Tumor necrosis factor alpha and
interleukin-1beta regulate the murine
manganese superoxide dismutase gene
through a complex intronic enhancer involving
C/EBP-beta and NF-kappaB.
P L Jones, D Ping and J M Boss
Mol. Cell. Biol. 1997, 17(12):6970.
These include:
CONTENT ALERTS
Receive: RSS Feeds, eTOCs, free email alerts (when new articles
cite this article), more»
Information about commercial reprint orders: http://journals.asm.org/site/misc/reprints.xhtml
To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/
Downloaded from http://mcb.asm.org/ on February 22, 2013 by PENN STATE UNIV
Updated information and services can be found at:
http://mcb.asm.org/content/17/12/6970
MOLECULAR AND CELLULAR BIOLOGY, Dec. 1997, p. 6970–6981
0270-7306/97/$04.0010
Copyright © 1997, American Society for Microbiology
Vol. 17, No. 12
Tumor Necrosis Factor Alpha and Interleukin-1b Regulate the
Murine Manganese Superoxide Dismutase Gene through a
Complex Intronic Enhancer Involving C/EBP-b and NF-kB
PETER L. JONES,† DONGSHENG PING,
AND
JEREMY M. BOSS*
Department of Microbiology and Immunology, Emory University School of Medicine,
Emory University, Atlanta, Georgia 30322
Manganese superoxide dismutase (MnSOD), a tumor necrosis factor (TNF)-inducible reactive oxygenscavenging enzyme, protects cells from TNF-mediated apoptosis. To understand how MnSOD is regulated,
transient transfections of promoter-reporter gene constructions, in vitro DNA binding assays, and in vivo
genomic footprint (IVGF) analysis were carried out on the murine MnSOD gene. The results of this analysis
identified a 238-bp region of intron 2 that was responsive to TNF and interleukin-1b (IL-1). This TNF response
element (TNFRE) had the properties of a traditional enhancer element that functioned in an orientation- and
position-independent manner. IVGF of the TNFRE revealed TNF- and IL-1-induced factor occupancy of sites
that could bind NF-kB and C/EBP. The 5* portion of the TNFRE bound C/EBP-b in vitro and was both
necessary and sufficient for TNF responsiveness with the MnSOD promoter or with a heterologous promoter
when in an upstream position. The 3* end of the TNFRE bound both NF-kB and C/EBP but was not necessary
for TNF responsiveness with the MnSOD promoter. However, this 3* portion of the TNFRE was required for
the TNFRE to function as a downstream enhancer with a heterologous promoter. These data functionally
separate the MnSOD TNFRE into a region responsible for TNF activation and one that mediates induction
when it is downstream of a promoter.
chinery within the mitochondria from oxidative damage. Both
TNF and IL-1 induce intracellular superoxide generation,
which probably contributes to their cytolytic activity (41, 54).
The role of MnSOD in protection from oxidative damage and
the cytolytic effects of TNF was demonstrated by the discovery
that overexpression of MnSOD in some TNF-sensitive cell
lines conferred resistance to TNF-mediated apoptosis (52).
Additionally, TNF- and IL-1-mediated induction of MnSOD
has been shown to confer protection against myocardial reperfusion injury (34, 35) and tissue damage due to oxidative stress
(26, 43). The mechanisms for the induction of MnSOD expression under all of these conditions are poorly understood. However, activation of the transcription factor NF-kB has been
implicated in all of these conditions.
Both TNF and IL-1 cause rapid activation and nuclear translocation of the transcription factor NF-kB (4, 5, 38). Activation
of NF-kB is required for the induction of many TNF- and
IL-1-induced genes (reviewed in reference 1) and strongly correlates with induction of MnSOD mRNA (9). Thus, it has been
proposed that TNF and IL-1 regulate MnSOD expression
through NF-kB, although, to date, no cis-acting TNF- or IL1-responsive element has been identified for the MnSOD gene
in any species.
To study the TNF-mediated regulation of MnSOD, we previously isolated and characterized a murine MnSOD genomic
clone (20). Sequence analysis of the 59 flanking DNA sequence
to 21734 revealed numerous putative regulatory motifs that
have the ability to bind SP-1 (GC box), AP-1 (TRE), and
NF-kB (kB element) family members. In this study, mutagenesis, in vivo genomic footprinting (IVGF), and in vitro DNA
binding assays were used to identify the elements responsible
for the TNF-mediated induction of MnSOD. The results of
these experiments demonstrated that TNF responsiveness was
not within this upstream region. IVGF, however, suggested a
role for SP-1 on the GC boxes by showing that these sites were
Tumor necrosis factor alpha (TNF) and interleukin-1b
(IL-1) are primary mediators of the immune response, potentiating numerous signal transduction pathways that lead to the
induction of specific gene expression through the activation of
transcription factors (reviewed in references 1, 8, and 16). In
addition, TNF initiates a cytolytic signaling cascade that leads
to increased levels of reactive oxygen intermediates (ROIs)
and the subsequent apoptosis of some tumor cell lines and
virally infected cells (reviewed in reference 1). ROIs, generated either as by-products of normal cellular metabolism or
under conditions of oxidative stress, lead to cell death and
tissue damage when allowed to accumulate (reviewed in references 11 and 18). To combat this lethal effect of ROIs,
eukaryotic cells have evolved several reactive oxygen-scavenging enzymes, including multiple species of superoxide dismutase (SOD) that vary by their catalytic metal ions as well as
their cellular localization (reviewed in references 12 and 13).
SODs rapidly catalyze the specific conversion of superoxide
radicals to hydrogen peroxide and oxygen (29). Mitochondria
are particularly susceptible to oxidative damage from superoxide radicals generated directly by oxidative phosphorylation
and electron transport (51). To protect the mitochondria from
superoxide radical-mediated damage, cells express a nucleusencoded, mitochondrially localized SOD, the manganese-containing SOD (MnSOD) (50). The importance of eliminating
oxygen radicals from the mitochondria is illustrated by the
neonatal death of mice lacking MnSOD expression (25, 27).
Of the antioxidant enzymes, MnSOD is uniquely induced in
response to conditions of oxidative stress (2, 26, 53), emphasizing the importance of protecting the energy-producing ma* Corresponding author. Phone: (404) 727-5973. Fax: (404) 7271719. E-mail: boss@microbio.emory.edu.
† Present address: Laboratory of Molecular Embryology, National
Institutes of Health, Bethesda, MD 20892.
6970
Downloaded from http://mcb.asm.org/ on February 22, 2013 by PENN STATE UNIV
Received 7 August 1997/Returned for modification 18 August 1997/Accepted 21 August 1997
VOL. 17, 1997
REGULATION OF MnSOD BY TNF
MATERIALS AND METHODS
Cell culture. NIH 3T3 cells (ATCC 1658-CRL) were grown in Dulbecco’s
modified Eagle’s medium supplemented with 10% calf serum (Hyclone, Inc.,
Logan, Utah), penicillin (50 U/ml), streptomycin (50 mg/ml), and L-glutamine (1
mM) (Life Sciences). Human recombinant TNF (Chiron Corp., Emeryville,
Calif., and Genzyme, Inc., Cambridge, Mass.) and murine IL-1 (Genzyme, Inc.)
were used at final concentrations of 500 U/ml and 2 ng/ml, respectively. The cells
were grown to 80% confluence prior to transfection or treatment with TNF or
IL-1.
Nuclear run-on assays. Nuclear run-on analysis was carried out as previously
described (24). Approximately 5 3 106 nuclei were harvested from NIH 3T3 cells
per sample. The run-on reaction was carried out in 100 mM Tris (pH 7.9)–50 mM
NaCl–340 mM (NH4)2SO4–2 mM EDTA–4.4 mM MnCl2–100 mg of heparin–1.5
mM ATP–1.5 mM GTP–1.5 mM CTP–100 mCi of [a-32P]UTP/50 ml of nuclei for
45 min at 32°C. Genomic DNA was degraded with 25 U of RQ1 DNase I
(Promega, Inc., Madison, Wis.) for 30 min at 37°C after modification of the
solution by the addition of Tris (pH 7.4) to 16 mM, CaCl2 to 8 mM, and 10 mg
of tRNA. The DNase was inactivated by the addition of sodium dodecyl sulfate
to 1%, EDTA to 20 mM, and 1 mg of proteinase K, followed by a 15-min
incubation at 37°C. The reaction was extracted with an equal volume of phenolchloroform-isoamyl alcohol and precipitated with trichloroacetic acid. The pellet
was redissolved in 400 ml of 25 mM Tris (pH 7.4)–1 mM EDTA and precipitated
with ethanol. The RNA was resuspended in diethylpyrocarbonate-treated distilled H2O. Equal counts per minute per sample were used for hybridization in
10 mM N-tris(hydroxymethyl)methyl-2-aminoethanesulfonic acid (TES)–0.2%
sodium dodecyl sulfate–10 mM EDTA–0.3 M NaCl–13 Denhardt’s solution–100
mg of tRNA per ml–100 mg of poly(A) per ml for 36 h at 65°C. cDNAs (500
ng/dot) were denatured and immobilized to GeneScreen (New England Nuclear,
Inc.) membranes for use as probes.
