1521-0103/347/1/136–144$25.00
THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS
Copyright ª 2013 by The American Society for Pharmacology and Experimental Therapeutics
http://dx.doi.org/10.1124/jpet.113.205369
J Pharmacol Exp Ther 347:136–144, October 2013
Differential Regulation of Hepatic Organic Cation Transporter 1,
Organic Anion-Transporting Polypeptide 1a4, Bile-Salt Export
Pump, and Multidrug Resistance-Associated Protein 2
Transporter Expression in Lymphocyte-Deficient Mice
Associates with Interleukin-6 Production
Connor E. Bodeman, Anika L. Dzierlenga, Catherine M. Tally, Ryan M. Mulligan,
April D. Lake, Nathan J. Cherrington, and Susan C. McKarns
Received April 4, 2013; accepted August 5, 2013
ABSTRACT
Cholestasis results from interrupted bile flow and is associated with
immune-mediated liver diseases. It is unclear how inflammation
contributes to cholestasis. The aim of this study was to determine
whether T and B cells contribute to hepatic transporter expression
under basal and inflammatory conditions. C57BL/6J wild-type
mice or strains lacking T, B, or both T and B cells were exposed to
lipopolysaccharide (LPS) or saline, and livers were collected 16
hours later. Branched DNA signal amplification was used to assess
mRNA levels of organic anion-transporting polypeptides (Oatp)
1a1, 1a4, and 1b2; organic cation transporter (Oct) 1; canalicular
bile-salt export pump (Bsep); multidrug resistance-associated
proteins (Mrp) 2 and 3; and sodium-taurocholate cotransporting
polypeptide (Ntcp). Real-time polymerase chain reaction analysis
Introduction
The liver is a critical immunological and metabolic organ,
and is strategically positioned to receive blood that is rich in
bacterial and food-derived antigens from the gut via the portal
vein. Immune-mediated liver diseases are usually progressive
and are associated with significant morbidity and mortality.
Cholestasis can result from either a functional defect in bile
formation or interrupted bile flow, and is commonly associated
with human liver diseases (Hirschfield and Heathcote, 2009;
This work was supported in part by the National Institutes of Health
National Institute of Allergy and Infectious Diseases extramural activities
[Grant AI083927]; the National Institutes of Health Eunice Kennedy Shriver
National Institute of Child Health and Human Development [Grant
HD062489] (to N.J.C.); and the National Institutes of Health National
Institute of Environmental Health Sciences toxicology training [Grant
ES007091] (to A.D.L.).
dx.doi.org/10.1124/jpet.113.205369.
was used to correlate changes of transporter expression with
interleukin-1b (IL-1b), IL-6, IL-17A, IL-17F, tumor necrosis factor-a
(TNF-a), and interferon-g expression in the liver. LPS treatment
inhibited Bsep and Oct1 mRNA expression, and this was abrogated with a loss of T cells, but not B cells. In addition, the
absence of T cells increased Mrp2 mRNA expression, whereas
B cell deficiency attenuated Oatp1a4 mRNA in LPS-treated mice.
Oatp1a1, Oatp1b2, Ntcp, and Mrp3 were largely unaffected by
T or B cell deficiency. Lymphocyte deficiency altered basal and
inflammatory IL-6, but not TNF-a or IL-1b, mRNA expression.
Taken together, these data implicate lymphocytes as regulators of
basal and inflammatory hepatic transporter expression and suggest that IL-6 signaling may play a critical role.
Hirschfield et al., 2010). Genetic and environmental factors,
including infections and xenobiotics, can contribute to cholestasis. A major consequence of acute cholestasis is the development of severe liver injury. Hepatocyte and cholangiocyte
proliferation that occurs in response to injury in turn leads to
periductular fibrosis, biliary fibrosis, and cirrhosis (Hirschfield
et al., 2010). The mechanisms by which inflammation contributes to the pathophysiology of cholestasis-mediated liver injury
remain unclear.
Bile acids are synthesized in the liver from cholesterol,
secreted into the bile, and actively transported to the gut and
then back to the liver via enterohepatic circulation. Enterohepatic bile flow is essential for the emulsification of dietary
fat, fat-soluble vitamin absorption, and elimination of toxic
compounds, and is regulated through a coordinated hepatobiliary sinusoidal (basolateral) and canalicular (apical) transport system (Merritt and Donaldson, 2009). Organic cation
ABBREVIATIONS: Bsep, bile-salt export pump; BW, body weight; Ct, threshold cycle; DCt, target Ct values; IFN-g, interferon g; IL, interleukin; KO,
knockout; LPS, lipopolysaccharide; Mrp, multidrug resistance-associated protein; mMT, IgM transmembrane tail exon; NK, natural killer; NKT,
natural killer T; Ntcp, Na1-taurocholate cotransporting polypeptide; Oatp, organic anion-transporting polypeptide; Oct, organic cation transporter;
PCR, polymerase chain reaction; Rag, recombination-activating gene; STAT, signal transducer and activator of transcription; TCR, T-cell receptor;
TLR, Toll-like receptor; tm1, targeted mutation 1; TNF-a, tumor necrosis factor-a; Treg, T regulatory; WT, wild-type.
136
Downloaded from jpet.aspetjournals.org at ASPET Journals on October 2, 2016
Center for Cellular and Molecular Immunology, Department of Surgery (C.E.B., C.M.T., R.M.M., S.C.M.) and Department of
Microbiology and Immunology (S.C.M.), University of Missouri School of Medicine, Columbia, Missouri; and Department of
Pharmacology and Toxicology, University of Arizona, Tucson, Arizona (A.L.D., A.D.L., N.J.C.)
Lymphocytes on Hepatic Cytokines and Transporters
Materials and Methods
Animal Models. Male adult C57BL/6J wild-type (WT) and homozygous T cell–deficient B6.129S2-T-cell receptor a chain; targeted
mutation 1 (tm1), Peter Mombaerts (Tcratm1Mom) (TCR-a KO),
B cell–deficient B6.129S2-IgM; tm1, University of Cologne (Ighmtm1Cgn)
[IgM transmembrane tail exon (mMT) deficient], and T and B cell–deficient
B6.129S7-recombination activating gene 1; tm1, Peter Mombaerts
(Rag1tm1Mom) (Rag1 KO) mice (8–10 weeks of age) were purchased
from The Jackson Laboratory (Bar Harbor, ME). B10.A 5C.C7 TCR
transgenic Rag2 KO mice (Seder et al., 1992) were obtained from the
National Institute of Allergy and Infectious Diseases contract facility
(Taconic Farms, Germantown, NY). All mice were acclimated to
the housing conditions for at least 14 days prior to use. Groups for
LPS-induced cholestasis studies were designated WT (n 5 6), TCR-a
KO (n 5 6), mMT (n 5 6), and Rag1 KO (n 5 6). Groups for sexpreference expression studies were designated C57BL/6J (n 5 3) and
B10.A TCR Rag2 KO (n 5 3). All mice were maintained in 12-hour
light/dark cycles and allowed water and standard chow ad libitum. All
animals were used according to the guidelines of the University of
Missouri Animal Care and Use Committee and in accordance with the
US National Institutes of Health and the American Association for
Laboratory Animal Care International.
