishii, A., Yasutomo, Y., Shimada, N., Ishikawa, N.,
Hanai, N., Nagara, N., Irimura, T., Nicolson, G., and Kimura, N.
Metastatic potential of rat mammary adenocarcinoma cells associated
with decreased expression of nucleoside diphosphate kinase/nm23: reduction by transfection of NDP kinase a isoform, an nm23–H2 gene
homolog. Int. J. Cancer, 65: 531–537, 1996.
16. Baba, H., Urano, T., Okada, K., Furukawa, K., Nakayama, E.,
Tanaka, H., Iwasaki, K., and Shiku, H. Two isotypes of murine nm23/
nucleoside diphosphate kinase, nm23–M1 and nm23–M2, are involved
in metastatic suppression of a murine melanoma line. Cancer Res., 55:
1977–1981, 1995.
17. Miele, M. E., Rosa, A. D. L., Lee, J. H., Hicks, D. J., Dennis, J. U.,
Steeg, P. S., and Welch, D. R. Suppression of human melanoma metastasis following introduction of chromosome 6 is independent of
NME1 (nm23). Clin. Exp. Metastasis, 15: 259 –265, 1997.
18. Parhar, R. S., Shi, Y., Zou, M., Farid, N. R., Ernst, P., and AlSedairy, S. Effects of cytokine mediated modulation of Nm23 expression on the invasion and metastatic behavior of B16F10 melanoma cells.
Int. J. Cancer, 60: 204 –210, 1995.
19. Tagashira, H., Hamazaki, K., Tanaka, N., Gao, C., and Namba, M.
Reduced metastatic potential and c-myc overexpression of colon adenocarcinoma cells (colon 26 line) transfected with nm23–R2 rat nucleoside diphosphate kinase a isoform. Int. J. Mol. Med., 2: 65– 68, 1998.
20. Miyazaki, H., Fukuda, M., Ishijima, Y., Negishi, A., Hirayama, R.,
Ishikawa, N., Amagasa, T., and Kimura, N. Overexpression of nm23–
H2/NDP kinase B in a human oral squamous cell carcinoma cell line
results in reduced metastasis, differentiated phenotype in the metastatic
site, and growth factor-independent proliferative activity in culture.
Clin. Cancer Res., 5: 4301– 4307, 1999.
21. MacDonald, N., Freije, J., Stracke, M., Manrow, R., and Steeg, P.
Site directed mutagenesis of nm23–H1: mutation of proline 96 or serine
120 abrogates its motility inhibitory activity upon transfection into
human breast carcinoma cells. J. Biol. Chem., 271: 25107–25116, 1996.
22. Kantor, J. D., McCormick, B., Steeg, P. S., and Zetter, B. R.
Inhibition of cell motility after nm23 transfection of human and murine
tumor cells. Cancer Res., 53: 1971–1973, 1993.
23. Bemis, L., and Schedin, P. Reproductive state of rat mammary
gland stroma modulates human breast cancer cell migration and invasion. Cancer Res., 60: 3414 –3418, 2000.
24. Howlett, A. R., Petersen, O. W., Steeg, P. S., and Bissell, M. J. A
novel function for Nm23: overexpression in human breast carcinoma
cells leads to the formation of basement membrane and growth arrest.
J. Natl. Cancer Inst. (Bethesda), 86: 1838 –1844, 1994.
25. Lombardi, D., Palescandolo, E., Giordano, A., and Paggi, M. Interplay between the antimetastatic nm23 and the retinoblastoma-related
Rb2/p130 genes in promoting neuronal differentiation of PC12 cells.
Cell Death Differ., 8: 470 – 476, 2001.
26. Backer, M., Kamel, N., Sandoval, C., Jayabose, S., Mendola, C.,
and Backer, J. Overexpression of NM23–1 enhances responsiveness of
IMR-32 human neuroblastoma cells to differentiation stimuli. Anticancer Res., 20: 1743–1749, 2000.
27. Negroni, A., Venturelli, D., Tanno, B., Amendola, R., Ransac, S.,
Cesi, V., Calabretta, B., and Raschelia, G. Neuroblastoma specific
effects of DR-nm23 and its mutant forms on differentiation and apoptosis. Cell Death Differ., 7: 843– 850, 2000.
