Mol. Cells, Vol. 8, No. 2, pp. 2 19-225 Molecules and Cells © Springer-Verlag 1998 Sequence Analysis and Expression of Met-rich Storage Protein SP-1 of Hyphantria cunea Cheon Hyang Mi, Hwang In Hwan; Chung Duck Hwa,2 and Seo Sook Jae* Department of Biology, College of Natural Sciences, Gyeongsang National Uni versity, Chinju 660- 701, Korea; I Plant Molecular Biology and Biotechnology Research Center, Gyeongsang National Uni versity, Chinju 660-701 , Korea; 2 Department of Food Science and Technology, Gyeongsang National University, Chinju 660-701, Korea. (Received on December 8, 1997) We isolated and se quenced a cDNA clone corresponding to the 2.5 kb storage protein (SP-I) from fall webworm, Hyphantria cunea. The SP-I gene encoded a pre-protein of 753 amino acids, including a signal peptide of 15 amino acids. The deduced amino acid sequence of SP-I contained one potential Nglycosylation site, and the calculated isoelectric point and molecula r weight of secreted SP-I were pI = 8.38 and 86.8 kDa, respectively. A Northern blot of mRNA from various developmental stages revealed that the SP-I mRNA in fat body appears in early last instar larvae and accumulates to a maximum level at the end of last instar larvae. The persistence of SP-I transcript through the early pupal stage suggests that its mRNA might be stable or expressed during the pupal stage. SP-I transcription was also found in the ovary as well as testis. This local expression of SP-I in both reproductive organs seems to allow the insect to keep its reproductive activity under a nutritional stress. Keywords: Hyphantria cunea; Met-rich Storage Protein ; Ovary; Storage Protein. Introduction Storage proteins are considered to be major components in the hemolymph of immature stages of insects and have been identified in a wide range of species, both hemimetabolous and holometabolous (Kanost et ai., 1990; Telfer and Kunkel, 1991). They are synthesized primarily in the larval fat body and are abundant in the hemolymph, particularly during the * To whom correspondence should be addressed. Tel: 82-591-751-5951 ; Fax: 82-591-54-0086 E-mail:sookjae@ gshp.gsnu.ac.kr feeding phase of the last larval stadium (Levenbook, 1985). Some are taken up by the fat body during the wandering and prepupal stages and deposited as protein granules (Locke and Collins, 1968; Miller and Silhacek, 1982; Sakurai et ai. , 1988a). Synthesis, release into the hemolymph , uptake by the fat body, and subsequent utilization of the storage protein appear to be under precise developmental regulation. These proteins have molecular masses of about 500 kDa and are hexamers composed of approximately 72-80 kDa subunits, which mayor may not be identical. These molecules function as a storage reservoir or amino acids used to support the intense biosynthetic activity that underlies metamorphosis (Levenbook and Bauer, 1984). The two main classes of storage proteins are (a) arylphorin which is a designation for proteins with tyrosine and phenylalanine contents totalling more than 15% and which can be incorporated into cuticles , and (b) methionine-rich storage proteins which exceed 4% of the methionine contents that are predominantly expressed in females (Telfer and Kunkel, 1991). The storage proteins represent important model proteins because their