LPS Model of Cholestasis. Four groups (WT, TCR-a KO, mMT,
and Rag1 KO) of adult (8–10 weeks old) age-matched male mice (22–
31 g) underwent treatment. LPS (4 mg/kg in a volume of 5 ml/g) or
sterile saline vehicle was administered to mice by i.p. injection. Livers
were excised 16 hours after LPS administration, snap frozen in liquid
nitrogen, and stored at 280°C until RNA isolation. Mice were
maintained under specific pathogen-free conditions in University of
Missouri animal facilities that are accredited by the Association for
Assessment and Accreditation of Laboratory Animal Care International. All protocols were approved by the University of Missouri
Animal Care and Use Committee. Mice were monitored for signs of
distress during the study (abdominal distention, respiratory difficulty).
Chemicals. LPS (from Escherichia coli serotype 055:B5) and all
other chemicals, unless otherwise indicated, were purchased from
Sigma-Aldrich (St. Louis, MO). One milligram of LPS was added to
0.5 ml of sterile saline to create stock solutions and frozen (220°C)
prior to use.
RNA Preparations. Total RNA was isolated from mouse liver
using RNAzol B reagent (Tel-Test, Inc., Friendswood, TX) per the
manufacturer’s recommendations. RNA concentrations were determined by UV spectrophotometry, and the integrity of the RNA
was confirmed by ethidium bromide staining after agarose gel
electrophoresis.
Branched DNA Assay. Specific oligonucleotide probes for
Oatp1a1, Oatp1a4, Oatp1b2, Oct1, Ntcp, Bsep, Mrp2, and Mrp3 genes
(Augustine et al., 2005) were diluted in lysis buffer supplied by the
QuantiGene HV Signal Amplification Kit (Panomics, Fremont, CA).
The substrate solution, lysis buffer, capture hybridization buffer,
amplifier, and label probe buffer used in the analysis were all obtained
from the QuantiGene Discovery Kit (Panomics). The assay was
performed in 96-well format with 10 mg of total RNA added to the
capture hybridization buffer and 50 ml of the diluted probe set. The
total RNA was then allowed to hybridize to the probe set overnight at
53°C. Hybridization steps were performed per the manufacturer’s
protocol on the following day. Luminescence of the samples was
measured with a Quantiplex 320 branched DNA luminometer interfaced with Quantiplex Data Management Software, version 5.02
(Bayer, Walpole, MA).
Real-Time Reverse-Transcription Polymerase Chain Reaction. Real-time quantification of IL-1b, interferon-g (IFN-g),
TNF-a, IL-6, IL-17A, and IL-17F relative to b-actin mRNA was
performed using SYBR Green polymerase chain reaction (PCR)
master mix (Applied Biosystems, Foster City, CA) and an ABI PRISM
7900HT sequence detector (Applied Biosytems). Total RNA (5 mg) was
reverse transcribed to cDNA using SuperScript III and random hexamer
primers (Invitrogen, Carlsbad, CA) in a 20-ml reaction. PCR was performed
using the following primers: IL-1b primers 59-GAAAGCTCTCCACCTCAATG and 59-GCCGTCTTTCATTACACAGG, IFN-g primers 59CTGCCACGGCACAGTCATTG and 59-TGCATCCTTTTTCGCCTTGC,
Downloaded from jpet.aspetjournals.org at ASPET Journals on October 2, 2016
transporter 1 (Oct1) is the major hepatic uptake transporter
for small cations, and increased expression of multidrug
resistance-associated protein 3 (Mrp3) provides an alternative route for efflux during periods of bile acid and/or
xenobiotic overload. At the hepatic canalicular membrane,
the ATP-dependent bile-salt export pump (Bsep) and Mrp2
function as the primary hepatic bile acid exporters, reviewed
in Klaassen and Aleksunes (2010). In concert, the sodiumtaurocholate cotransporting polypeptide (Ntcp) is the predominant mechanism of bile acid uptake at the sinusoidal
membrane. The organic anion transporting polypeptides
(Oatp) 1a1, 1a4, and 1b2 transport conjugated bile acids,
organic acids, and xenobiotics. Disruption of transporter
function results in cholestasis (Ricciardi et al., 2001).
Lipopolysaccharide (LPS) is a common cause of inflammationinduced cholestasis in humans, and is widely used in experimental animal models to initiate cholestasis, presumably by
increasing synthesis of cytokines such as tumor necrosis factor-a
(TNF-a), interleukin-6 (IL-6), and IL-1b in response to Toll-like
receptor 4 (TLR4)–dependent nuclear factor of the kB enhancer
activation in Kupffer cells. This model predicts that proinflammatory cytokines, in turn, signal through their respective membrane receptors to suppress transporter expression and function
(Geier et al., 2006; Lickteig et al., 2007; Mulder et al., 2009).
Although the underlying mechanisms remain unclear, LPSinduced alteration of transporter function appears to be immunemediated and the direct cause of cholestasis. Thus, LPSinduced cholestasis provides a valuable experimental tool to
study mechanisms of hepatic transporter regulation directly,
rather than secondarily in response to the accumulation of bile
constituents resulting from biliary obstruction.
The liver receives approximately 70% of its blood supply from
the intestine through the portal circulation, and is thus exposed
to potential gut-derived immune modulators including bile
acids and bacteria. Accordingly, the liver is selectively enriched
in a large number of innate and adaptive immune cells for
protection against harmful pathogens and autoreactive selfantigens from foodstuffs and commensal bacteria. Lymphocyte
subpopulations in normal human livers comprise approximately
35% T cells, 30% natural killer (NK) T cells (NKT), 20% NK
cells, and 10% B cells (Dong et al., 2007). TLRs are widely
expressed by immune cells, including conventional CD41 T
helper cells, cytotoxic T lymphocytes, B cells, natural forkhead
box P31 regulatory T cells, and NKT cells. This enables responsiveness to microbes through pathogen-associated molecular patterns or cell injury via danger-associated molecular
patterns for cytokine production during LPS-induced cholestasis. Substantial evidence has recently implicated that TLR4
signaling contributes to the activation of T cells, B cells, and
NKT cells (Pone et al., 2010; Kim et al., 2012; Reynolds et al.,
2012). Importantly, whereas some cytokines, e.g., TNF-a and
IL-1b, are thought to be proinflammatory and detrimental,
others, including IL-6, are also anti-inflammatory and suppress
liver injury (Sun et al., 2004). The objective of this study was to
test the hypothesis that lymphocytes contribute to the expression of hepatic transporter expression under basal and acute
inflammatory conditions.
137
138
Mulligan et al.
Results
A genetic loss of function approach was used to determine
the regulatory role of lymphocytes in hepatic transporter
steady-state mRNA expression prior to and after LPS
treatment. Uptake and efflux transporters investigated in
this study were chosen on the basis that they encompass
sinusoidal and canalicular membrane localization and respond to inflammation. Given that transporter and cytokine
expression are sex-dependent and adult female responses
are likely influenced by the estrous cycle (Klaassen and
Aleksunes, 2010; Kwekel et al., 2010), male mice were used.