Plasmid constructions. The 59 MnSOD-chloramphenicol acetyltransferase
(CAT) deletion constructs were generated by PCR amplification with the
genomic MnSOD clone pSODE13 as a template (20). One of the 59 primers
(where the 59 base is indicated in parentheses) (21709) 59-GAAGACCGCTTT
GACATCAGCC, (21373) 59-GTGCCACCACACCACCATA, (2509) 59-GGA
GTCCGCAACCCCAGTCTC, or (2195) 59-CAAGGCCGATGGTGGGGGC
was amplified with the 39 primer (169) 59-TATTGAGGTTTACACGACCGC
TGCTC in a standard reaction with cycling temperatures of 94, 58, and 72°C.
The PCR products were cloned into the pCATBasic vector (Promega, Inc.),
which was linearized with XbaI and filled in with the Klenow fragment. The
largest construct, containing 1,709 bp of upstream sequence, was named
p59MnSOD and was used as the base vector for the 39 construction series
described below. All PCR amplifications were performed with PfuI DNA polymerase (Stratagene, Inc., La Jolla, Calif.). All clones were sequenced.
Four sets of constructions were created in which DNA sequences from the
MnSOD gene were placed 39 to the CAT reporter cassette of p59MnSOD. In the
first set, the MnSOD genomic DNA clone pSODE13 was digested with EcoRI
and either XbaI, HindIII, or XbaI and SmaI. Restriction fragments were gel
isolated and ligated into the 39 polylinker of p59MnSOD, which was linearized
with BamHI. All the digestion products were filled in with the Klenow fragment
prior to ligation. These plasmids were termed p59Mn(*), where the * indicates
which restriction fragment was used. The second set of constructions, termed
pMnSOD39(*–*), where the asterisks indicate the included base pairs, was created by ligating PCR-amplified fragments of the MnSOD genomic DNA into the
BamHI site of the p59MnSOD vector as described above. PCR amplification was
carried out with one of the 59 primers (146) 59-GCAGCGGTCGTGTAAACC
TC, (1365) 59-ACCTCAACGCCACCGAGGAGA, (11561) 59-AACTGTCTT
CAGACAGAGGGCG, (11665) 59-GGTTGCTGGGATTTGAACTC, (12119)
59-GGGGCATCTAGTGGAGAAGTA, or (12280) 59-GGGAGGATGTGGT
AATAGT with one or the other 39 primer (12420) 59-AGCTCTGGCTCCAC
AGAAGG or (12126) 59-GATGCCCCTCGTCAGCCAGATGTCA.
The third set, a 39 fine-structure deletion series, was also generated by PCR
amplification with one of the 59 primers (12119) 59-GGGGCATCTAGTGGA
GAAGTA, (12158) 59-GTGTAAGTGGCCAATCCAAGAGAGGG, (12266)
59-GAAATTGCAGATCTGGGAGG, or (12280) 59-GGGAGGATGTGGTA
ATAGT and one of the 39 primers (12420) 59-AGCTCTGGCTCCACAGAA
GG, (12352) 59-GCCAGATGTCACCTTAAAGG, (12337) 59-AAAGGAAA
TGCTTTCCCAACTG, (12299) 59-CACTATTACCACATCCTCCC, (12280)
59-CAGATCTGCAATTTCC, (12271) 59-AATTTCCAAAAATCCCAGTCTC,
or (12222) 59-GCTTATTGCAAGTAAAATTTCC in a standard reaction as
described above. The PCR products were cloned into the 39 BamHI site of
p59MnSOD as described above.
In the fourth set, internal deletions within the TNFRE were generated by
overlap PCR amplification from the genomic MnSOD clone pSODE13 template
with the following 59 and 39 border primers, respectively: (12119) 59-GGGGC
ATCTAGTGGAGAAGTA and (12420) 59-AGCTCTGGCTCCACAGAAGG.
One of a pair of complementary overlap primers was synthesized and used in the
first step of the amplification with either the 39 or 59 primers. The 59 direction
overlap primers used were 59D(12304) 59-GGTAATAGTGAAGCACTTTAA
GGTGACATC, 59D(12288) 59-GGAAATTGCAGATCTAGTGAAGCAGGGG,
59D(12216) 59-GGAAATTTTACTTGCGGGAGGATGTGGTAA, 59D(12192)
59-GAGAGGGAAATATTAAATAAGCAAATCAC, and 59D(12168) 59-TAATT
GTGTAAGTGGCCACATTCTGGAAAT. After purification of the 59 and 39
PCR products, the fragments were mixed and a second PCR was carried out with
just the 59 and 39 border primers listed above. The mutated TNFRE PCR
product was blunt-end cloned into the p59MnSOD reporter vector as described
above.
The MnSOD heterologous promoter constructions were made by cloning the
indicated PCR products or oligonucleotides into the pCATPromoter vector
(Promega, Inc.), which was linearized with BglII for 59 constructs or BamHI for
39 constructs, and filled in with the Klenow fragment.
Transfection assays. Transient transfections were carried out by electroporation at 280 V and 960 mF as previously described (40). Plasmid DNA was twice
banded on CsCl gradients, extracted with phenol-chloroform-isoamyl alcohol,
precipitated with ethanol, and resuspended in Tris-EDTA (TE) at 1 mg/ml prior
to transfection. For each data point, two cultures of approximately 3 3 106 NIH
3T3 cells were transfected with 20 mg of reporter construct DNA. Following
electroporation, the two transfections were pooled and split equally between two
plates. TNF (500 U/ml) or IL-1 (2 ng/ml) was added 36 h posttransfection to one
plate, and medium alone was added to the second plate. The cells were harvested
48 h posttransfection as described previously (40) and assayed by chloramphenicol acetyltransferase (CAT) enzyme-linked immunosorbent assay (ELISA)
(Boehringer Mannheim, Inc., Indianapolis, Ind.) for CAT protein expression
with 25 ml of extract for the pCATPromoter constructs and 100 ml of extract for
the pCATBasic constructs. All transfections were repeated at least three times
and plotted with the standard deviation from the mean.
IVGF. IVGF was carried out as previously described (31, 32, 40) with minor
modifications. Control NIH 3T3 cells or cells treated with cytokine for the
indicated time were exposed to dimethyl sulfate (DMS) for 2 min to methylate
the DNA in vivo. All IVGF reactions were carried out with Vent Polymerase
(New England Biolabs, Inc., Beverly, Mass.) in the recommended buffer supplemented with 0.4 mM (each) dATP, dCTP, dTTP, and dGTP. The common linker
was ligated in the recommended buffer with 5 U of T4 DNA ligase (Life Sciences,
Inc., Grand Island, N.Y.) at 16°C overnight. The first primer in each group was
used in the fill-in reaction, the second was used in PCR amplification, and the
third was used in the labeling/fill-in reaction. The coding strand for the 59flanking region of MnSOD was analyzed with the primer set SOD59C-1 (59-GA
CCCACCCGTAGGGGACG), SOD59C-2 (59-CCCTGCCGCTCACCTGCAC),
and SOD59C-3 (59-CTGCCGCTCACCTGCACGCC). The noncoding strand of
the 59 region was analyzed with three primer sets as follows: SOD59NC-1A
(59-TGACGCCTGTGGACAGGTTTCT), SOD59NC-2A (59-TCTCCCTACCG
GAAAGCATCCTCTTG), and SOD59NC-3A (59-CCCTACCGGAAAGCATC
CTCTTGACAATTCCC); SOD59NC-1B (59-AGATGAACCTCGCCTTCTAA
TCCG), SOD59NC-2B (59-AGTTAACTGGCAAGCTGCACCCGG), and
SOD59NC-3B (59-ACTGGCAAGCTGCACCCGGAGTCCG); and SOD59NC-1C
(59-GAGGGGCCCTGATTACTCCATAATT), SOD59NC-2C (59-TTCTGACC
AGCAGCAGAGCCTTGGC), and SOD59NC-3C (59-CCAGCAGCAGAGCC
TTGGCTTTCCGG).