28. Lombardi, D., Lacombe, M., and Paggi, M. nm23: unraveling its
biological function in cell differentiation. J. Cell. Physiol., 182: 144 –
149, 2000.
29. Ishijima, Y., Shimada, N., Fukada, M., Miyazaki, H., Orlov, N.,
Orlova, T., Yamada, T., and Kimura, N. Overexpression of nucleoside
diphosphate kinases induced neurite outgrowth and their substitution to
Clinical Cancer Research 3771
inactive forms leads to suppression of nerve growth factor- and dibutryl
cAMP-induced effects in PC12D cells. FEBS Lett., 445: 155–159,
1999.
30. Amendola, R., Martinez, R., Negroni, A., Venturelli, D., Tanno, B.,
Calabretta, B., and Raschella, G. DR-nm23 gene expression in neuroblastoma cells: Relationship to integrin expression, adhesion characteristics, and differentiation. J. Natl. Cancer Inst. (Bethesda), 89: 1300 –
1310, 1997.
31. Gervasi, F., D’Agnano, I., Vossio, S., Zupi, G., Sacchi, A., and
Lombardi, D. nm23 influences proliferation and differentiation of PC12
cells in response to nerve growth factor. Cell Growth Differ., 7: 1689 –
1695, 1996.
32. Hartsough, M., and Steeg, P. Nm23/Nucleoside diphosphate kinase
in human cancers. J. Bioenerg. Biomembr., 32: 301–308, 2000.
33. Liu, F., Qi, H-L., and Chen, H-L. Effects of all-trans retinoic acid
and epidermal growth factor on the expression of nm23–H1 in human
hepatocarcinoma cells. J. Cancer Res. Clin. Oncol., 126: 85–90, 2000.
34. Lin, K., Wang, W., Wu, Y., and Cheng, S. Activation of antimetastatic Nm23–H1 gene expression by estrogen and its a-receptor. Endocrinology, 143: 467– 475, 2002.
35. Natarajan, K., Mori, N., Artemov, D., and Bhujwalla, Z. Exposure
of human breast cancer cells to the anti-inflammatory agent indomethacin alters choline phospholipid metabolites and Nm23 expression. Neoplasia, 4: 409 – 416, 2002.
36. Jiang, W., Hiscox, S., Bryce, R., Horrobin, D., and Mansel, R. The
effects of n-6 polyunsaturated fatty acids on the expression of nm-23 in
human cancer cells. Br. J. Cancer, 77: 731–738, 1988.
37. Hartsough, M., Clare, S., Mair, M., Elkahloun, A., Sgroi, D.,
Osborne, C., Clark, G., and Steeg, P. Elevation of breast carcinoma
nm23–H1 metastasis suppressor gene expression and reduced motility
by DNA methylation inhibition. Cancer Res., 61: 2320 –2327, 2001.
38. Ouatas, T., Clare, S., Hartsough, M., DeLaRosa, A., and Steeg, P.
A cassette of mammary-specific transcription factor binding sites contributes to nm23–H1 promoter activity in human breast carcinoma cell
lines. Clin. Exp. Metastasis, 19: 35– 42, 2002.
39. Price, J. E., Polyzos, A., Zhang, R. D., and Daniels, L. M. Tumorigenicity and metastasis of human breast carcinoma cell lines in nude
mice. Cancer Res., 50: 717–721, 1990.
40. Thompson, E., Paik, S., Brunner, N., Sommers, C., Zugmaier, G.,
Clarke, R., Shima, T., and Tarri, J. Association of increased basement
membrane invasiveness with absence of estrogen receptor and expression of vimentin in human breast cancer cell lines. J. Cell. Physiol., 150:
534 –544, 1992.
41. Liu, X., Yao, S., Kirschenbaum, A., and Levine, A. NS398, a
selective cyclooxygenase-2 inhibitor, induces apoptosis and downregulates bcl-2 expression in LnCaP cells. Cancer Res., 58: 4245– 4249,
1998.
42. Selman, P., Wolfswinkel, J., and Mol, J. Binding specificity of
medroxyprogesterone acetate and proligesterone for the progesterone
and glucocorticoid receptor in the dog. Steroids, 61: 133–137, 1996.
43. Bentel, J., Birrell, S., Pickering, M., Holds, D., Horsfall, D., and
Tilley, W. Androgen receptor agonist activity of the synthetic progestin
medroxyprogesterone acetate, in human breast cancer cells. Mol. Cell.