Hepatic transporter expression has also been shown to be
age-dependent (Fu et al., 2012); therefore, despite C57BL/6J
Rag1 KO mice being smaller in size relative to WT, TCR-a
KO, and mMT mice (P , 0.01), age-matched mice were studied
(Fig. 1). Unfasted body weights were recorded during the acclimatization period (days 214, 210, and 25), on the day of treatment (day 1), and at necropsy (16 hours post-treatment). The
administration of LPS resulted in a loss of body weight in WT,
TCR-a KO, and mMT mice, but not Rag1 KO mice, amounting
to 12.97% 6 1.86% (P , 0.05), 16.22% 6 0.99% (P , 0.01),
13.36% 6 1.05% (P , 0.01), and 8.44% 6 1.18% (P . 0.05) of
saline controls, respectively (Fig. 1). Overall, these results
suggest that mice lacking T and B cells likely respond
differently to acute LPS exposure.
Consistent with previous studies (Klaassen and Aleksunes,
2010), basal steady-state mRNA expression of sinusoidal Oatp1a1,
Oatp1a4, Oatp1b2, Ntcp, Oct1, and Mrp3 and canalicular
Mrp2 and Bsep transporters was readily detected (Table 1).
Oatp1a4 expression was reduced in TCR-a KO mice relative
to WT mice (P , 0.05). Although not significant, basal Oct1
expression was reduced in Rag1 KO mice. In comparison, basal
Mrp3, Mrp2, and Bsep expression was lower in TCR-a KO,
mMT, and Rag1 KO mice compared with WT mice. Meanwhile,
basal Oatp1a1, Oatb1b2, and Ntcp expression was unaffected
by lymphocyte deficiency. Of the transporter genes studied,
Oatp1a4 mRNA was uniquely downregulated in the absence of
Fig. 1. The influence of LPS treatment on body weight. The body weights
of 16-week-old male WT, TCRa KO, mMT, and Rag1 KO mice (n = 3 mice
per experimental group) were obtained 1 day prior to and 16 hours
following LPS administration (4 mg/kg in a volume of 5 ml/g i.p.) or an
equal volume of sterile saline (vehicle control). The body weight (grams)
for individual mice before and after saline (top) or LPS (bottom) treatment
is shown. Open and closed circles represent prior to and after treatment.
**P , 0.01; *P , 0.05.
T cells, but not B cells or the combined deficiency of T and
B cells (Table 1), suggesting that B cells, in a T cell–independent
manner, may augment Oatp1a4 expression. In summary, these
data demonstrate that T and B cells contribute to the maintenance of steady-state mRNA expression levels of selective
transporters in the liver of adult male C57BL/6J mice in the
absence of inflammation, infection, or autoimmunity.
We next investigated the effect of T cell and B cell deficiency
on transporter mRNA expression during inflammation.
Figure 2 demonstrates augmented Mrp2 mRNA and a loss of
LPS-induced suppression of Bsep mRNA in TCR-a KO mice
following acute LPS exposure. We further investigated the potential for lymphocytes to impact hepatic sinusoidal transporter
expression following LPS treatment. Figure 3 shows that LPS
treatment did not alter Oatp1b2, Ntcp, or Mrp3 mRNA in any of
the genotypes. In contrast, Oatp1a1 mRNA was reduced in
response to LPS treatment in all four genotypes. Meanwhile,
LPS-induced inhibition of Oct1 and Oatp1a4 was observed only
in WT and B cell–deficient mice, respectively (Fig. 3). Overall,
these data demonstrate that lymphocytes contribute to differential regulation of hepatic transporter expression in a transporter- and inflammation-dependent manner.
TNF-a, IL-1b, and IL-6 likely contribute to the regulation of
hepatic drug transporters during injury. Given that these
cytokines are produced by multiple cell types, including
lymphocytes, we next asked whether T and B cells influence
the expression of these soluble mediators in the liver. For these
Downloaded from jpet.aspetjournals.org at ASPET Journals on October 2, 2016
TNF-a primers 59-GACCCTCACACTCAGATCATCTTCT and 59CCACTTGGTGGTTTGCTACGA, IL-6 primers 59-TGTCTATACCACTTCACAAGTCGGAG and 59-GCACAACTCTTTTCTCATTTCCAC,
IL-17A primers 59-GCTCCAGAAGGCCCTCAGACT and 59-CCAGCTTTCCCTCCGCATTGA, IL-17F primers 59-CTGGAGGATAACACTGTGAGAGT and 59-TGCTGAATGGCGACGGAGTTC, and b-actin
primers 59-ATGGTGGGAATGGGTCAGAA and 59-CCATGTCGTCCCAGTTGGTAA. PCR reactions incorporated 5 pmol forward and reverse
primer and used the following cycling conditions: 95°C for 10 minutes,
95°C for 15 seconds, and 60°C for 60 seconds followed by dissociation
curve analysis. For the negative controls, the reverse-transcriptase
step was omitted and PCR was performed directly from the RNA. The
normalized threshold cycle (Ct) values were subtracted from the target
Ct values of each sample (DCt). Relative levels of target mRNA were
calculated as 22DDCt.
Statistical Analysis. Statistical analysis was performed using
InStat 3 software (GraphPad Software, La Jolla, CA). Data are shown
as the mean 6 S.E. The Mann-Whitney, Wilcoxon matched-pairs test,
or unpaired two-tailed t test was applied to compare two groups; the
one-way analysis of variance with Bonferroni’s multiple comparisons
test was used to compare three or more means. Best fit of correlation
was measured by the root mean square. All P values ,0.05 were
considered statistically significant. In the figures and tables, P values
are displayed according to the following scheme: **P , 0.01; *P ,
0.05.
OATP1B1
OATP2B2 (OATP1B3)
NTCP
OCT1
MRP3
MRP2, cMoat
BSEP, SPGP, PFIC-2
Oatp1a4 (Oatp2)
Oatp1b2 (Oatp4)
Ntcp (lx1)
Oct1
Mrp3
Mrp2
Bsep
Abcb11
Abcc2
Slc22a1
Abcc3
Slco1a4
Sclo1b2
Slc10a1
Slco1a1
Gene
NM_021022
NM_013806
NM_009202
NM_029600
NM_030687
NM_020495
NM_011387
NM_013797
Accession #
FXR, RXR
PXR, CAR, FXR
FXR, RXR, SHP,
HNF4a, GR
FXR, SHP, HNF4a
FXR
FXR, RXR, SHP, HNFa,
GR, RARa
PXR, PPARa, HNF1a
CAR, PXR, VDR
Nuclear Receptora
TCR-a KO
74.09 6 13.39
0.90 6 0.41*
88.53 6 19.38
57.95 6 2.83
124.42 6 20.75
11.24 6 4.80
20.40 6 1.91
21.81 6 4.35
WT
69.56 6 7.78
5.81 6 0.88
82.27 6 17.96
64.04 6 11.80
192.93 6 29.88
15.21 6 3.58
29.87 6 8.59
50.48 6 8.52
BA (↑)
SHP (↓)
BA (↑)
Retinoids (↑)
SHP (↓)
OC (↑)
BS, Bili, PB,
phytoestrogens (↑)
BA, Bili, GSH,
Xenobiotics (↑)
BA (↑)
Ligandb
mMT
31.27 6 0.38
13.13 6 3.27
151.48 6 30.08
11.89 6 3.13
6.03 6 0.61
63.80 6 3.33
76.06 6 8.80
63.43 6 8.85
Rag1 KO
38.67 6 15.93
14.55 6 3.65
104.84 6 3.80
5.56 6 1.00
5.03 6 0.92
85.07 6 7.10
80.73 6 18.80
64.26 6 4.16
Abcb, ATP-binding cassette, subfamily B; Abcc, ATP-binding cassette, subfamily C; BA, bile acid; Bili, bilirubin; BS, bile salts; CAR, constitutive androstane receptor; cMoat, canalicular multiorganic anion transporter; FXR,
farnesoid X receptor; GSH, glutathione; GR, glucocorticoid receptor; HNFa, hepatocyte nuclear factor a; OC, organic cation; PB, phenobarbital; PFIC-2, progressive familial intrahepatic cholestasis; PPARa, peroxisome proliferatoractivated receptor a; PXR, pregnane X receptor; RARa, retinoid acid receptor a; RXR, retinoid X receptor; SHP, short heterodimer partner; Slc, solute-carrier; SPGP, sister of P-glycoprotein; VDR, vitamin D receptor; ↑, increases
transporter expression; ↓, decreases transporter expression.