ge nes are highly expressed and are developmentally regulated. In order to investigate gene regulation, it is necessary to know the sequence of the genes and mRNAs which code for the proteins. The cDNA and gene structure for the methionine-rich storage protein from B. mori have been reported (Leven book and Bauer, 1984; Sakurai et ai. , 1988b). The cDNAs of two basic j uvenile hormone suppressible proteins (BJHSPs) from T ni were reported (Jones et ai., 1993). The genes for the three arylphorin subunits from D. melanogaster (Dalaney Abbreviation s: B. mori, Bombyx mori ; D. melanogaster, Drosophila melanogaster; H. cunea, Hyphantria cunea; M. sexta , Manduca sexta ; SP-l , storage protein-l ; T. ni, Trichoplusia ni. 220 Storage Protein-l Gene in Hyphantria cunea et al., 1986 ; Lepesant et al., 1986; Srrtith et al. , 1981) and for the arylphorin from M. sexta (Willott et al., 1989) have been cloned and its sequence data reported. However, to date, the sequence for H. cunea storage protein has not been reported. Two forms of storage proteins termed SP-l and SP-2 accumulate in the larval hemolymph of the fall webworm, Hyphantria cunea (Kim et al., 1989). Both storage proteins are hexamers and phosphorylated glycolipoproteins. They show sirrtilar quantitative changes during development in males and females ; however, SP-I is more abundant (Kim et al., 1989). In this paper, we report the complete cDNA sequence for the storage protein-l (SP-I) subunit from H. cunea. In addition, we report that SP-l shows a remarkable degree of sequence homology to the juvenile hormone suppressible protein from T ni, as well as the female specific storaoe " b protem from B. mOrL. Materials and Methods Animals Fall webworms, H. cunea, were reared on artifi cial diet at 27°C and rel ative humidity of 75 % with a photoperiod of 16 L:8 D. Isolation of nucleic acids Total RNA was isolated from ti ssues by lysis buffer, spin column, and wash buffer according to the protoco l reco mm ended by the manufacturer (Qi age n In c . Chatsworth, USA). From total RNA, poly(A/ RNA was prepared by oli gotex suspen sion and sp in columns according to the protocol reco mm ended by th e manufac turer (Qi age n In c . Chatsworth, USA) . All RNA samples contained intact rRNA and were free of contaminating DNA as evaluated in agarose gels. Primer sy nthesi s, PCR, and s ubcloning of PCR products Oligo nucleotide primers were synthesized by Korea Bioneer Inc. The 20 mer and 17 mer oligonucleotide degenerated prim e rs were sy nthesized for th e amino acid sequ ences YYKDDTY (17-23 amino acids) and NQFINT (84-89 amino acids), respec tive ly: Primer I (2 0 mer ) 5'GTNGTNAARGAYGAYAAYTA-3' , Primer 2 ( 17 mer) 5 ' GTRTTDATRAAYTGRTT-3' . Using 5 ~g of poly(A / RNA prepared fro m larval fat bodies, the first strand of cDNA was synthesized with AMY reverse transcriptase and the degenerated primers as a template for PCR. The PCR cycles were as follows; 3 min at 94°C; 40 cycles of 30 s at 94°C I I min at 40°C I I min at n oc; 3 min at n °e. The amplified DNA fragment was used as the template in the second PCR, which was performed with Taq DNA polymerase and the same degenerated primers. The resulting PCR products were separated on a 1% agarose gel, and a 0.2 kb fragment was obtained. This fragment was excised from the agarose gel , purified, ligated into a T-vector, and amplified in XLI Blue competent cells. Screening of the cDNA library The cDNA library of H. cunea was kindly provided by Dr. Ho-Yong Park (Genetic Engineering Research Institute, KIST, Korea). For screening, 50,000 plaques were plated on l5 cm diameter agar plates. Nitrocellulose filters (Schleicher & Schuell Dassel Germany) were taken from the plates and hybridi zed' at hicrh . 