The coding strand of the TNFRE was analyzed with one primer set as follows:
SODREC-1 (59-GAGCGACCTGAGTTGTAACATCTCCT), SODREC-2 (59GCACCTTTAAAAAAACCTGTCCTCAGCC), and SODREC-3 (59-AAAAC
CTGTCCTCAGCCAGGCAAACCA). The noncoding strand of the TNFRE
was analyzed with two primer sets as follows: SODREN-1A (59-GGGGCATCT
AGTGGAGAAGTA), SODREN-2A (59-GTGTAAGTGGCCAATCCAAGA
GAGGG), and SODREN-3A (59-TGGCCAATCCAAGAGAGGGAAATATT
ACCACA); and SODREN-1B (59-GCGTCAGATGTCATTAAGGATGGTT),
SODREN-2B (59-CATGTGGTTGCTGGACCTTTGGAA), and SODREN-3B
(59-GCTGGACCTTTGGAAGAGCTGTCATTGC). The products were dena-
Downloaded from http://mcb.asm.org/ on February 22, 2013 by PENN STATE UNIV
constitutively protected regardless of the level of MnSOD expression. A TNF-responsive element (TNFRE) was identified
within the second intron of the MnSOD gene. This 238-bp
element is also responsive to IL-1. Sequence analysis of the
TNFRE revealed numerous potential transcription factor
binding sites. IVGF analysis showed TNF- and IL-1-induced
changes within the binding sites for NF-kB, C/EBP, and NF-1.
DNA-binding assays with the TNFRE showed that the 59 region of the TNFRE binds C/EBP-b and the 39 region binds
both C/EBP-b and NF-kB. The 59 C/EBP region was found to
be sufficient for TNF responsiveness when it was placed downstream of the MnSOD promoter but not when it was placed
downstream of a heterologous promoter. The 39 kB site was
not responsive to TNF but, together with the 59 region, could
provide position and orientation independence to the TNFRE
in a heterologous setting. These results describe two novel
activities of the MnSOD TNFRE: TNF responsiveness involving C/EBP-b and the ability of TNFRE to function in an intron
involving NF-kB.
6971
6972
JONES ET AL.
MOL. CELL. BIOL.
tured, electrophoresed on 6% denaturing polyacrylamide gels, and exposed to
film without screens.
EMSAs. Electrophoretic mobility shift assays (EMSAs) were performed as
previously described (40) with 3 mg of nuclear extract from either untreated or
TNF-treated NIH 3T3 cells. Binding reactions were carried out at room temperature in 12 mM HEPES (pH 7.9)–4 mM Tris (pH 7.9)–70 mM KCl–5 mM
MgCl2–0.6 mM EDTA–5 mM dithiothreitol–5 mg of bovine serum albumin–12%
glycerol–250 ng of poly(dI-dC)-poly(dI-dC). EMSA probes were made by synthesizing and annealing complementary oligonucleotides. The coding strand is
indicated with the cis element underlined: C/EBP30 (59-GGAAATATTACCA
CATTCTGGAAATTTTAC), C/EBP45 (59-GGAAATATTACCACATTCTGG
AAATTTTACTTGCAATAAGCAAAT), kB28 (59-ATAGTGAAGCAGGGG
AATAGCCCAGTTG), and kB40 (59-GAGGATGTGGTAATAGTGAAGCA
GGGGAATAGCCCAGTTG).
Competitor DNAs (100 ng per competition reaction) were synthesized and
annealed as described above by using the above sequences or the following
sequences (mutations are shown in lowercase type): C/EBPm59 (59-GGAAATg
actagtcaTTCTGGAAATTTTAC), C/EBPm39 (59-GGAAATATTACCACATga
ctagtcaTTTTAC), and C/EBPm5939 (59-GGAAATgactagtcaTgactagtcaTTTTA
C). The consensus DNAs used as competitors were as follows, with the consensus
sites underlined: AP-1 DNA (59-CGCTTGATGACTCAGCCGGAA) and C/
EBP DNA (59-TGCAGATTGCGCAATCTGCA).
Polyclonal antibodies for p65 (A), p65 (C-20), p50 (NLS), C/EBP (D198),
C/EBP-b (C-19), and SP-1 (PEP2), purchased from Santa Cruz Biotechnology,
Inc., were at a concentration of 1 mg/ml. As recommended by the manufacturer,
1 ml was used for each supershift assay.
Nucleotide sequence accession number. DNA sequence analysis of intron 2
was carried out, and the sequence has been submitted to GenBank. The accession number is AF003694.
RESULTS
TNF regulates MnSOD at the level of transcription initiation. MnSOD mRNA expression in murine fibroblasts is induced by TNF, and the steady-state levels of MnSOD mRNA
increase over the course of treatment (20). A previous report
suggested that part of this induction may be due to an increased stability of the mRNA (30). To determine if TNF
induction of MnSOD is transcriptionally regulated, nuclear
run-on analysis was carried out (Fig. 1). MnSOD transcription
was induced by TNF, with a maximal induction of eightfold
over that in untreated cells, occurring 30 min after TNF addition. The levels of transcription then decreased over time to
threefold after 8 h of TNF treatment. There was no detectable
transcription in the a-amanitin-treated control, indicating
specificity to RNA polymerase II transcription. The glyceral-
Downloaded from http://mcb.asm.org/ on February 22, 2013 by PENN STATE UNIV
FIG. 1. MnSOD is regulated at the level of transcription. Nuclear run-on
assays performed on control or TNF-treated (500 U/ml) NIH 3T3 cells for the
indicated time were carried out as described in Materials and Methods. PhosphorImager analysis for each gene was determined by dividing the results for the
TNF-treated reactions by those for the untreated reactions. The maximal fold
gene induction is indicated.
dehyde phosphate dehydrogenase gene, which is not regulated
by TNF, was not transcriptionally induced, indicating specificity of the induction (data not shown). Additional TNF-induced
genes, the JE/MCP-1 (15), VCAM (15, 37), and A20 (36)
genes, were assayed for comparison and showed maximal inductions of 56-, 20-, and 223-fold, respectively. Thus, while
MnSOD is clearly induced transcriptionally, the level of induction is not as great as for some other TNF-induced genes.
TNF responsiveness is controlled through a sequence in the
second intron of the MnSOD gene. Sequence analysis of the 59
flanking region of the murine MnSOD gene revealed multiple
putative regulatory motifs, including two kB sites that could
potentially respond to TNF (20). To identify the TNFRE for
MnSOD, PCR products generating 59 deletions in the 1,709 bp
upstream of the MnSOD gene were cloned 59 to the CAT gene
(Fig. 2A) such that all of the constructs contained the MnSOD
transcription initiation sites. To assay the activity of the MnSOD/
CAT reporters, the constructs were transiently transfected into
NIH 3T3 cells, treated with TNF or left untreated, and assayed
by ELISA for CAT protein (Fig. 2A). The three constructions
containing the most 59 flanking DNA expressed CAT protein
close to background levels. A construction containing 195 bp of
59 DNA expressed higher levels of CAT protein and exhibited
a small (1.7-fold) induction when the cells were treated with
TNF. However, none of the constructs showed a level of induction or expression that was analogous to the TNF response
observed in the nuclear run-on assay described above, indicating that elements required for TNF induction must be located
elsewhere in the MnSOD gene. To determine if a TNFRE was
located elsewhere in the MnSOD gene, restriction fragments
from the MnSOD gene were cloned 39 to the CAT reporter
gene of the largest MnSOD construct (p59MnSOD) and assayed as described above (Fig. 2B). The transient-transfection
assays showed that two constructs, p59MnX2(Sma) and
p59Mn(HI), were inducible by TNF (5.9- and 2.8-fold, respectively) and expressed significant levels of CAT protein. These
constructs contained 850 bp of overlapping sequence in intron
2, suggesting the presence of a TNFRE within this region.