a
Reviewed in Beuers et al., 2001; Trauner and Boyer, 2003; Chandra and Brouwer, 2004; Tirona and Kim, 2005; Hofmann, 2007, 2009; Shu et al., 2008; Halilbasic et al., 2013.
b
Reviewed in Beuers et al., 2001; Chandra and Brouwer, 2004; Shu et al., 2008; Halilbasic et al., 2013.
*P , 0.05 relative to WT.
OATP1A2
Human
Oatp1a1 (Oatp1)
Transporter
Results represent the mean relative light units/10 mg total RNA 6 S.E. (n = 3).
TABLE 1
Basal transporter gene expression in liver isolated from male WT mice and mice lacking T cells (TCRa KO), B cells (mMT), or both T and B cells (Rag1 KO)
Lymphocytes on Hepatic Cytokines and Transporters
139
studies, reverse-transcription PCR analyses were performed
on liver homogenates from LPS- or saline-treated WT, TCR-a
KO, mMT, and Rag1 KO mice. We demonstrated decreased
basal IL-6 mRNA in TCR-a KO and mMT mice and exacerbated
LPS-induced IL-6 expression in Rag1 KO mice (Fig. 4). In
contrast, alterations in IL-1b and TNF-a mRNA were modest
as shown by tempered upregulation during inflammation.
Noteworthy, selective B cell loss lessened hepatic TNF-a, IL1b, and IL-6 mRNA levels in LPS-treated mice (Fig. 4). IL-6
mRNA levels were increased in mMT and Rag1 KO mice
following LPS treatment. Meanwhile, IL-17A and IL-17F
mRNA were only slightly detectable (Ct 5 38–42), and these
levels did not differ with loss of T and/or B cells (data not
shown). Hepatic IFN-g expression was below the level of
detection in all samples tested (data not shown). Overall, these
results suggest that T and B cells contribute to basal and acute
inflammatory IL-6 production in the liver.
NKT cells represent a population of unconventional T lymphocytes that can mediate both innate and adaptive immune
responses and are abundant in the liver (Eberl et al., 1999;
Duwaerts and Gregory, 2011; Parker and Picut, 2012). In mice,
NKT cells represent approximately 0.5% of the total T cell
population in the blood, peripheral lymph nodes, and spleens.
In striking contrast, almost 30% of total hepatic T cells have
the NKT phenotype (Eberl et al., 1999) and the majority of
these cells, such as conventional T cells and NK cells, are localized in the sinusoids (Geissmann et al., 2005). Therefore, we
Downloaded from jpet.aspetjournals.org at ASPET Journals on October 2, 2016
Fig. 2. Steady-state mRNA levels of hepatic canalicular efflux transporters in response to LPS. Male WT, TCR-a KO, mMT, or Rag1 KO mice
(22–31 g) were administered LPS (4 mg/kg in a volume of 5 ml/g) or sterile
saline vehicle by injection (i.p.). Livers were excised 16 hours after LPS
administration, collected, snap frozen in liquid nitrogen, and stored at
280°C until RNA isolation (n = 3 mice per experimental group). Livers
were evaluated for steady-state mRNA levels of Bsep and Mrp2 as
determined by the branched DNA assays. Data are expressed as mean
relative light units (RLU)/10 mg total RNA 6 S.E. **P , 0.01; *P , 0.05.
140
Mulligan et al.
further investigated the contribution of NKT cells to the
regulation of sex-biased expression of hepatic bile acid transporters (Buist and Klaassen, 2004; Maher et al., 2005; Cheng
et al., 2007; Klaassen and Aleksunes, 2010). For these
experiments, male and female WT C57BL/6J and B10.A TCR
transgenic Rag2 KO mice were used to determine the influence
of combined genetic deficiency of CD81, B, NKT, and natural
CD41 T regulatory (Treg) cells on hepatic transporter expression. We first compared WT C57BL/6J and CD81, B, NKT,
and natural Treg cell–deficient (henceforth referred to as NKTdeficient) males and females (Table 2). Although hepatic transporter mRNA expression was unaltered in NKT-deficient
males, increased Mrp3 mRNA (P , 0.01) and modestly decreased Oatp1a4 mRNA was observed in NKT-deficient female
mice relative to WT controls (Table 2).
We next determined whether NKT deficiency influenced
the sex predominance of transporter mRNA expression. First,
Oatp1a1 and Oatp1b2 mRNA was male-predominant in WT
mice (P , 0.01), and this sex bias was exacerbated in NKTdeficient mice. Second, Oatp1a4 (P , 0.05), Mrp3 (P . 0.05),
Ntcp (P , 0.05), Oct1 (P . 0.05), and Bsep (P . 0.05) expression
was greater in WT females than males, and the magnitude of
the female predominance was either unchanged or exacerbated
with NKT deficiency. Mrp2 mRNA expression in WT mice was
comparable between males and females. Mrp3 mRNA expression was female-predominant in WT as well as NKT-deficient
mice (Table 2). In summary, the previous analyses provide
evidence that lymphocytes may further function in a sex-bias
manner to modulate hepatic transporters.
Discussion
The possibility that lymphocytes may control hepatic
transporter expression has not been addressed until now.
Using a genetic loss-of-function approach, we provide evidence
suggesting that T and B cells contribute to the regulation of
hepatic Mrp2, Bsep, Oct1, and Oatp1a4 transporter expression.
We further associate elevated IL-6 production during conditions of T cell deficiency with abrogated suppression of Bsep
and Oct1 expression during acute inflammation. In addition,
we provide evidence that lymphocyte-mediated regulation
of hepatic transporter expression is sex-biased. Given that
transporters can be significantly affected by drug-drug interactions or genetic polymorphisms, and the immune system has been linked to sex-biased human liver disorders, the
contribution of lymphocytes to changes in drug transporter
activity warrants further attention. These findings contribute
novel insights to the cellular basis of cytokine production in the
liver and to the mechanisms of inflammation-induced liver
diseases.