0 stnngency (65°C and 0.1 X SSC) with the radioactive-l abelled PCR product. The positi ve clones were rescreened at low density on 9 cm diameter agar plates. Colony hybridization yielded 5 po sitiv e clones from the library. Po sitiv e pl aqu es were indi vidually isolated in phage buffer by the plate lysate method followed by lambda DNA extraction (Sambrook et aL. , 1989). The insert of the positive clone was subcloned into an EcoRl site of pBluescript KS (+). Subcloning and DNA sequencing Suitable cDNA fraoments which hybridi zed with the radioactive-labelled PCR ;'oduct: were removed from the gels by electroelution , followed by phenol extraction and ethanol precipitation in the presence of 2 ~g glycogen. Subsequently, these DNA fragments were ligated into pBluescript KS (+), followed by electroporation into JMI09 cells (Sambrook et ai., 1989). The sequencing reaction was based on the dideoxynucleotide chain termination method of Sanger et al. (1977) and was carried out according to the thermal cycle DNA sequencing protocol with DNA pol ymerase from Thermus thermophilus HB7 (Korea Bioneer Inc.). Template-specific and uni versal primers derived from pBluescript were used in the sequence reactions in the presence of ex-35S-labelled dATP. Subclones for sequencing were prepa red by ligatin g suitable re striction fragments into pBluescript followed by transform ation into JML09 cell s. Computer-assisted analysis of sequence data The EMBL DataBank was searched with FASTA and BLAST. Editing and analysis of the DNA sequence data were performed with the DNASIS (Hitachi Software Engineering Co. , Hitachi , Japan). Northern blotting Ten microgram of total RNA from fat body and other tissues were denatured and subjected to electrophoresis in a 1.2% agarose gel containing 2.2 M formaldehyde. Following eletrophoresis, gels were rinsed in LO X SSC and transferred to nitrocellulose (Schleicher & Schuell, Dassel, Germany) in lO x SSe. Blots were prehybridized with 1.5 X SSPE, 7% SDS, 10% PEG, 0.1 mglml sonicated denatured salmon sperm DNA and 0.25 mgl ml BSA for 4 h at 65 0e. Hybridization was performed for 18 h at 65°C in the prehybridization buffer with 5 X 105 cpml mI of 32P-Iabelled probes, prepared according to the method of random priming (Feinberg and Yolgelstein, 1983). The filter was then washed twice with I X SSC, 0.1 % SDS at 65°C for 15 min, and subsequently two more times for 15 min with 0.1 X SSC, 0.1% SDS at 65°C before exposure to X-ray fi lm at -70°C. Results and Discussion In the present study, the mRNA sequence coding for the major storage protein of H. cunea, fall web worm, was molecularly cloned and its nucleotide sequence was deterrrtined. This is the first complete arrtino acid sequence of a storage hexamer from Hyphantria. The cDNA library from fall webworm mRNA was . h a 32P-Iabelled probe of 216 bp peR product screened