To further delineate the TNFRE, a series of deletions spanning the TNF-responsive region were generated (Fig. 3). As
above, all of the PCR fragments were cloned 39 to the CAT
reporter. Except for p59Mn(2280–2420) and p59Mn(1561–
2126), all of the constructs shown in Fig. 3 were able to respond
to TNF with an effective range of 4.0- to 8.5-fold. The two
constructs that failed to be induced by TNF in this assay contained deletions in all or part of a 301-bp region of intron 2.
The smallest TNF-inducible construct, p59Mn(2119–2420),
contained 301 bp of intron 2, 238 bp of which was contained
within the p59Mn(X2-Sma) construct that showed TNF responsiveness (Fig. 2B and 3). We will therefore refer to this
238-bp region as the MnSOD TNFRE.
In addition to TNF, IL-1 induces MnSOD expression (49).
Therefore, the 39 deletion series was tested for responsiveness
to IL-1 (Fig. 3). Indeed, the TNF-responsive constructions
were also responsive to IL-1, providing up to sixfold induction.
Furthermore, the constructions that did not respond to TNF
also did not respond to IL-1. Thus, the IL-1-responsive element mapped to the same 238-bp region as the TNFRE, identifying an intronic cytokine-responsive region in the MnSOD
gene.
The MnSOD TNF-responsive element has the properties of
an enhancer. To test the ability of this cytokine-responsive
region to function as an enhancer element, two tests were
performed. In the first test, the ability of the TNFRE to drive
the expression of a heterologous promoter in an orientation-
VOL. 17, 1997
REGULATION OF MnSOD BY TNF
6973
independent manner was assayed. A 301-bp fragment containing the TNFRE (bp 2119 to 2420) was cloned 39 to the CAT
gene in the pCATPromoter vector, which contains the basic,
enhancerless simian virus 40 (SV40) promoter instead of the
MnSOD promoter (Fig. 4). Transient transfections followed by
CAT ELISAs showed that the TNFRE in pSV39Mn(2119–
2420) and pSV39Mn(2420–2119) can confer TNF responsiveness (5.9- and 7.0-fold, respectively) to a heterologous promoter that was independent of the element’s orientation. In
the second test, the TNFRE was cloned upstream of the SV40
promoter, creating pSV59Mn(2119–2420) and pSV59Mn
(2420–2119). Expression from pSV59Mn(2119–2420) and
pSV59Mn(2420–2119) was induced by TNF (14.6- and 10.2fold, respectively), indicating that the region can function in a
position-independent manner. Thus, the TNFRE (2119–2420)
functions as a classic enhancer, activating transcription from a
heterologous promoter in a position- and orientation-independent manner.
Multiple 5* GC boxes are used for basal and activated
MnSOD transcription. To accurately identify the sequences
and the potential transcription factors involved in TNF regulation of MnSOD, IVGF was performed on both the 59 flanking sequence and the intronic cytokine responsive region. The
59 flanking sequence (Fig. 5) showed in vivo protection from
DMS methylation at guanines corresponding to five GC boxes
(summarized in Fig. 6A), and include guanines at bp 2172,
2201, and 2236, compared to the in vitro methylated DNA
control, indicating constitutive factor occupancy of these sites
in vivo. However, no change in protection was observed between the untreated and TNF-treated in vivo DNAs. EMSAs
Downloaded from http://mcb.asm.org/ on February 22, 2013 by PENN STATE UNIV
FIG. 2. Intron 2 of the MnSOD gene is responsive to TNF. (A) CAT reporter constructions containing the promoter and 59 flanking DNA of the MnSOD gene
are illustrated below a schematic of the computer-identified potential regulatory sites (20). The 59 base pair of each construct is indicated. Transient-transfection CAT
ELISA data for three separate experiments were averaged and plotted as optical density (O.D.) units. The fold induction of untreated control versus the TNF-treated
transfections is indicated. (B) Restriction digestion products or PCR products from the MnSOD gene were cloned into the BamHI site 39 to the CAT reporter gene
of the base vector pMnSOD59 and labeled p59Mn(*–*), where the asterisks indicate the restriction fragment used. CAT ELISA data from transient transfections with
the intronic restriction digestion series (X, XbaI; H, HindIII; sma, SmaI) are plotted as an average of three independent experiments. The fold induction between
control and TNF-treated transfections is shown for each pair. A schematic of the MnSOD genomic restriction map is indicated. B, BamHI; E, EcoRI.
6974
JONES ET AL.
MOL. CELL. BIOL.
have suggested that these sequences can bind SP-1 in vitro
(data not shown), suggesting a role for SP-1 in both basal and
TNF-induced MnSOD expression. The two putative kB binding sites at 2219 and 2788 and one AP-1 binding site at 2398
were not occupied under the conditions tested. Additional
IVGF of the 59 region of MnSOD, from bp 11 to 2834 (data
not shown), was carried out, and no guanines within the region
showed TNF-induced occupancy or hypersensitivity. Thus,
these data support the results of the transient-transfection
analysis, and together they indicate that no TNFRE is located
within the immediate 59 flanking DNA.
TNF induces the occupancy of putative C/EBP and NF-kB
binding sites in the TNFRE. Sequence analysis of the TNFRE
identified numerous potential binding sites for transcription
factors (Fig. 6). Of these sites, those that can bind C/EBP (6),
NF-kB (22), and NF-1 (14) have been previously associated
with other TNF-induced genes. In contrast to the 59 region of
MnSOD, IVGF analysis of the intronic TNFRE displayed multiple areas of TNF-induced occupancy and hypersensitivity in
vivo (Fig. 7). Two adjacent, putative C/EBP binding motifs
were identified by computer search and termed C/EBP-1 and
C/EBPX. These tandem putative C/EBP binding motifs
showed induced protection and hypersensitivity (bp G2192,
G2195, G2201, and G2202) at the earliest time point (15 to 30
min) after treatment with either TNF or IL-1 (Fig. 7), correlating with the nuclear run-on data, and remained occupied
over the course of treatment. Another putative C/EBP site
(C/EBP-2), located 80 bp downstream of the tandem C/EBP
sites, displayed cytokine-induced occupancy at bp G2288, and
G2291. Additional protection located adjacent to C/EBP-2 at
bp G2306, G2307, and G2308 corresponds to an NF-kB binding motif (Fig. 7B). The NF-kB binding site also contained one
FIG. 4. The MnSOD TNFRE functions with a heterologous promoter in an orientation- and location-independent manner. The TNFRE (bp 2119 to 2420) was
cloned 59 or 39 in both orientations into the pCATPromoter vector, which contains an enhancerless SV40 promoter, as diagrammed. Transient transfections and CAT
ELISAs were carried out, and the results are plotted as described in the legend to Fig. 2. OD, optical density.
Downloaded from http://mcb.asm.org/ on February 22, 2013 by PENN STATE UNIV
FIG. 3. MnSOD intronic CAT reporter constructions identify a 238-bp intronic element responsive to both TNF and IL-1. PCR products spanning exons 1 and 2
and intron 2 were cloned into the p59MnSOD CAT reporter vector shown in Fig. 2. The 59 and 39 ends of each fragment are indicated. CAT ELISA data from transient
transfections with this series are plotted as described in the legend to Fig. 2. A schematic of the first three exons and introns of the MnSOD gene is shown.
VOL. 17, 1997
hypersensitive site at G2313, suggesting a role for NF-kB in the
regulation of MnSOD. A strong site of induced hypersensitivity occurred 6 bp downstream of the NF-kB site, at G2322,
within a putative binding site for NF-1. In addition to these
sites of induced occupancy, there was an area of constitutive
protection at G2131, G2132, G2134, G2142, and G2148 that
did not correspond to any known protein binding sites (Fig. 6B
and 7), suggesting that part of this enhancer may also function
in basal transcription. Thus, the IVGF data support the CAT
fusion reporter data by identifying numerous sites of TNF- and
IL-1-induced protein occupancy within the 238-bp intronic enhancer.
NF-kB and C/EBP-b bind to the TNFRE in vitro. EMSAs
were carried out with nuclear extracts prepared from TNFtreated and control NIH 3T3 cells to identify factors that
interact with the putative kB and C/EBP sites of the TNFRE.