Endocrinol., 154: 11–20, 1999.
44. Bamberger, C., Else, T., Bamberger, A., Beil, F., and Shulte, H.
Dissociative glucocorticoid activity of Medroxyprogesterone Acetate in
normal human lymphocytes. J. Biol. Chem., 84: 4055– 4061, 1999.
45. Pina, B., Bruggemeier, U., and Beato, M. Nucleosome positioning
modulates accessibility of regulatory proteins to the mouse mammary
tumor virus promoter. Cell, 60: 719 –731, 1990.
46. Lan, L., Vinci, J., Melendez, J., Jeffrey, J., and Wilcox, B. Progesterone mediates decreases in uterine smooth muscle cell interelukin-1a
by a mechanism involving decreased stability of IL-1a mRNA. Mol.
Cell. Endocrinol., 155: 123–133, 1999.
47. Shiozawa, T., Horiuchi, A., Kato, K., Obinata, M., Konishi, I., Fuji,
S., and Nikaido, T. Up-regulation of p27Kip1 by progestins is involved
in the growth suppression of the normal and malignant human endometrial glandular cells. Endocrinology, 142: 4182– 4188, 2001.
48. Croxtall, J., Choudhury, Q., and Flower, R. Glucocorticoids act
within minutes to inhibit recruitment of signalling factors to activated
EGF receptors through a receptor-dependent, transcription-independent
mechanism. Br. J. Pharmacol., 130: 289 –298, 2000.
49. Almawi, W., Jaouda, M., and Li, X. Transcriptional and posttranscriptional mechanisms of glucocorticoid antiproliferative effects.
Hematol. Oncol., 20: 17–32, 2002.
50. Rokaw, M., Benos, D., Palevsky, P., Cunningham, S., West, M.,
and Johnson, J. Regulation of a sodium channel-associated G-protein by
aldosterone. J. Biol. Chem., 271: 4491– 4496, 1996.
51. Groves, T., Wagner, G., and DiMattia, G. cAMP signaling can
antagonize potent glucocorticoid post-transcriptional inhibition of stanniocalcin gene expression. J. Endocrinol., 171: 499 –516, 2001.
52. Thomas, D., Rogers, S., Ng, K., and Best, J. Dexamethasone modulates insulin receptor expression and subcellular distribution of the
glucose transporter GLUT1 in UMR 106-01, a clonal osteogenic sarcoma cell line. J. Mol. Endocrinol., 17: 7–17, 1996.
53. Ahola, T., Manninen, T., Alkio, N., and Ylikomi, T. G proteincoupled receptor 30 is critical for a progestin-induced growth inhibition
in MCF-7 breast cancer cells. Endocrinology, 143: 3376 –3384, 2002.
54. Lippert, C., Seeger, H., Wallwiener, D., and Mueck, A. Effect of
medroxyprogesterone acetate and norethisterone on the estradiol-stimulated proliferation of MCF-7 cells. Med. Sci. Res., 27: 595–596, 1999.
55. Abe, M., Yamashita, J., and Ogawa, M. Medroxyprogesterone
acetate inhibits human pancreatic carcinoma cell growth by inducing
apoptosis in association with Bcl-2 phosphorylation. Cancer (Phila.),
88: 2000 –2009, 2000.
56. Altinoz, M., Bilir, A., Ozar, E., Onar, F., and Sav, A. Medroxyprogesterone acetate alone or synergistic with chemotherapy suppresses
colony formation and DNA synthesis in Cg glioma in vitro. Int. J. Dev.
Neurosci., 19: 541–547, 2001.
57. Gao, J., Mazella, J., Tang, M., and Tseng, L. Ligand-activated
progesterone receptor isoform hPR-A is a stronger transactivator than
hPR-B for the expression of IGFBP-1 (insulin-like growth factor binding protein-1) in human endometrial stromal cells. Mol. Endocrinol., 14:
1954 –1961, 2000.
58. Yamaji, T., Tsuboi, H., Murata, N., Uchida, M., Kohno, T., Sugino,
E., Hibino, S., Shimamura, M., and Oikawa, T. Anti-angiogenic activity
of a novel synthetic agent, 9-a-flurormedroxyprogesterone acetate. Cancer Lett., 145: 107–114, 1999.