WIt Cheon Hyang Mi et at. which are complementary from 17 to 89 of the amino acid sequence. From a total of 50,000 screened plaques, five positive plaques were isolated. They were checked for insert lengths after plasmid isolation by digestion with EcoRI and XhoI. One insert was 2.5 kb showing two fragments of 2.3 and 0.2 kb, which was expected from the presence of the EcoRI site in the SP-I cDNA . The transcript (2.5 kb) was of sufficient size to code for the polypeptide subunit of SP-I - the major Hyphantria hexamerin (Kim et aI., 1989) . The fragments were subcloned into pBluescript SK and sequenced. Figure I shows a restriction map of a 2.5 kb EcoRIXhoI fragment and the strategy used to sequence the SP-I cDNA. DNA sequence data and the deduced amino acid sequence for the SP-I are presented in Fig. 2. Sequence analysis of SP-I revealed a 2259 bp open reading frame and the 753 amino acids. The 753 amino acids encoded by the open reading frame contained a typical signal peptide and one N-glycosylation site (NXT/S) , which should provide the accepting site of sugar (Fig. 2, dotted line). We identified the presence of carbohydrate in Hyphantria SP1 with PAS staining (data not shown). The result of the Nterminal primary structure of SP-I clearly showed the presence of a signal sequence for secretion in the nascent SP-I. The N-terminus of SP-I was preceded by a sequence encoding 15 amino acids , typical for a signal peptide. Hence, a putative signal peptide cleavage site was assigned between Ala 1s and Ser l6 as indicated in Fig. 2. In the deduced amino acid sequence of SP-l , the positively charged amino terminus (Met-Lys) was followed by 13 amino acids , most of which were hydrophobic, with a single serine residue following the hydrophobic domain . Analogous structures have been found for many secretory proteins (Pearlman and Halvorson, 1983). Signal peptides of other insect storage hexamers vary between 15 and 18 amino acids (Fujii et al., 1989; Jones et aI., 1990; Levenbook and Bauer, 1984; Memmel et aI. , 1992; 1994; Willott et aI., 1989). The calculated isoelectric point and molecular weight of the secreted SP-I were pI = 8.38 and 86.8 kDa, respectively. One translational stop codon TAA was located at +2260. A single polyadenylation signal site (AATAAA) was present at 35 bp from the stop codon. The derived sequence of SP-l was used to search the EMBL Data Bank using FASTA and BLAST for sequence similarities. Multiple sequence alignment was carried out EI T3 I Sc EV P P I SI EV I I EI ... X T7 Fig. 1. Restriction map and sequencing strategy of the SP-l eDNA. The direction and extent of sequencing are shown by arrows. EI, EcoRI; Sc, Sad; EV, EcoRV; P, PstI ; S1, Sail ; X, XhoI. 221 with amino acid sequences of SP-l and six other storage hexamers, which were found to have extensive homology to SP-l from H. cunea. The result of the amino acid alignment is illustrated in Fig. 3. Based on common positions in amino acid sequence alignments, the SP-I exhibits a more closely related identity with T ni BJHSPI compared to other storage proteins (Figs. 3 and 4). Amino acid identities between SP1 of H. cunea and BJHSPI of T ni and SPI of B. mori were 66.3% and 64.4%, respectively. Between SP-l and arylphorin from M . sexta, the amino acid identity showed a very low value