For the kB probe, EMSAs with nuclear extract from TNFtreated cells identified a shifted complex that was not present
when extracts from control untreated cells were used (Fig. 8A,
compare lanes 2 and 3). The specificity of the bound complex
was demonstrated by competition for complex formation with
unlabeled probe DNA (lane 4) but not with nonspecific DNA
(lane 5). Antiserum to NF-kB p65 supershifted the complex.
Antiserum to NF-kB p50 partially disrupted the DNA binding
of the complex, while two nonspecific antisera did not affect
the DNA binding or the mobility of the complex. Thus, these
data demonstrate that NF-kB can bind to this site in vitro and
imply that NF-kB uses this site in vivo.
As described above, three C/EBP sites were found within the
TNFRE that displayed changes in their in vivo DMS protection patterns following TNF treatment (Fig. 6 and 7). To iden-
6975
FIG. 6. Summary of the IVGF data from the MnSOD 59-flanking DNA (A)
and the MnSOD TNFRE (B). The positions of the bases are indicated relative
to the MnSOD transcription initiation site (11 5 bp 1734 on the genomic clone)
(20). Open circles and triangles indicate bases exhibiting constitutive occupancy
and hypersensitivity, respectively. Solid circles and triangles indicate bases exhibiting cytokine-induced occupancy (protection) or distortion (hypersensitivity),
respectively. Shaded base pairs identify putative transcription factor binding
sites. The boxed region highlights the borders of the CPR in the TNFRE.
tify factors that interact with these sites in vitro, EMSAs were
performed on a 30-bp probe (C/EBP30) encompassing the
C/EBP-1 and C/EBPX, located at the 59 half of the TNFRE.
EMSAs were carried out in the presence and absence of wildtype competitor DNAs and DNAs with mutations in one or
both putative C/EBP binding sites. Nuclear extracts from both
control and TNF-treated cells contained proteins that could
interact with the C/EBP30 probe in vitro, forming two bands
labeled a and b (Fig. 8B). Competitor DNA with mutations in
the C/EBPX site competed for all factor binding, while competitor DNA with mutations in the C/EBP-1 site or both binding sites failed to compete for factor binding. In addition, a
competitor DNA containing the consensus C/EBP binding site,
which is distinct from the TNFRE C/EBP sequences, competed effectively for the binding activity. Thus, the factors in
these extracts are present in the nucleus prior to TNF treatment and interact with C/EBP-1 but not with C/EBPX in vitro.
An antibody supershift assay was able to determine that antisera specific for C/EBP-b could supershift the b complex completely and partially supershift the a complex (Fig. 8C), indicating that C/EBP-b binds to the C/EBP-1 site of this TNFRE.
Because competitor DNAs (both wild-type C/EBPX and mutated C/EBP-1) were unable to compete for factor binding
activity, the identity of the factor interacting at C/EBPX is
unknown and is unlikely to be C/EBP. Additionally, C/EBP-2
site competitor DNA was able to compete for both complexes,
suggesting that C/EBP-2 also binds C/EBP-b.
Downloaded from http://mcb.asm.org/ on February 22, 2013 by PENN STATE UNIV
FIG. 5. TNF does not alter the occupancy of the 59 MnSOD flanking DNA
in vivo. An autoradiograph of an in vivo genomic footprint is shown (coding
strand). Cells were treated with TNF for the indicated time, followed immediately with DMS. DNA was prepared and IVGF was carried out as described in
Materials and Methods. Lane V contains in vitro-methylated DNA; lane 2
contains control, untreated cells. Open circles and triangles indicate protected
and hypersensitive guanines, respectively. Computer-identified regulatory motifs
(20) are indicated, as are the specific bases identified as contact sites.
REGULATION OF MnSOD BY TNF
6976
JONES ET AL.
MOL. CELL. BIOL.
High-resolution mapping identifies the C/EBP binding sites
but not the kB site as necessary for TNF induction of MnSOD.
The IVGF suggested that the entire region would be required
for TNF responsiveness. To determine if this was the case or if
a smaller subelement could be identified, deletion analysis was
carried out within the TNFRE. PCR was used to generate a
series of 59 and 39 deletions within the TNFRE. These fragments were ligated downstream of the CAT reporter of the
p59MnSOD vector. The plasmids were transfected and assayed
for their ability to respond to TNF. Transient transfections of
the 59 and 39 deletion series (Fig. 9) identified a 64-bp region
(bp 2158 to 2222) that was TNF responsive and capable of
functioning downstream of the MnSOD promoter. Surprisingly, the minimal TNF-responsive element, p59Mn(2119–
2222), did not contain the downstream kB site but instead
contained C/EBP-1 and C/EBPX and the constitutively protected region (CPR). Moreover, a construct containing the
downstream kB element without the upstream C/EBP-1 and
C/EBPX sites, p59Mn(2280–2420), was unresponsive to TNF.
It should be noted that the entire TNFRE containing the kB
element provided a higher level of expression, suggesting that
while one region may be sufficient, the entire region provides
maximal levels of expression.
To further localize the minimal TNFRE, a series of internal
deletion mutants were created by overlap PCR. Transfection
of this series of mutants identified a 23-bp deletion in
p59D(2192–2215) that lost TNF responsiveness (Fig. 9). This
deletion coincides with the 39 end of the 64-bp minimal TNFresponsive fragment defined by p59Mn(2158–2222). A construct deleting the 59 half of the minimal inducible fragment,
p59D(2168–2191), was fully inducible by TNF. Thus, the 23-bp
deletion in p59D(2192–2215) eliminated the cis-acting element(s) required for TNF-responsiveness. The deleted DNA
contains C/EBP-1 and C/EBPX, which displayed TNF and
IL-1-induced occupancy in vivo. The ability of the TNF-induc-
ible construct p59Mn(2158–2222) to respond to IL-1 was also
assayed. IL-1-treated cells transfected with p59Mn(2158–2222)
expressed CAT activity to levels similar to those obtained with
TNF (Fig. 9). These data therefore imply that the region containing C/EBP-1 and C/EBPX but not the kB site is sufficient
for induction by TNF and IL-1 when it is placed downstream of
the MnSOD promoter. Sequence analysis of this region of the
TNFRE did not reveal a kB site.
The ability of the C/EBP sites to regulate TNF-induced
expression is limited compared to that of the full TNFRE.
As shown above, the full TNFRE can function as a true
enhancer, retaining both position and orientation independence. To determine if the minimal region containing C/
EBP-1 and C/EBPX retained its positional independence,
the 30-bp C/EBP EMSA probe and a larger, 45-bp DNA
fragment, both of which encompass C/EBP-1 and C/EBPX
(C/EBP30 and C/EBP45, respectively), were cloned upstream
and downstream of the heterologous SV40 enhancerless promoter-driven CAT reporter gene pCATPromoter. Additionally, a 40-bp fragment containing the downstream kB element
and its adjacent C/EBP-2 site was synthesized (kB40) and
cloned as described above (Fig. 10). Transient transfections
revealed that the C/EBP30 and C/EBP45 fragments were responsive to TNF when they were located upstream but not
downstream of the SV40 promoter (Fig. 10). In addition, the
kB40 fragment was not TNF responsive in either location.
These data indicated that the C/EBP-1–C/EBPX region,
while being TNF responsive in the upstream position of a
heterologous promoter or downstream of its own promoter,
lacked elements required to function in a position-independent manner. Thus, it is likely that the additional elements
(including the kB site) mapped by in vivo footprinting are
required for proper regulation and responsiveness to TNF
and IL-1.
Downloaded from http://mcb.asm.org/ on February 22, 2013 by PENN STATE UNIV
FIG. 7. TNF or IL-1 treatment of cells induces factor binding to the intronic TNFRE. Autoradiographs of IVGF carried out on the TNFRE are shown. NIH 3T3
cells were methylated in vivo with DMS before (lane 2) or after TNF or IL-1 treatment for the indicated times. (A) Coding strand of the TNFRE encompassing the
C/EBP-1 and C/EBPX sites; (B) noncoding strand of the TNFRE encompassing the CPR, C/EBP-1, and C/EBPX sites; (C) coding strand of the TNFRE encompassing
the C/EBP-2, NF-kB, and NF-1 sites. An in vitro methylated DNA control is also shown (lane V). Open circles and triangles indicate bases exhibiting constitutive
protection or hypersensitivity, respectively. Solid circles and triangles signify bases exhibiting cytokine-induced occupancy (protection) and hypersensitivity, respectively.