Previous studies demonstrating that altered hepatic transporter expression in response to LPS have implicated that
Kupffer cells directly respond to LPS through TLR4-dependent
signaling to upregulate TNF-a, IL-6, and IL-1b transcription
(Green et al., 1996; Kubitz et al., 1999; Kim et al., 2000;
Cherrington et al., 2004; Li et al., 2004; Augustine et al., 2005;
Li and Klaassen, 2005). In theory, these presumed proinflammatory cytokines, in turn, signal through their respective
receptors to repress transcription of genes encoding hepatic
transporters, causing bile acid accumulation and cholestatic
liver disease. We now demonstrate that T and B cells play
substantial, yet differential, roles in IL-6, but not IL-1b, and
TNF-a production during basal and acute inflammatory
conditions. IL-6 has been implicated in both proinflammatory
and anti-inflammatory responses (Scheller et al., 2011), and
most studies have investigated proinflammatory contributions by IL-6. However, our data illustrating down- and
upregulated IL-6 in WT and T cell–deficient mice, respectively, are consistent with recent reports suggesting that
B cell–induced production of IL-6 prevents downregulation of
hepatic transporters to reduce liver injury associated with
acute inflammation (Taub, 2003; Klein et al., 2005). The
Downloaded from jpet.aspetjournals.org at ASPET Journals on October 2, 2016
Fig. 3. Steady-state mRNA levels of hepatic sinusoidal transporters in response to LPS. Male WT, TCR-a KO, mMT, or Rag1 KO mice (22–31 g) were
administered LPS (4 mg/kg in a volume of 5 ml/g) or sterile saline vehicle by injection (i.p.). Livers were excised 16 hours after LPS administration,
collected, snap frozen in liquid nitrogen, and stored at 280°C until RNA isolation (n = 3 mice per experimental group). Livers were evaluated for steadystate mRNA levels of the hepatic bile acid transporters Oatp1a1, Oatp1a4, Oatp1b2, Ntcp, Oct1, and Mrp3 as determined by branched DNA analyses.
Data are expressed as mean relative light units (RLU)/10 mg total RNA 6 S.E. **P , 0.01; *P , 0.05.
Lymphocytes on Hepatic Cytokines and Transporters
molecular mechanisms by which IL-6 provides protection in
the liver are not well understood, and this is further confounded by a poor understanding of how T cells propagate
hepatic inflammation. Nonetheless, it is well established that
IL-6 binds the membrane-bound IL-6 receptor a (gp80) and
heterodimerizes with gp130 to form a signaling complex and
activates downsteam signal transducer and activator of transcription (STAT)1, STAT3, and short heterodimer partner
2–Ras–mitogen-activated protein kinase signaling pathways
(Ishihara and Hirano, 2002). A lack of gp130 expression in
hepatocytes has previously been shown to promote liver
injury (Streetz et al., 2003). Thus, it is unclear whether
B cell–induced IL-6 production directly targets T cells or
hepatocytes to modulate transporter expression. Given that
IL-6–gp130–STAT3 in T cells promotes IL-17–producing CD4
T cells (Camporeale and Poli, 2012), we were surprised by the
low levels of IL-17 expression in LPS-treated Rag1 KO mice.
However, these results suggest that hepatocytes may be the
critical recipient of the IL-6 signaling during acute TLR4mediated inflammation.
Although not well appreciated, recent evidence has established that T, B, and NKT cells also express TLR4 (Gururajan
et al., 2007; Meyer-Bahlburg et al., 2009; Kim et al., 2012).
Thus, lymphocytes also retain the capacity to rapidly respond to
endotoxin and other microbes, including commensal bacteria
(Tough et al., 1997; Godfrey and Rossjohn, 2011; Reynolds et al.,
2012). Little is known about TLR4 signaling in lymphocytes,
and it remains to be determined whether TLR4 signaling
pathways differ between lymphocytes and macrophages, particularly with regard to the requirement for CD14, myeloid
differentiation primary response 88, and Toll/IL-1R domaincontaining adapter-inducing IFN-b. Given the abundance of T,
B, and NKT cells in the liver and their capacity to propagate
proinflammatory, but also anti-inflammatory, cytokine production, we used a genetic loss-of-function approach to test the
hypothesis that lymphocytes contribute to the regulation of
genes encoding uptake and efflux transporters in mouse liver.
Our results are in agreement with previous studies demonstrating downregulation of sinusoidal and canalicular transporters in response to LPS, as previously reviewed (Klaassen
and Aleksunes, 2010).
Regarding the role of lymphocytes in regulating transporter
expression, our findings do, in fact, support our hypothesis
that lymphocytes contribute to the transcriptional control of
hepatic bile acid transporters. Given that most lymphocytes,
including T, B, NK, and NKT cells, are thought to provide
critical defense against invading pathogens and modulate liver
injury by circulating through hepatic sinusoids (Geissmann
et al., 2005), it was somewhat unexpected that the efflux
transporters positioned on the apical membrane were most
affected by lymphocyte deficiency. Nonetheless, it is well accepted that migration through hepatic sinusoids enables
lymphocytes to come in close contact to antigens displayed by
endothelial cells, Kupffer cells, and microbial pathogens undergoing enterohepatic circulation. Since altered Mrp3 and
Bsep mRNA expression in response to lymphocyte deficiency
was evident only during inflammation, we speculate that
lymphocytes likely gain access, via direct contact or through the
secretion of soluble mediators, to hepatocytes at times when
the vasculature in the liver is inflamed, as the sinusoidal endothelium is highly fenestrated and lacks a basement membrane. In agreement, the sinusoidal membrane has previously
been identified as a unique means by which the liver is able
to differentially regulate immune-mediated responses (Crispe,
2012; Parker and Picut, 2012). This line of reasoning is also
consistent with our observation that lymphocytes retain the
capacity to modulate efflux transporters that are located on the
apical membrane, i.e., Mrp3, in the absence of LPS-induced
inflammation.
Without doubt, hepatic transporter expression is critical for
effective elimination of conjugated bilirubin and bile acids, as
well as xenobiotics and their metabolites, to maintain metabolic homeostasis and simultaneous removal of toxic waste.
However, it is also appreciated that transient repression of
hepatic efflux transporter function during acute inflammation,
Downloaded from jpet.aspetjournals.org at ASPET Journals on October 2, 2016
Fig. 4. The influence of T and B cell deficiency on basal and LPS-induced
hepatic cytokine gene expression. Male WT, TCR-a KO, mMT, and Rag1
KO mice were administered LPS (4 mg/kg in a volume of 5 ml/g) or sterile
saline vehicle by injection (i.p.). Livers were excised 16 hours after LPS
administration, collected, snap frozen in liquid nitrogen, and stored at
280°C until RNA isolation. Gene expression was quantified by reversetranscription PCR using SYBR green PCR master mix and the ABI Prism
7900HT sequence detection system. Fold change was calculated as 22DDCt
using b-actin as the endogenous control. The results shown are
normalized to WT vehicle (saline) controls. Quantification was calculated
as vehicle versus LPS-treated cells. Data are the mean 6 S.E. of three
mice. **P , 0.01; *P , 0.05.