of 12.6% (Fig. 4). Its relatively high content of methionine (6%) and low content of aromatic amino acid residues (Tyr+ Phe 8.5%) correlated with its high homology to the Met-rich storage proteins from T ni (Jones et aI. , 1993) and B. mori (Sakurai et aI., 1988a) (Table 1, Fig. 3). Generally, Met-rich storage protein is known to exhibit sexual dimorphism ; in some species, only traces of it occur in males (Telfer and Kunkel, 1991). On a structural basis, Hyphantria hexamerin SP-I meets the criteria of a Met-rich storage protein, but it is not sexspecifically accumulated as are Met-rich storage proteins in other species. Changes in the amount of SP-I mRNA in fat body during the development of H. cunea was studied by means of RNA blot hybridization. Fat bodies were dissected from staged insects. RNA was extracted from each fat body preparation and electrophoresed under denaturing conditions. SP-l transcripts appeared in small amounts in the early 7th instar larvae, and then increased to a maximum level in the late 7th instar larvae. The levels gradually declined and remained low throughout the middle pupal development (Fig. 5A). A weak hybridization signal in the lower part of the membrane was found in RNA from almost all the staged fat bodies. It seemed to be a part of the smeared band of 2.5 kb SP-l RNA. The longer persistence of SP-I mRNA during the pupal stage may be due to a reduced level of expression or a greater stability of this mRNA. It is noteworthy that a small but significant amount of RNA complementary to the SP-l cDNA sequence was detectable at the early pupal stage in B. mori (Izumi et aI. , 1988). Although significant overlap occurred in the fifth larval instar, the pHV-I transcript coding for the 82 kDa storage protein persisted into early pupal development, while pHV-2 RNA coding arylphorin appeared in fourth instar larvae and abruptly disappeared at the cessation of feeding in the final instar larvae of Heliothis virescens (Leclerc and Miller, 1990). Juvenile hormone (JH)-suppressible hexamerins, synthesized only during the last instar, usually persist in the hemolymph well into the pupal stage of development and thus do not exhibit the typical storage protein profile (Jones et aI., 1990; Leclerc and Miller, 1990; Ray et aI., 1987a, 1987b). In H. cunea, the lack of complete clearance of SP-I in the pupal hemolymph may be related to the persistence of its Storage Protein-I Gene in Hyphantria cunea 222 CCT TGG ACA CGC CGC ATT CTT GAC AAC ACC GAA GAA ATC AGT GGA 1800 ATG AGG GTC CIT GTG GTA GTA GeT GeT CTT Gee CTG GCT TCG Gee" 45 M R V L V V V A A L A LAS A AGe GTG GTe AAA GAT GAC Ace TAC TCT AGe Ace GTe ATe GGC AGA y s y P K P T X s § T V G B GAA TCC ATG GTT Me GTG GAC GTe AAG Ace AAG GAG GTC TCC ATe E M V N V D V K T K E LSI CTT AAG TTA CTG Me CAe ATT TTG CAG CCA Ace ATG TAC GAT GAT L K L L N H L Q P Y M Y 0 0 ATT eGG GAG ATe Gee AGG GAG TGG Gee ATe GAA GAG Me AAG GAC IRE I ARE W A U E E B J D AAA TAT CIG AAA ACT GAT ATe GTA AAT CAG TTT ATe AAT Ace TTC K Y L K T 0 V N Q FIN T F AAG ATG GGT ATG CIT eCG eGG GGT GAA GTG TTC GTC CAC AGe Me K M G M L P R G E V F V H N Me TTG CAe ATT GAC CAG GCG GTT AAG GTG TTC AGG ATT CTT TAC N L HID Q A V K V F R L Y TTT GeT AAG GAC TTT GAT GTA TTC ATT AGG ACT TGC TGT TGG CTA F A K 0 F 0 V FIR Tee W L AGG GAG