Putative regulatory motifs are indicated.
VOL. 17, 1997
REGULATION OF MnSOD BY TNF
6977
DISCUSSION
The exposure of cells to the cytokine TNF leads to the
accumulation of toxic reactive oxygen intermediates and, not
surprisingly, to the induction of a gene, MnSOD, whose product eliminates these radicals from the cell. Here we show that
the initial burst in MnSOD expression, resulting from exposure
of cells to TNF, is due to transcriptional regulation through a
novel enhancer region located within the second intron of the
murine MnSOD gene. TNF-induced gene expression has been
shown to be mediated through the activities of transcription
factors belonging to the NF-kB, cFos/cJun, and C/EBP families
(reviewed in reference 1). IVGF of the TNFRE identified
several subregions that became occupied in response to TNF
and IL-1. These subregions were found to bind members of the
NF-kB p50/p65 and C/EBP-b in vitro. Further analysis of the
TNFRE revealed that TNF induction was mediated by a C/
EBP binding element and not the kB element. However, the
C/EBP element did not retain all the characteristic activities of
the full TNFRE. Namely, the ability of the element to function
downstream of a heterologous promoter was lost when just the
C/EBP-TNF-responsive region was included. Thus, these data
suggest that the ability of the MnSOD TNFRE to function in
an intronic or downstream position probably requires the activities of the factors identified by the IVGF.
Three novel features distinguish the MnSOD TNFRE from
other TNF-responsive regions. The first is location: the MnSOD
TNFRE is intronic. To date, all other TNFREs have been 59 to
the start of transcription. For example, HIV transcription (39),
VCAM (33), ICAM (17), E-selectin (44), IL-6 (42), TSG-6
(21), IL-2R-a chain (19), and A20 (23) are regulated by TNF
Downloaded from http://mcb.asm.org/ on February 22, 2013 by PENN STATE UNIV
FIG. 8. NF-kB and C/EBP bind to sequences within the TNFRE. Autoradiographs of EMSAs with nuclear extracts prepared from control and TNF-induced cells
were assayed for binding to the kB region of the TNFRE (A) and the C/EBP-1 and C/EBPX sites (B and C). (A) DNA competition was carried out with a 100-fold
molar excess of unlabeled probe as the specific competitor (Comp.) (lane 4) or a consensus AP-1 site containing DNA as the nonspecific competitor (lane 5). The
indicated antiserum was added as suggested to lanes 6 to 9. The dark and light arrows indicate the locations of the NF-kB complex and p65 supershifted complex,
respectively. (B) DNA competition with the C/EBP probe was carried out as indicated with a 100-fold molar excess of competitor DNA. Complexes a and b are
indicated. Crossed-out boxes indicate mutations in the sites as described in Materials and Methods. (C) Antibody supershift assays were carried out with the indicated
antisera. DNA competitions were carried out with DNA derived from the C/EBP-2 region. The light arrows indicate the altered mobility of the complexes as a result
of antiserum interaction.
6978
JONES ET AL.
MOL. CELL. BIOL.
through elements located within a few hundred base pairs of
the start of transcription. The TNFRE does not have to be
close to the promoter region. For the MCP-1 gene, the
TNFRE is located in a distal regulatory region 2.4 kb upstream
of the transcription initiation site (40). The second distinguish-
ing feature of the MnSOD TNFRE is the role of NF-kB. Like
MnSOD, TNFREs for other genes all contain either single or
tandemly arranged NF-kB sites. In the genes mentioned above,
the NF-kB sequence was required for TNF responsiveness. For
MnSOD, the NF-kB site was not required for all situations.
FIG. 10. The C/EBP region responds to TNF when placed upstream but not downstream of a heterologous SV40 promoter. Oligonucleotides encoding C/EBP-1
and C/EBPX or the NF-kB site were subcloned upstream or downstream of the pCATPromoter vector, which contains a minimal SV40 enhancerless promoter as in
Fig. 4. Transient transfection and CAT ELISAs were performed as in Fig. 2. O.D., optical density.
Downloaded from http://mcb.asm.org/ on February 22, 2013 by PENN STATE UNIV
FIG. 9. TNF responsiveness does not require an NF-kB binding site. PCR products spanning the TNFRE were cloned into the pMnSOD59 CAT reporter vector
shown in Fig. 2. The 59 and 39 ends of each fragment are indicated. CAT ELISA data from transient transfections with this series are plotted as described in the legend
to Fig. 2. OD, optical density.
VOL. 17, 1997
Nonetheless, several lines of evidence suggest that NF-kB is
important for regulation of the endogenous gene. Stimuli that
induce MnSOD expression (TNF [53], IL-1 [49], lipopolysaccharide [49], and ionizing radiation [2]) also induce NF-kB
activation (3). Reagents that inhibit the function of NF-kB,
such as the protease inhibitors tolylsulfonyl phenylalanyl chloromethyl ketone and tosyl lysyl chloromethyl ketone (TPCK
and TLCK), block TNF activation of MnSOD (9). Conversely,
reducing reagents that stimulate NF-kB activity, such as Nacetyl-L-cysteine (NAC), DTT, and b-mercaptoethanol (BME),
induce MnSOD expression (10). In addition, NF-kB activation
can suppress TNF-mediated apoptosis (28, 48), suggesting its
involvement in the stimulation of TNF resistance genes like
MnSOD. The finding of a kB site within the TNFRE that
becomes occupied upon TNF induction and that can bind
NF-kB is consistent with a role for this protein in regulating
MnSOD. However, as discussed above, the NF-kB region was
not sufficient for expression, indicating that other regions and
factors are required.
The IVGF analysis first identified potential regions or factors within the TNFRE. Sequence comparison between murine
and human MnSOD intron 2 DNA sequences showed that all
of the protected sites are highly conserved, emphasizing the
importance of this region (Fig. 11). Included within this homology was the CPR at the 59 end of the TNFRE (bp 2119 to
2148), which was not similar to any sites within the database.
The role of this region is not known. Also included were
C/EBP-1, C/EBPX, C/EBP-2, and the putative NF-1 site located 39 to the NF-kB site.
The third novel feature of the MnSOD TNFRE is the role of
the C/EBP binding region, which bound C/EBP-b in vitro and
can respond to TNF on its own. The failure to detect NF-kB
binding to this region and the lack of a kB binding site suggests
either that C/EBP is directly responding to TNF or that the kB
proteins are interacting with C/EBP to enhance its binding and
allow transcriptional activation. In light of the finding that
NF-kB activity correlates directly with MnSOD induction, the
latter scenario is more likely. Supporting this model are experiments by Stein et al. (47), which showed that C/EBP binding
was enhanced in the presence of NF-kB p65. In this case, the
addition of p65 did not alter the mobility of the C/EBP-DNA
complex from the control. The authors suggested that the p65
interaction may have altered the conformation of C/EBP, making it more stable (47). They further demonstrated that this
interaction enhanced expression in transient-transfection assays. Because NF-kB binding activity but not C/EBP was in-
6979
duced by TNF treatment, the study of Stein et al. (47) may
offer some explanation for the mechanism of the MnSOD
TNFRE. In the uninduced state, MnSOD transcription is at
low levels and is probably controlled by the factors that bind to
the 59 GC boxes and to the CPR of the TNFRE, which were
occupied prior to TNF treatment. We propose that following
TNF stimulation, NF-kB translocation and activation induce
the assembly of the TNFRE by enhancing or stabilizing the
binding of C/EBP-b to the C/EBP region. The binding of
factors to the additional induced sites within the TNFRE,
C/EBP-2, and the putative NF-1 binding site may further stabilize interactions or DNA binding, ultimately recruiting the
general transcription factors and RNA polymerase. In the
transient transfections, the stabilization of C/EBP-b to C/
EBP-1 by NF-kB, in the absence of a kB site, is sufficient to
activate expression from a heterologous promoter when placed
upstream or downstream of the MnSOD promoter and may
occur as described by Stein et al. (47). For unknown reasons,
this enhancement is not sufficient for the C/EBP-1 region to
function when it is placed downstream of a heterologous promoter unless a bona fide kB site is present. Thus, this model
predicts interactions between C/EBP-b and NF-kB factors in
either the presence or the absence of kB containing DNA.