141
142
Mulligan et al.
TABLE 2
Sex-dependent differences in constitutive hepatic transporter gene expression in WT mice and mice
genetically deficient in NKT, CD8+, B, and natural forkhead box P3+ regulatory T cells
Results represent the mean relative light units/10 mg total RNA 6 S.E. (n = 3).
Males
Transporter
Oatp1a1
Oatp1a4
Oatp1b2
Ntcp
Oct1
Mrp3
Mrp2
Bsep
WT
89.07
6.80
91.75
64.49
128.78
6.31
28.95
74.97
6
6
6
6
6
6
6
6
Females
TCR-a Tg Rag2 KO
26.73
1.30
8.18
12.90
26.81
0.53
3.17
12.99
100.32
5.09
93.07
97.89
154.74
7.22
25.71
60.70
6
6
6
6
6
6
6
6
17.10
1.11
3.75
10.96
14.71
1.98
4.91
1.32
WT
37.87
44.53
61.29
146.58
182.76
9.30
24.38
128.67
6
6
6
6
6
6
6
6
TCR-a Tg Rag2 KO
22.75
5.91
14.74
21.35
56.49
0.97
13.87
56.47
4.41
27.09
50.60
163.08
254.43
17.46
41.69
102.47
6
6
6
6
6
6
6
6
1.93
3.15
20.58
4.55
49.54
3.07**
5.16
9.06
**P , 0.01, comparing sex-specific WT and TCR-a Tg Rag2 KO mice.
unique environment that favors immunological tolerance. Of
particular importance, CD41 forkhead box P31 Tregs are
mediators of immune tolerance, express Toll-like receptors
including TLR4, exert enhanced suppressor function in response to LPS treatment, and have previously been shown to
contribute to extrahepatic cholestasis (Caramalho et al., 2003;
Katz et al., 2011). Additional studies to identify which lymphocytes are involved and gain a better understanding of their
mechanism(s) of action during acute and chronic exposure are
required to appropriately address this question. Here, we have
clearly determined that hepatic transporters are sensitive to
Fig. 5. Schematic depicting differential regulation of hepatic transporter expression by T and B cells. Bsep and Mrp2 transporters are expressed on
hepatocyte canalicular membranes and export monovalent tauro- and glyco-conjugated (conj.) hepatic bile acids (BAs) and divalent sulfated (sulpho-) or
glucuronidated (glucurono-) BAs amidated with a taurine or a glycine, organic anions (OAs), reduced glutathione (GSH), and bilirubin (bili) out of the
hepatocyte into the bile canaliculi. Mrp3, similar to Mrp2, is an ATP-binding cassette transporter, but unlike Mrp2, is localized on hepatocyte basolateral
surfaces and functions to efflux bile and organic acids during periods of bile acid overload, e.g., gallstones or dysfunctional Mrp2 and/or Bsep. Ntcp,
Oatp1a1, Oatp1a4, and Oatp1b2 are positioned at the basolateral membrane and facilitate enterohepatic cycling of BAs and OAs. Oct1 is also expressed
at the basolateral membrane and functions in a similar manner, except it transports conj. BAs and organic cations (OCs) from the portal vein.
Downloaded from jpet.aspetjournals.org at ASPET Journals on October 2, 2016
such as sepsis or gallstones, offers protection to the liver by
enhancing the retention of antioxidants such as glutathione
(Roeb et al., 2003; Kong et al., 2012). Thus, it is the sustained
disruption of these efflux pumps, in combination with uptake
transporters, which exacerbates pathology in liver diseases. It
is appreciated that administration of LPS in experimental
mouse models reproduces the common clinical features of
sepsis, including downregulation of transporter mRNA. Therefore, is altered hepatic transporter expression in response
to lymphocyte deficiency pathogenic or protective? This is a
particularly important question given the liver provides a
Lymphocytes on Hepatic Cytokines and Transporters
Acknowledgments
The authors sincerely thank Ambima Buzhyason for technical
assistance.
Authorship Contributions
Participated in research design: Cherrington, McKarns.
Conducted experiments: Tally, Bodeman, Dzierlenga, Lake,
McKarns.
Performed data analysis: Tally, Bodeman, Dzierlenga, Cherrington, McKarns.
Wrote or contributed to the writing of the manuscript: Mulligan,
Tally, Dzierlenga, Cherrington, McKarns.
References
Augustine LM, Markelewicz RJ, Jr, Boekelheide K, and Cherrington NJ (2005) Xenobiotic and endobiotic transporter mRNA expression in the blood-testis barrier.
Drug Metab Dispos 33:182–189.
Beuers U, Bilzer M, Chittattu A, Kullak-Ublick GA, Keppler D, Paumgartner G,
and Dombrowski F (2001) Tauroursodeoxycholic acid inserts the apical conjugate
export pump, Mrp2, into canalicular membranes and stimulates organic anion
secretion by protein kinase C-dependent mechanisms in cholestatic rat liver.
Hepatology 33:1206–1216.
Buist SC and Klaassen CD (2004) Rat and mouse differences in gender-predominant
expression of organic anion transporter (Oat1-3; Slc22a6-8) mRNA levels. Drug
Metab Dispos 32:620–625.
Camporeale A and Poli V (2012) IL-6, IL-17 and STAT3: a holy trinity in autoimmunity? Front Biosci (Landmark Ed) 17:2306–2326.
Caramalho I, Lopes-Carvalho T, Ostler D, Zelenay S, Haury M, and Demengeot J
(2003) Regulatory T cells selectively express toll-like receptors and are activated by
lipopolysaccharide. J Exp Med 197:403–411.
Chandra P and Brouwer KL (2004) The complexities of hepatic drug transport:
current knowledge and emerging concepts. Pharmaceutical Res 21:719–735.
Cheng X, Buckley D, and Klaassen CD (2007) Regulation of hepatic bile acid transporters Ntcp and Bsep expression. Biochem Pharmacol 74:1665–1676.
Cherrington NJ, Slitt AL, Li N, and Klaassen CD (2004) Lipopolysaccharidemediated regulation of hepatic transporter mRNA levels in rats. Drug Metab
Dispos 32:734–741.
Clodfelter KH, Holloway MG, Hodor P, Park SH, Ray WJ, and Waxman DJ (2006)
Sex-dependent liver gene expression is extensive and largely dependent upon
signal transducer and activator of transcription 5b (STAT5b): STAT5b-dependent
activation of male genes and repression of female genes revealed by microarray
analysis. Mol Endocrinol 20:1333–1351.
Clodfelter KH, Miles GD, Wauthier V, Holloway MG, Zhang X, Hodor P, Ray WJ,
and Waxman DJ (2007) Role of STAT5a in regulation of sex-specific gene expression in female but not male mouse liver revealed by microarray analysis. Physiol
Genomics 31:63–74.
Crispe IN (2012) Migration of lymphocytes into hepatic sinusoids. J Hepatol 57:
218–220.
Dong Z, Wei H, Sun R, and Tian Z (2007) The roles of innate immune cells in liver
injury and regeneration. Cell Mol Immunol 4:241–252.