eGC ATe AAe GGe GGC ATG TTC GTG TAT Gee CTT ACT GCA R E R I N G G M F V Y A L T A GeT GTG TTT CAC AGG AAC GAC TGC AGA GGA ATT ATT CTT CCT GCC A V F H R N 0 C R G L P A CCC TAC GAG ATC TAC cce TAT TTC TTT GTC GAC AGC MC ATA ATC P Y ElY P Y F F VON I I CAA - AAG GCC CTC ATG ATG AAA ATG ACC AGA GCC GCA ACT GAT CCA Q K A L M M K M GTC ATC ATG GAC TAC TAT GGT ATC V M 0 Y Y G T R A A T K P AAA GTG ACC GAC AAG AAT CTG K V T 0 K N L ATT GTA ATT GAC TGG CGC AAG GGA GTC CGT CGC ACC TTG ACT GAA I V lOW R K G V R R T L T E AAT GAC CGA ATT GGG TAC TTC ACT GAG GAC GTC GAT CTC AAT ACA NOR I G Y F TED VOL N T TAT ATG TAT TAC CTG CAC ATG AGC TAT CCA TTC TGG ATG ACT GAT Y M Y Y L H M S Y P F W M T 0 GAT ATT TAT AAC TTG MC AAG GAG eGA CGT GGT GAA ATC TTG TCT o Y N L N K ERR G E L TGC GCT AAT ACG CAG CTG TTA GCT AGG TAT AGG CTG GAA CGC CTT T CAN Q L L A R Y R L E R L 15 90 30 135 45 180 60 225 75 270 90 315 105 360 120 405 135 450 150 495 165 540 180 585 195 630 210 675 225 720 240 765 255 810 270 855 285 ACT CAT GAA ATG TGe GAC ATC AAG ACC ATT ATG TGG CAT GAG CCT 900 K 300 THE M C 0 T M W H E P TTG AGG ACC GGT TAT TGG CCC AAA ATe ATT CTT CAC AAT GGA GAA L R T G Y W P L K H N G E CAC ATG CCT GTG CGC AGC AAC AAT ATG GTG GTG CTT ACC GAC ATG H M P V R S N N M V V L TOM V K L K R Q L 0 0 V E R M 315 990 330 0 M G T G K ERR 0 G T 360 GTA ATC AGT CTA AGA AAA CCT GAA GAT GTT GAA AAC CTG GCT AGA 1125 V I S L R K P E 0 V E N L A R 375 CTG CTA CTT GGT GGT ATG CAG TTA GTT AAT GAT GAT GCT AAG ACT 1170 L L L G G M Q L V NOD A K T 390 ATC CAC ATA ATG CAC CTG ATG AGG AAG ATG CTA ACT TAC AAT ACA 1215 M H H L M R K M L T Y N T 405 TAT AAC ACT GAC AAG TAT ACC TAC GTA CCT ACT GCT CTG GAT ATG 1260 Y N T 0 K Y T Y- V PTA L 0 M 420 TAT ACC ACT TGT CTG CGT GAT CCT GTT TTC TGG CAG CTG ATA AAA. 1305 Y T T C L R 0 P V F W Q K L 435 CGC GTC ACA AAC ACC GTT CAA ACT TTC AAG AAT ATG CTT CCT AAG 1350 R v TNT V Q T F K N M L P K 450 TAT ACT CGC GAT GAA eTC GAC TTC CCT GGT GTC AAG ATC GAC AAG 1395 ~ T ROE L 0 F P G V o K K 465 ATC TCT ACC GAC AAA CTC GTC ACT TTT ATG GAT GAA TAT GAC ATG 1440 s T 0 K L V T F MOE YOM 480 GAC ATC ACC AAT GCT GTA TAC eTC GAT GAG ACT GAG ATA AAA AAG 1485 o T N A V Y L 0 E T E K K 495 AAG CGC TCC GAT CTG ACA TTC GTG GCC CGC ACT CGA CGT CTG AAe 1530 K R SOL T F V ART R R L N 510 CAT CAT cce TTC AAG GTG GCT ATC GAT GTT ACA TCT GAC AAA. TCA 1575 H H P F K V A I 0 V T SDK S 525 GTT GAC GCT GTT GTC CGT ATT TTT ATC GGT CCT AAG TAC GAC TGT 1620 V 0 A V V R F G P KYO T R R LON TEE S G 600 T T F K N V 0 lEW W Y K 615 T CGC ATC GGA TTC CCA CAC AGG CTT CTC CTG CCC CTA GGT CGT AAG 1890 RIG F P H R L L L P L G R K 630 GGA GGT TTG CCT ATG CAG ATG TTC GCC ATC GTC ACC CCA ATA AAG 1935 G G L P M Q MFA I V T P I K 645 ACC GGC GCG ATC CTA CCG AAC ATT GAC GTG AGC ATA ATG AAG GAA 1980 T G A I LPN I 0 V S I M K E 660 CGT AAA ATG TGT CGC TTC AGC GTG TGC TTC GAC ACA ATG CCG CTC 2025 R K M C R F S V C F 0 T M P L 675 GGC TTT CCC TTC GAC AGA AGA ATA GAT ACT TCG GAA TTC TTT ACT 2070 G F P FOR RID T S E F F T 690 AAG AAC ATG AAA TTC TAT GAC ATT GCG ATT TAC AGG ATT GAT ATG 2115 K N M K F Y 0 I A I Y ROM 705 GAC ACG GCC AAC ATT AGC AAG GAC ATC GAC ATG TCG GAC ATG GTG 2160 o T A Jj _ L _li.. K 0 . 