Previous sequence analysis of the MnSOD 59 flanking sequence identified numerous potential transcription factor
binding sites, including two NF-kB sites, an AP-1 site, and
multiple SP-1 binding sites (20). The experiments presented
here indicated that this region was not sufficient for TNF
responsiveness. This was unexpected due to the presence of
the two 59 kB elements. EMSAs on the two kB elements
showed that these sequences were capable of binding NF-kB in
vitro (data not shown), raising the possibility that while these
sites may still be necessary, they were not sufficient for TNF
induction. This possibility was diminished by IVGF of the 59
region, since the only 59 sites that exhibited protection in vivo
were SP-1 sites and their occupancy was independent of TNF.
Our IVGF analyses of kB element occupancy in response to
TNF for the MCP-1 gene (40) and the E-selectin gene (39a)
clearly show induced occupancy of the kB sites immediately
following TNF treatment. Additionally, deletions of these sites
had no effect on the ability of reporter constructions to respond to TNF if they contain the intronic TNFRE (data not
shown). Thus, the failure of the upstream kB elements to show
induced expression and to become occupied in vivo strongly
suggests that they are not required for TNF induction. Additionally, the AP-1 binding site as well as the putative antioxidant responsive element were unoccupied, suggesting that it is
unlikely that these elements are involved in basal or TNFinduced expression. However, it is possible that they function
in response to other stimuli, such as lipopolysaccharide or UV
irradiation, which were not tested.
The binding of multiple SP-1 proteins to GC boxes is characteristic of the GC-rich class of TATA-less promoters that
includes MnSOD (45). For the MnSOD gene, these GC boxes
were occupied prior to TNF stimulation and may be responsible for the low background levels of MnSOD mRNA that can
be detected by Northern blot analysis (7, 20). Preliminary analysis of these sites suggests that SP-1 can bind in vitro (data not
shown). Because SP-1 functions to recruit TATA binding protein to the transcription initiation site in the absence of a
TATA box, it is likely that these sites are required for both
basal and activated transcription of MnSOD (46). This observation contrasts with a similar analysis of the TATA boxcontaining MCP-1 gene (40). TNF induction of the MCP-1
gene results in the induced occupancy of a promoter-proximal
SP-1 site. This comparison suggests that TNF induction mech-
Downloaded from http://mcb.asm.org/ on February 22, 2013 by PENN STATE UNIV
FIG. 11. The murine and human TNFRE are highly homologous. DNA
sequence comparison is shown with the IVGF protected and hypersensitive sites
indicated.
REGULATION OF MnSOD BY TNF
6980
JONES ET AL.
MOL. CELL. BIOL.
anisms may be different for TATA-containing and TATA-less
genes.
ACKNOWLEDGMENTS
We thank C. P. Moran, D. Reines, and G. G. Churchward for their
comments on the manuscript and Chiron Corp. for its initial supply of
recombinant TNF.
This work was supported by Public Health Service grants CA47953
and CA74271 from the National Cancer Institute.
REFERENCES
Downloaded from http://mcb.asm.org/ on February 22, 2013 by PENN STATE UNIV
1. Aggarwal, B. B., and K. Natarajan. 1996. Tumor necrosis factors: developments during the last decade. Eur. Cytokine Netw. 7:93–124.
2. Akashi, M., M. Hachiya, R. L. Paquette, Y. Osawa, S. Shimizu, and G.
Suzuki. 1995. Irradiation increases manganese superoxide dismutase mRNA
levels in human fibroblasts. J. Biol. Chem. 270:15864–15869.
3. Baldwin, A. S. 1996. The NF-kB and IkB proteins: new discoveries and
insights. Annu. Rev. Immunol. 14:649–681.
4. Beg, A. A., and A. S. Baldwin. 1994. Activation of multiple NF-kB/Rel
DNA-binding complexes by tumor necrosis factor. Oncogene 9:1487–1492.
5. Beg, A. A., T. S. Finco, P. V. Nantermet, and A. S. Baldwin. 1993. Tumor
necrosis factor and interleukin-1 lead to phosphorylation and loss of IkBa: a
mechanism for NF-kB activation. Mol. Cell. Biol. 13:3301–3310.
6. Birkenmeier, E. H., B. Gwynn, S. Howard, J. Jerry, J. I. Gordon, W. H.
Landschulz, and S. L. McKnight. 1989. Tissue-specific expression, developmental regulation, and genetic mapping of the gene encoding CCAAT/
enhancer binding protein. Genes Dev. 3:1146–1156.
7. Boss, J. M., S. M. Laster, and L. R. Gooding. 1991. Sensitivity to tumor
necrosis factor mediated cytolysis is unrelated to manganous superoxide
dismutase mRNA levels among transformed mouse fibroblasts. Immunology
73:309–315.
8. Cao, Z., R. M. Umek, and S. L. McKnight. 1991. Regulated expression of
three C/EBP isoforms during adipose conversion of 3T3-L1 cells. Genes
Dev. 5:1538–1552.
9. Das, K. C., Y. Lewis-Molock, and C. W. White. 1995. Activation of NF-kB
and elevation of MnSOD gene expression by thiol reducing agents in lung
adenocarcinoma (A549) cells. Am. J. Physiol. 269:L588–L602.
10. Das, K. C., Y. Lewis-Molock, and C. W. White. 1995. Thiol modulation of
TNFa and IL-1 induced MnSOD gene expression and activation of NF-kB.
Mol. Cell. Biochem. 148:45–57.
11. Davies, K. J. A. 1994. Oxidative stress: the paradox of aerobic life. Biochem.
Soc. Symp. 61:1–31.
12. Fridovich, I. 1975. Superoxide dismutases. Annu. Rev. Biochem. 44:147–159.
13. Fridovich, I. 1995. Superoxide radical and superoxide dismutases. Annu.
Rev. Biochem. 64:97–112.
14. Gil, G., J. R. Smith, J. L. Goldstein, C. A. Slaughter, K. Orth, M. S. Brown,
and T. F. Osborne. 1988. Multiple genes encode nuclear factor 1-like proteins that bind to the promoter for 3-hydroxy-3-methylglutaryl-coenzyme A
reductase. Proc. Natl. Acad. Sci. USA 85:8963–8967.
15. Gordon, H. M., G. Kucera, R. Salvo, and J. M. Boss. 1992. Tumor necrosis
factor induces genes involved in inflammation, cellular and tissue repair and
metabolism in murine fibroblasts. J. Immunol. 148:4021–4027.
16. Heller, R. A., and M. Kronke. 1994. Tumor necrosis factor receptor-mediated signaling pathways. J. Cell Biol. 126:5–9.
17. Hou, J., V. Baichwal, and Z. Cao. 1994. Regulatory elements and transcription factors controlling basal and cytokine-induced expression of the gene
encoding intracellular adhesion molecule 1. Proc. Natl. Acad. Sci. USA
91:11641–11645.
18. Janssen, Y. M. W., B. Van Houten, P. J. A. Borm, and B. T. Mossman. 1993.
Cell and tissue responses to oxidative damage. Lab. Invest. 69:261–274.
19. John, S., R. B. Reeves, J.-X. Lin, R. Child, J. M. Leiden, C. B. Thompson,
and W. J. Leonard. 1995. Regulation of cell-type-specific interleukin-2 receptor a-chain gene expression: potential role of physical interactions between Elf-1, HMG-I(Y), and NF-kB family proteins. Mol. Cell. Biol. 15:
1786–1796.
20. Jones, P. L., G. Kucera, H. Gordon, and J. M. Boss. 1995. Cloning and
characterization of the murine manganous superoxide dismutase-encoding
gene. Gene 153:155–161.
21. Klampfer, L., T. H. Lee, W. Hsu, J. Vilcek, and S. Chen-Kiang. 1994. NF-IL6
and AP-1 cooperatively modulate the activation of the TSG-6 gene by tumor
necrosis factor alpha and interleukin-1. Mol. Cell. Biol. 14:6561–6569.
22. Kunsch, C., S. M. Ruben, and C. A. Rosen. 1992. Selection of optimal kappa
B/Rel DNA-binding motifs: interaction of both subunits of NF-kappa B with
DNA is required for transcriptional activation. Mol. Cell. Biol. 12:4412–
4421.