Duwaerts CC and Gregory SH (2011) Targeting the diverse immunological functions
expressed by hepatic NKT cells. Expert Opin Ther Targets 15:973–988.
Eberl G, Lees R, Smiley ST, Taniguchi M, Grusby MJ, and MacDonald HR (1999)
Tissue-specific segregation of CD1d-dependent and CD1d-independent NK T cells.
J Immunol 162:6410–6419.
Fu ZD, Csanaky IL, and Klaassen CD (2012) Effects of aging on mRNA profiles for
drug-metabolizing enzymes and transporters in livers of male and female mice.
Drug Metab Dispos 40:1216–1225.
Geier A, Fickert P, and Trauner M (2006) Mechanisms of disease: mechanisms and
clinical implications of cholestasis in sepsis. Nat Clin Pract Gastroenterol Hepatol
3:574–585.
Geissmann F, Cameron TO, Sidobre S, Manlongat N, Kronenberg M, Briskin MJ,
Dustin ML, and Littman DR (2005) Intravascular immune surveillance by
CXCR61 NKT cells patrolling liver sinusoids. PLoS Biol 3:e113.
Giraud C, Manceau S, Declèves X, Goffinet F, Morini JP, Chappuy H, Batteux F,
Chouzenoux S, Yousif S, and Scherrmann JM, et al. (2010) Influence of development, HIV infection, and antiretroviral therapies on the gene expression
profiles of ABC transporters in human lymphocytes. J Clin Pharmacol 50:226–230.
Godfrey DI and Rossjohn J (2011) New ways to turn on NKT cells. J Exp Med 208:
1121–1125.
Green RM, Beier D, and Gollan JL (1996) Regulation of hepatocyte bile salt transporters by endotoxin and inflammatory cytokines in rodents. Gastroenterology 111:
193–198.
Gururajan M, Jacob J, and Pulendran B (2007) Toll-like receptor expression and responsiveness of distinct murine splenic and mucosal B-cell subsets. PLoS ONE 2:e863.
Halilbasic E, Claudel T, and Trauner M (2013) Bile acid transporters and regulatory
nuclear receptors in the liver and beyond. J Hepatol 58:155–168.
Hirschfield GM and Heathcote EJ (2009) Cholestasis and cholestatic syndromes.
Curr Opin Gastroenterol 25:175–179.
Hirschfield GM, Heathcote EJ, and Gershwin ME (2010) Pathogenesis of cholestatic
liver disease and therapeutic approaches. Gastroenterology 139:1481–1496.
Ishihara K and Hirano T (2002) Molecular basis of the cell specificity of cytokine
action. Biochim Biophys Acta 1592:281–296.
Hofmann AF (2007) Biliary secretion and excretion in health and disease: current
concepts. Annals of Hepatology 6:15–27.
Hofmann AF (2009) The enterohepatic circulation of bile acids in mammals: form and
functions. Frontiers in Bioscience: A Journal and Virtual Library 14:2584–2598.
Katz SC, Ryan K, Ahmed N, Plitas G, Chaudhry UI, Kingham TP, Naheed S, Nguyen
C, Somasundar P, and Espat NJ, et al. (2011) Obstructive jaundice expands
intrahepatic regulatory T cells, which impair liver T lymphocyte function but
modulate liver cholestasis and fibrosis. J Immunol 187:1150–1156.
Kim JH, Kim HS, Kim HY, Oh SJ, and Chung DH (2012) Direct engagement of TLR4
in invariant NKT cells regulates immune diseases by differential IL-4 and IFN-g
production in mice. PLoS ONE 7:e45348.
Kim PK, Chen J, Andrejko KM, and Deutschman CS (2000) Intraabdominal sepsis
down-regulates transcription of sodium taurocholate cotransporter and multidrug
resistance-associated protein in rats. Shock 14:176–181.
Klaassen CD and Aleksunes LM (2010) Xenobiotic, bile acid, and cholesterol transporters: function and regulation. Pharmacol Rev 62:1–96.
Klein C, Wüstefeld T, Assmus U, Roskams T, Rose-John S, Müller M, Manns MP,
Ernst M, and Trautwein C (2005) The IL-6-gp130-STAT3 pathway in hepatocytes
triggers liver protection in T cell-mediated liver injury. J Clin Invest 115:860–869.
Kong B, Csanaky IL, Aleksunes LM, Patni M, Chen Q, Ma X, Jaeschke H, Weir S,
Broward M, and Klaassen CD, et al. (2012) Gender-specific reduction of hepatic
Mrp2 expression by high-fat diet protects female mice from ANIT toxicity. Toxicol
Appl Pharmacol 261:189–195.
Kubitz R, Wettstein M, Warskulat U, and Häussinger D (1999) Regulation of the
multidrug resistance protein 2 in the rat liver by lipopolysaccharide and dexamethasone. Gastroenterology 116:401–410.
Kwekel JC, Desai VG, Moland CL, Branham WS, and Fuscoe JC (2010) Age and sex
dependent changes in liver gene expression during the life cycle of the rat. BMC
Genomics 11:675.
Li N, Choudhuri S, Cherrington NJ, and Klaassen CD (2004) Down-regulation of
mouse organic anion-transporting polypeptide 4 (Oatp4; Oatp1b2; Slc21a10)
mRNA by lipopolysaccharide through the toll-like receptor 4 (TLR4). Drug Metab
Dispos 32:1265–1271.
Downloaded from jpet.aspetjournals.org at ASPET Journals on October 2, 2016
modulation by lymphocyte activity. Importantly, although we
and others propose that LPS-induced cytokines directly target
hepatocytes and ductal epithelial cells to alter hepatic transporter mRNA, it has also been established that transporters, in
particular ATP-binding cassette transporters, are expressed
on lymphocytes. Therefore, given that lymphocytes also
express TLR4, we cannot ignore the possibility that alteration
of lymphocyte transporter expression may contribute to inflammation in the liver, as has been previously suggested (van
de Ven et al., 2009; Giraud et al., 2010; Verbrugge et al., 2012).
As hepatic bile acid transporter expression and immune
response in other liver diseases are both sex-dependent,
a second aspect of this study involved elucidating whetherlymphocytes contribute to the sex-biased basal expression of
hepatic transporters. Exacerbated basal Mrp3 expression in
female mice only suggests that lymphocytes may contribute to
sex-biased hepatic transporter expression and implicates
a particularly important role for CD41 T cells. Consistent
with this, conventional CD41 T cells rapidly produce IL-2
upon activation. IL-2 receptor signaling is predominantly
mediated through STAT5a and STAT5b signaling pathways
(Lin et al., 2012; Liao et al., 2013), and hepatocytes respond to
IL-2 signaling (Sunman et al., 2004). A role for STAT5
signaling in sex-specific hepatic transporter expression has
been identified for Ntcp (Clodfelter et al., 2006, 2007; Zhang
et al., 2012). Thus, it is plausible that cytokine signaling crosstalk with bile acid–induced nuclear receptor activation also
contributes to sex-specific regulation of hepatic transporters.
Alternatively, sex discrepancy could be the result of other
divergent sex-dependent immune responses. For example,
women have higher absolute numbers of total CD41 T cells
and produce higher levels of IFN-g.