10M S 0 M v 720 ATG AAG GAG GAC GAC CTT ACG TAC CTG CAC CAG GAT AAG CTG GTG 2205 M K Q DOL T Y L H Q 0 K L v 735 AAA GAT GTG ATG ATG TCA AGC GCA GAC AAC ATT 2250 AGA TGG TCG TAC R W Y K 0 V M M S SAD N 750 ATG AGG ATG TAA CTATAAATGTATTAAGATTATCTGACAATTAATT~TAG 2305 M R M 754 2337 CATCTACAlt,lo.AAA:a.AAa.JU,AAA.a.aA.a.aAa.AA.all,a~ Fig. 2. cDNA and protein sequence of Hyphantria cunea SP-I. The sequence is numbered relative to the transcription start site and amino acid residues are denoted by the standard single letters underneath the nucleotide sequence. Underlined amino acids (a. a. 16-35) were confIrmed by N-terminal amino acid sequence analysis of SP-I. The vertical arrow represents the signal peptide cleavage site. An asterisk marks the translation stop codon and the overlined AATAAA shows the polyadenylation signa\. The dotted line indicates the potential N-glycosylation site. Table 1. Amino acid composition of SP-I from H. cunea. Residue Number Mature protein Ala Arg AsniAsp Cys GlnlGlu Gly His 25 53 104 9 47 29 16 62 60 52 44 31 25 30 55 II 33 52 738 86809.16 3.98 7.17 13.80 a Experimental b 345 CGT GAC GGC ATC ATG ACC GGC AAG ATA GAA CGT CGT GAT GGA ACT 1080 R W 945 AAT GTT AAG CTT AAG CGT CAG TTG GAT GAC GTT GAG AGA ATG ATC 1035 N P ACT ACA TTT AAG AAC GTA GAT ATC GAA AGe TGG TGG TAC AAG ACT 1845 C 540 LIe Leu Lys Met Phe Pro Ser Thr Trp Tyr Val Total Mr 2.22 8.76 13 .85 1.19 1.19 6.23 3.85 2.12 8.23 8.36 6.90 5.97 4.11 3.32 4 .11 7.30 1.46 4.38 7.43 7.82 2.46 3.64 7.91 8.56 8.38 4.57 5.31 2.88 3.29 6.17 6.88 6.11 ATG GGC CTT CTT GTA TCA GTC AAT GAC AAA CGC CTe GAC ATG GTA 1665 M G L L V S V N 0 K R L 0 M V 555 GAG ATT GAT TCC TTC AGT TAC AAG CTG GAT ACT GGC AAG AAT TCT 1710 E IDS F S Y K LOT G K N S 570 ATC GTG CGT AAC TCT CAG GAA ATG CAT GGT ATC ATT GAG CAG AGG 1755 V R N Q E M H G E Q R 585 a Based on the deduced amino acid sequence minus the signal peptide. b From purifIed SP-I . Cheon Hyang Mi et ai. HCSPI BlHSPI IlMSI'I HR-VLN\.vAA lAlASASVVK DOI"iSS'IVlG RESKVNVDVK "ntELSIU:lL /'IR- VLVLVAS LGL-RGSVVK OOl'--'1WIG KIJ>lMInMDIK Km.CIUaL MR-VLVILAC I..AMSAS.\IS QT-YGn1VFT KEPKVNUJ« KKFl.CIMKlL MRAVlLEVVS u.Al.RM---- ----ARP£ro HKSVLIU\GL VAWtLSSAVP XPS - --TtXS HK'TVVI£ML w.iAlSSAVP PPKYQHKYKT ~ILAGL ~ V- --1QtSFKV OTn.VDoIDIK !CNIIDo\VFYDt SPVI».IfVEX I<DVtIAAfVER """" NKIl.QPlM'iD D~ I~ NHllOPlM'iD DIJU.v.\RElo/V [J(ll.QP'IY.FE DIKEIAKEYN IEEN1llKYU{ 'TDIVNOFIm' fJOCMLl'RGE 'lUJVlOO"IDr f'KIoD«.PRGE ~ VLWKOFMEM 'LlG(;MLPRGE "'~P2 NHVVEPIJm{ ILEEI..GIOO'l( nDm:lFllt 'n7ILI'J)f'DCM RK\IGFLPI;I:GE ''''''' MSARlI Q[7.JSQUmX) E't'fKlGJa:nD ~ IO\AIJI:£FLKH YRl'GFMPKNL ()I7Vt:Q'.'NPtI E'f'tKIGKE'iN ~SN KKAVEEfLOL ~r HCSPI BJlISPI 8MSPI M ISP2 BMSP2 MSAAA MSAIW VFVHSNNLKI ~VXVF1UL YPAKIFI7ffl VF'VH'INEU\L FJJj\VlM"KIM 'tSMJ:l'tM'l 'I'FVIf'INEI..O fD-VKVFRVL ~ ll"'lUf'JmIOL nvvIM!"HHL Y'OoXIFITFV Ef'SVFYtICMR IFAlALUXP YY.UIFEl'F'f EFSIf'YDtMR £EUALF!U' ~ EFSPFYII'tUt IEAIGVFHIF Y'O.KIEf1f'fY """'" ' MSI'> MSARA MSARB sntsPI "''''' MSARA ~ EYYKIGJaM) QROLVIUaL 50 (!KK-- ILSFF QKX--VPSlE QKK- - VUll.F 100 VF...I.NDN'tSN KJ<VVEDfl...LL YRTGF'MPI<GF R'l'CCWLRERI ~T Rl'ACWLREIU NGGHfVfALT ~ ~ K'TA(.'WoI!U.'t'L NIG1fVYALT KSACPARVHL ~FL,{AFY KT~ NEQiFL'OWY 223 MSARA MSARB 56.3 % BMSP2 HCSPl BJHSPl BMSPl BJHSP2 14.9% 66.3 % 28.5 % KSAAWMVYL NIDQFLYAVY GIILPAP'I'EI YPYFfVDSNl l~ Cl'It.PAP'tEI YPYVFVDSHl INM.fIMOrI' GLYLPAPYEl \'P'lFfVDSHV I SKAf1+OOfJ' GIILPPPrEI YPYVFVRAIN IQKArt.ua« IAV'IQRPDCH GfWPAP'tEV ~ t.QJCn'VI1(HQ UVIQRHD1N GLVLPAP'fEV ~ LF1M:IUKIf;) MVFHRNOCR IoC'VFHRItX:R .v.cFHR'ltXlC. VO\.VRHRE£lCK IAVl~ ~~!'