59. Classen-Linke, I., Alfer, J., Krusche, C., Chwalisz, K., Rath, W.,
and Beier, H. Progestins, progesterone receptor modulators, and progesterone antagonists change VEGF release of human endometrial cells
in culture. Steroids, 65: 763–771, 2000.
60. Ory, K., Lebeau, J., Levalois, C., Bishay, K., Fouchet, P., Allemand, I., Therwath, A., and Chevillard, S. Apoptosis inhibition mediated by medroxyprogesterone acetate treatment of breast cancer cell
lines. Breast Cancer Res. Treat., 68: 187–198, 2001.
61. Moasser, M., and Rosen, N. The use of markers in farnesyltransferase inhibitor (FTI) therapy of breast cancer. Breast Cancer Res.
Treat., 73: 135–144, 2002.
62. Chao, S., and Price, D. Flavopiridol inactivates P-TEFb and blocks
most RNA polymerase II transcription in vivo. J. Biol. Chem., 276:
31793–31799, 2001.
63. Labrie, F., Li, S., Belanger, A., Cote, J., Merand, Y., and Lepage,
M. Controlled release of low-dose medroxyprogesterone acetate (MPA)
inhibits the development of mammary tumors induced by dimethylbenz(a)antracene in the rat. Breast Cancer Res. Treat., 26: 253–265,
1993.
64. Mizukami, Y., Tajiri, K., Nonomura, A., Nogichi, M., Taniya, T.,
Koyasaki, N., Nakamura, S., and Matsubara, F. Effects of tamoxifen,
medroxyprogesterone acetate and estradiol on tumor growth and oncogene expression in MCF-7 breast cancer cell line transplanted into nude
mice. Anticancer Res., 11: 1333–1338, 1991.
3772 MPA Elevation of Nm23 Expression
65. Lanari, C., Molinolo, A., and Pasqualini, C. Induction of mouse
mammary adenocarcinomas by medroxyprogesterone acetate in
BALB/c female mice. Cancer Lett., 33: 215–223, 1986.
66. Lanari, C., Luthy, I., Lamb, C., Fabris, V., Pagano, E., Helguero, L.,
Sanjuan, N., Merani, S., and Molinolo, A. Five novel hormone responsive
cell lines derived from murine mammary ductal carcinomas: in vivo and in
vitro effects of estrogens and progestins. Cancer Res., 61: 293–302, 2001.
67. Gregoraszczuk, E., Milewicz, T., Kolodziejczyk, J., Krzusiek, J., Basta,
A., Sztefko, K., Kurek, S., and Stachura, J. Progesterone-induced secretion
of growth hormone, insulin-like growth factor I and prolactin by human
breast cancer explants. Gynecol. Endocrinol., 15: 251–258, 2001.
68. Jordan, A. Toxicology of depot medroxyprogesterone acetate. Contraception, 49: 189 –201, 1994.
69. Skegg, D., Noonan, E., Paul, C., Spears, G., Meirik, O., and
Thomas, D. Depot medoxyprogesterone acetate and breast cancer. A
pooled analysis of the World Health Organization and New Zealand
studies. J. Am. Med. Assoc., 273: 799 – 804, 1995.
70. Stockler, M., Wilcken, N., Ghersi, D., and Simes, R. Systematic
reviews of chemotherapy and endocrine therapy in metastatic breast
cancer. Cancer Treat. Rev., 26: 151–168, 2000.
71. Focan, C., Beauduin, M., Salamon, E., Greve, J. D., deWasch, G.,
Lobelle, J., Majois, F., Tagnon, A., Tygat, J., vanBelle, S., Vandervellen, R., and Vindevoghel, A. Adjuvant high dose medroxyprogesterone acetate for early breast cancer: 13 years update in a multicentre
randomized trial. Br. J. Cancer, 85: 1– 8, 2001.
72. Hupperets, P., Wils, J., Volovics, L., Schouten, L., Fickers, M.,
Bron, H., Jager, J., deJong, J., and Blijham, G. Adjuvant chemohormonal therapy with cyclophosphamide, doxorubicin and 5-fluorouracil (CAF) with or without medroxyprogesterone acetate (MPA) for
node-positive cancer patients, update at 12 years follow up. Breast, 10:
35–37, 2001.