In conclusion, the present study implicates that T and
B cells regulate hepatic transporters (Fig. 5). In addition, we
further implicate a protective role for IL-6 and identify lymphocytes as modulators of sex-biased hepatic transporter
expression. Given that targeted therapies that affect lymphocyte function could adversely affect bile flow, it is critical that
further work be done to identify the lymphocytes that regulate
transporter function.
143
144
Mulligan et al.
Seder RA, Paul WE, Davis MM, and Fazekas de St Groth B (1992) The presence of
interleukin 4 during in vitro priming determines the lymphokine-producing
potential of CD41 T cells from T cell receptor transgenic mice. J Exp Med 176:
1091–1098.
Shu Y, Brown C, Castro RA, Shi RJ, Lin ET, Owen RP, Sheardown SA, Yue L,
Burchard EG, and Brett CM, et al. (2008) Effect of genetic variation in the organic
cation transporter 1, OCT1, on metformin pharmacokinetics. Clin Pharmacol Ther
83:273–280.
Streetz KL, Wüstefeld T, Klein C, Kallen KJ, Tronche F, Betz UA, Schütz G, Manns
MP, Müller W, and Trautwein C (2003) Lack of gp130 expression in hepatocytes
promotes liver injury. Gastroenterology 125:532–543.
Sun R, Tian Z, Kulkarni S, and Gao B (2004) IL-6 prevents T cell-mediated hepatitis
via inhibition of NKT cells in CD41 T cell- and STAT3-dependent manners.
J Immunol 172:5648–5655.
Sunman JA, Hawke RL, LeCluyse EL, and Kashuba AD (2004) Kupffer cell-mediated
IL-2 suppression of CYP3A activity in human hepatocytes. Drug Metab Dispos 32:
359–363.
Taub R (2003) Hepatoprotection via the IL-6/Stat3 pathway. J Clin Invest 112:
978–980.
Tirona RG and Kim RB (2005) Nuclear receptors and drug disposition gene regulation. J Pharm Sci 94:1169–1186.
Tough DF, Sun S, and Sprent J (1997) T cell stimulation in vivo by lipopolysaccharide
(LPS). J Exp Med 185:2089–2094.
Trauner M and Boyer JL (2003) Bile salt transporters: molecular characterization,
function, and regulation. Physiol Rev 83:633–671.
van de Ven R, Oerlemans R, van der Heijden JW, Scheffer GL, de Gruijl TD, Jansen
G, and Scheper RJ (2009) ABC drug transporters and immunity: novel therapeutic
targets in autoimmunity and cancer. J Leukoc Biol 86:1075–1087.
Verbrugge SE, Assaraf YG, Dijkmans BA, Scheffer GL, Al M, den Uyl D, Oerlemans
R, Chan ET, Kirk CJ, and Peters GJ, et al. (2012) Inactivating PSMB5 mutations
and P-glycoprotein (multidrug resistance-associated protein/ATP-binding cassette
B1) mediate resistance to proteasome inhibitors: ex vivo efficacy of (immuno)proteasome inhibitors in mononuclear blood cells from patients with rheumatoid arthritis. J Pharmacol Exp Ther 341:174–182.
Zhang Y, Laz EV, and Waxman DJ (2012) Dynamic, sex-differential STAT5 and
BCL6 binding to sex-biased, growth hormone-regulated genes in adult mouse liver.
Mol Cell Biol 32:880–896.
Address correspondence to: Susan C. McKarns, University of Missouri
School of Medicine, Department of Surgery, M616 Medical Sciences Building,
Columbia, MO 65212. E-mail: mckarnss@health.missouri.edu
Downloaded from jpet.aspetjournals.org at ASPET Journals on October 2, 2016
Li N and Klaassen CD (2005) Lipopolysaccharide-induced down-regulation of organic
anion transporting polypeptide 4 (Oatp4; Slc21a10) is independent of tumor necrosis factor-alpha, Interleukin-1beta, interleukin-6, or inducible nitric oxide synthase. Toxicol Sci 83:197–203.
Liao W, Lin JX, and Leonard WJ (2013) Interleukin-2 at the crossroads of effector
responses, tolerance, and immunotherapy. Immunity 38:13–25.
Lickteig AJ, Slitt AL, Arkan MC, Karin M, and Cherrington NJ (2007) Differential
regulation of hepatic transporters in the absence of tumor necrosis factor-alpha,
interleukin-1beta, interleukin-6, and nuclear factor-kappaB in two models of cholestasis. Drug Metab Dispos 35:402–409.
Lin JX, Li P, Liu D, Jin HT, He J, Ata Ur Rasheed M, Rochman Y, Wang L, Cui K,
and Liu C, et al. (2012) Critical Role of STAT5 transcription factor tetramerization
for cytokine responses and normal immune function. Immunity 36:586–599.
Maher JM, Slitt AL, Cherrington NJ, Cheng X, and Klaassen CD (2005) Tissue
distribution and hepatic and renal ontogeny of the multidrug resistance-associated
protein (Mrp) family in mice. Drug Metab Dispos 33:947–955.
Merritt ME and Donaldson JR (2009) Effect of bile salts on the DNA and membrane
integrity of enteric bacteria. J Med Microbiol 58:1533–1541.
Meyer-Bahlburg A, Bandaranayake AD, Andrews SF, and Rawlings DJ (2009) Reduced c-myc expression levels limit follicular mature B cell cycling in response to
TLR signals. J Immunol 182:4065–4075.
Mulder J, Karpen SJ, Tietge UJ, and Kuipers F (2009) Nuclear receptors: mediators
and modifiers of inflammation-induced cholestasis. Front Biosci (Landmark Ed)
14:2599–2630.
Parker GA and Picut CA (2012) Immune functioning in non lymphoid organs: the
liver. Toxicol Pathol 40:237–247.
Pone EJ, Zan H, Zhang J, Al-Qahtani A, Xu Z, and Casali P (2010) Toll-like receptors
and B-cell receptors synergize to induce immunoglobulin class-switch DNA recombination: relevance to microbial antibody responses. Crit Rev Immunol 30:1–29.
Reynolds JM, Martinez GJ, Chung Y, and Dong C (2012) Toll-like receptor 4 signaling in T cells promotes autoimmune inflammation. Proc Natl Acad Sci USA
109:13064–13069.
Ricciardi R, Schaffer BK, Shah SA, Quarfordt SH, Banner BF, Wheeler SM, Donohue
SE, Meyers WC, and Chari RS (2001) Bosentan, an endothelin antagonist, augments hepatic graft function by reducing graft circulatory impairment following
ischemia/reperfusion injury. J Gastrointest Surg 5:322–329.
Roeb E, Purucker E, Gartung C, Geier A, Jansen B, Winograd R, and Matern S (2003)
Effect of glutathione depletion and hydrophilic bile acids on hepatic acute
phase reaction in rats with extrahepatic cholestasis. Scand J Gastroenterol 38:
878–885.
Scheller J, Chalaris A, Schmidt-Arras D, and Rose-John S (2011) The pro- and antiinflammatory properties of the cytokine interleukin-6. Biochim Biophys Acta 1813:
878–888.