23. Laherty, C. D., N. D. Perkins, and V. M. Dixit. 1993. Human T cell leukemia
virus type 1 tax and phorbol 12-myristate 13-acetate induce expression of the
A20 zinc finger protein by distinct mechanisms involving nuclear factor kB. J.
Biol. Chem. 268:5032–5039.
24. Lamers, W. H., R. W. Hanson, and H. M. Meisner. 1982. cAMP stimulates
transcription of the gene for cytosolic phosphoenolpyruvate carboxykinase in
rat nuclei. Proc. Natl. Acad. Sci. USA 79:5137–5141.
25. Lebovitz, R. M., H. Zhang, H. Vogel, J. Cartwright, L. Dionne, N. Lu, S.
Huang, and M. M. Matzuk. 1996. Neurodegeneration, myocardial injury,
and perinatal death in mitochondrial superoxide dismutase-deficient mice.
Proc. Natl. Acad. Sci. USA 93:9782–9787.
26. Lewis-Molock, Y., K. Suzuki, N. Taniguchi, D. H. Nguyen, R. J. Mason, and
C. W. White. 1994. Lung manganese superoxide dismutase increases during
cytokine-mediated protection against pulmonary oxygen toxicity in rats.
Am. J. Respir. Cell Mol. Biol. 10:133–141.
27. Li, Y., T. Huang, E. J. Carlson, S. Melov, P. C. Ursell, J. L. Olson, L. J.
Noble, M. P. Yoshimura, C. Berger, P. H. Chan, D. C. Wallace, and C. J.
Epstein. 1995. Dilated cardiomyopathy and neonatal lethality in mutant mice
lacking manganese superoxide dismutase. Nat. Genet. 11:376–381.
28. Liu, Z.-G., H. Hsu, D. V. Goeddel, and M. Karin. 1996. Dissection of TNF
receptor 1 effector functions: JNK activation is not linked to apoptosis while
NF-kB activation prevents cell death. Cell 87:565–576.
29. McCord, J. M., and I. Fridovich. 1969. Superoxide dismutase. An enzymatic
function for erythrocuprein. J. Biol. Chem. 244:6049–6055.
30. Melendez, J. A., and C. Baglioni. 1993. Differential induction and decay of
manganese superoxide dismutase mRNAs. Free. Radical Biol. Med. 14:601–
608.
31. Mueller, P. R., P. A. Garrity, and B. Wold. 1994. Ligation-mediated PCR for
genomic sequencing and footprinting, p. 15.5. In F. M. Ausubel, R. Brent,
R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.),
Current protocols in molecular biology on CD-ROM. John Wiley & Sons,
Inc., New York, N.Y.
32. Mueller, P. R., and B. Wold. 1989. In vivo footprinting of a muscle specific
enhancer by ligation mediated PCR. Science 246:780–786.
33. Neish, A. S., A. J. Williams, H. J. Palmer, M. Z. Whitley, and T. Collins.
1992. Functional analysis of the human vascular cell adhesion molecule 1
promoter. J. Exp. Med. 176:1583–1593.
34. Nelson, S. K., G. H. W. Wong, and J. M. McCord. 1995. Leukemia inhibitory
factor and tumor necrosis factor induce manganese superoxide dismutase
and protect rabbit hearts from reperfusion injury. J. Mol. Cell. Cardiol.
27:223–229.
35. Nogae, C., N. Makino, T. Hata, I. Nogae, S. Takahashi, K.-I. Suzuki, N.
Taniguchi, and T. Yanaga. 1995. Interleukin 1a-induced expression of manganous superoxide dismutase reduces myocardial reperfusion injury in the
rat. J. Mol. Cell. Cardiol. 27:2091–2099.
36. Opipari, A. W., M. S. Boguski, and V. M. Dixit. 1990. The A20 cDNA
induced by tumor necrosis factor alpha encodes a novel type of zinc finger
protein. J. Biol. Chem. 265:14705–14708.
37. Osborn, L., C. Hession, R. Tizard, C. Vassallo, S. Luhowskyj, G. Chi Rosso,
and R. Lobb. 1989. Direct expression cloning of vascular cell adhesion
molecule 1, a cytokine-induced endothelial protein that binds to lymphocytes. Cell 59:1203–1211.
38. Osborn, L., S. Kunkel, and G. J. Nabel. 1989. Tumor necrosis factor alpha
and interleukin 1 stimulate the human immunodeficiency virus enhancer by
activation of the nuclear factor kappa B. Proc. Natl. Acad. Sci. USA 86:
2336–2340.
39. Pazin, M. J., P. L. Sheridan, K. Cannon, Z. Cao, J. G. Keck, J. T. Kadonaga,
and K. A. Jones. 1996. NF-kB-mediated chromatin reconfiguration and
transcriptional activation of the HIV-1 enhancer in vitro. Genes Dev. 10:37–
49.
39a.Ping, D. Unpublished data.
40. Ping, D., P. L. Jones, and J. M. Boss. 1996. TNF regulates the in vivo
occupancy of both distal and proximal regulatory regions of the murine
monocyte chemoattractant protein-1 (MCP-1/JE) gene. Immunity 4:455–
569.
41. Radeke, H. H., B. Meier, N. Topley, J. Floge, G. G. Habermehl, and K.
Resch. 1990. Interleukin 1-a and tumor necrosis factor-a induce oxygen
radical production in mesangial cells. Kidney Int. 37:767–775.
42. Sanceau, J., T. Kaisho, T. Hirano, and J. Wietzerbin. 1995. Triggering of the
human interleukin-6 gene by interferon-g and tumor necrosis factor-a in
monocytic cells involves cooperation between interferon regulatory factor-1,
NF-kB, and Sp1 transcription factors. J. Biol. Chem. 270:27920–27931.
43. Sato, M., M. Sasaki, and H. Hojo. 1995. Antioxidative roles of metallothionein and manganese superoxide dismutase induced by tumor necrosis factor-a and interleukin-6. Arch. Biochem. Biophys. 316:738–744.
44. Schindler, U., and V. R. Baichwal. 1994. Three NF-kB binding sites in the
human E-selectin gene required for maximal tumor necrosis factor alphainduced expression. Mol. Cell. Biol. 14:5820–5831.
45. Smale, S. T., and D. Baltimore. 1989. The “initiator” as a transcription
control element. Cell 57:103–113.
46. Smale, S. T., M. C. Schmidt, A. J. Berk, and D. Baltimore. 1990. Transcriptional activation by Sp1 as directed through TATA or initiator: specific
requirement for mammalian transcription factor IID. Proc. Natl. Acad. Sci.
USA 87:4509–4513.
47. Stein, B., P. C. Cogswell, and A. S. Baldwin. 1993. Functional and physical
associations between NF-kB and C/EBP family members: a Rel domain-
VOL. 17, 1997
bZip interaction. Mol. Cell. Biol. 13:3964–3974.
48. Van Antwerp, D. J., S. J. Martin, T. Kafri, D. R. Green, and I. M. Verma. 1996.
Suppression of TNF-a-induced apoptosis by NF-kB. Science 274:787–789.
49. Visner, G. A., W. C. Dougall, J. M. Wilson, I. A. Burr, and H. S. Nick. 1990.
Regulation of manganese superoxide dismutase by lipopolysaccharide, interleukin-1, and tumor necrosis factor. Role in the acute inflammatory response. J. Biol. Chem. 265:2856–2864.
50. Weisiger, R. A., and I. Fridovich. 1973. Mitochondrial superoxide dismutase.
Site of synthesis and intramitochondrial localization. J. Biol. Chem. 248:
4793–4796.
REGULATION OF MnSOD BY TNF
6981
51. Weisiger, R. A., and I. Fridovich. 1973. Superoxide dismutase. J. Biol. Chem.
248:3582–3592.
52. Wong, G. H., J. H. Elwell, L. W. Oberley, and D. V. Goeddel. 1989. Manganous superoxide dismutase is essential for cellular resistance to cytotoxicity
of tumor necrosis factor. Cell 58:923–931.
53. Wong, G. H., and D. V. Goeddel. 1988. Induction of manganous superoxide
dismutase by tumor necrosis factor: possible protective mechanism. Science
242:941–944.
54. Wong, G. H. W. 1995. Protective roles of cytokines against radiation: induction of mitochondrial MnSOD. Biochim. Biophys. Acta 1271:205–209.
Downloaded from http://mcb.asm.org/ on February 22, 2013 by PENN STATE UNIV