?"!'ANlNJ' ~ RM'l'OP'JIM) KMRDPVHlD KAAXDPVLWK KGLU:UCl.a) 200 1G..mPF.AM L'Cf'UOO:LM, Fig. 4. Dendogram of sequence relationships of storage proteins from various Lepidoptera. Percentages refer to identity. The dendogram is based on the alignment shown in Fig. 3. r:s:NIISM1J\A ~ ~ RRT-L~ I~ NI'YMYYUIKS YYClJCVIU(N LWIDoIRl(GV RRT- L'l'nDt IS'tF'IEDIlX.o YYGI'lVI.tQIl L~ RRS-I.StNCN MS'fFHEDIlL FYGIlOC'l'tfCD VPI:nEN¥D ~ LRYFImIa. ~I-KKaW YPV"t1OOffSN AVL~ LT'iF'IEDlQi YYQi-YiIElm N'fIIF'{}N{SN ~ IA'lFYEDIGL m'YMYYUDtS tlI'YK'fYLKIoti N'IYYFYFHVD w.rtYYFHSH NS'tYYYFHMH ~I-VKE!<N Y'N'f'(AN'lSN SL~ ~IGL ~ MSARB YPl"'rMlmIY NJ.NKElUlGBl t...SCAm"QLlA RYIUBUll'1iE I«::DIKTIK-.'H ~ 'I\'NKERRG£I KO-'IYn;;U.A P.lJUBU.SHE IC)IKSDW< ~ GDiKEJUIGEI ~ RKRLER1.SHK ~ ~ InOOIRRFEL TYlMYOOIlA R'llUJU.SN:> ~ t.f>PtMJ'SEK'/ ~ YFYFY(.lQU.A RYYFERlJINJ LGKIPD'l>Wi I.PfWtHSEXY GPf'KElUCEI YYYFYQQ[.IA RYYt.ER.LIlN:J LGEI~ t..PfW,fiSERY GIUJ<SRRGEI YYYP"iOQl.l9. RYYFJ::R.I..SN: LGDI PfFSWY 'ICSI" EPLR'iGYWPK l~ \IRSNt>...~T ~L toJERKlRIX> EPLK'IGYWPK IlU.Hl'GDEHP Vl'ISNNKIIVT k1NVY.VJ<RHL tDIERKLROO HCSP' 1lIHSP' '''''''' "'"'" ........ BMSP2 "'''''' ""'" """'" BMSP2 ........ ... .. . . ., ... ~lJoISS'tYYPFA~~~ prrGKlDUID G'iVI.SLIU<PE ~ Ga<lL~ KTnt - - - -n-. I LTG!ttDlRO GTIINLKJ(AE WDiLAALLL GG«iL~ Ki'HH - - --i+I '''''''' 'MSI'> MSARA """" HCSPI BJl"'" '''''''' "'15P2 ~ ILTGKIUUU) G'IVIsuotSE Dll'NLARLVL GGLE~ KVrH---- LT llXGPIEl - N Q'lUD.'J'Kl1) DreIUiKLIF ' GIUI»(V'(LD( 'n.NDSYRYLL ======, LQJ<J:I{F'FAFC -QI(ID'llDPK AlNfVGN'iWl ao.DLYGEEV nmYQRSY£\I 1 HtMKRLLS':'N 1.I'{NFDC'(T'{V P'l'AULYS'TC LROl"If'WRLH KRV'ID1'PFLF Nl.HKXI".I.SYG~P'l"SUMY'ITCLRD~I<:RVOttF"JVF ~ 'I'FliSIE\'FW PSIlLQYQJ''' LRDPVf"YKI.O XlUDLVHLF - f'ARRVl.GAA ~ PSAHtI'YQTS LRDPAFYQLY NRIVEYrvEF' - NAJUM.GAA l'!CP'mKYSFl PSAlLFtQTS LRDPVFYQLY IlUINYINEF '!eSP' JQflL.PKY'mD ELDFF'GVXUl IO\KLPKY'I'RE I:f"Ilf'PCVKIE KMiLPKYTRE: OfSFPCVK\IE. KUU.PS'I'ntE DLYFFCVKID KQYUIPYTOD KLYFtXMaT lCQ't1.QP'tlO< r:utFVGVKIS ""'" ~P2 ........ ~ MSARB HCSP' "'''''' ""'" """'" ........ BMSP2 MSARB BlIISP ' ""'" BJHSP2 'MSARA MSI'> MSARB ,<=', """'" OMSPI """'" 'MSARA MSI'> MSARIl I!eSP! MtSPI IlMSP! "'' 1MSI' SP2> MSARA """" ,<=" antS!'1 BMSP' ~P2 OMSI'> MSARA MSARIl HeSP! Dn tSP! SMSPI Bn tSPl BMSP1 MSAAA MSAAD actin . . HI.JoIR!(MLT'iN TIN'It:IC'iTI'V PI'Al.LM'i'M'C LRDI"If'W\)LI KRIrJN'NQl'F' MSARA MSARB "'''''' SP1 . . transcript EPtEI'G'iWPI't I:RLPSGtEMP ~T ~ 1:I:JIEHtIREX; KTlKXGYWiW ~IP VRFtNiVIVR I:ttNRIWIRLC [E'fERlIJU»,. SPIJcr'G'iYP- I.Mr:n(F'l'Pf? QRP(m'NUfT' EENYlJMIFt, D1YEK'l'!'VQf' SPVKTGYYP- HLYGS'fYPFA QfU'N'iYDIJGII OKNYD;)IRFL Qo!FDfI'Ft.Q'f MSARlI ~P2 A )00 . I«:SP! BJlISP' W...J ...J W :IE ...J a.. a..O N "'IitCD CO ~ CD ,.... ,.... ,.... a.. a..a.. a.. a..a.. a.. a.. <50 -~~~~Y~ "VYLCETE.IK XISIDa..Vl'F MD£VIHDI 'lN XFTltla.TTF' IIEYIMDI 'lN ~ JaTroELVl'F VIlE\'tHOISN ~TEH2 Nl/llVTJ:L1/T'f FOO'I'll1DfIN "VYL~IK lMI:V[I(LTTF' ~ ~n;: soo 8 Fb Gt Ov Te J:lIJKVtI(LA'n' f"EYYlFWSN SVFVSKKDIK ~~SSE ~ ~vr; ~ SVFWSXEEVK !OOtStL~ R't"RRU<HHPF ~ KXRSnfIMIIA ~ XVIVDV'rSa'; 'IVDCVVR.IFI CPK'iIlCLGRL S'JI».WRIFI C PKYIX::K>U.. ~ ~ QVSIlJIJHSIE ~WRIFL CPKYIX:K>lIL Jm<SDo!VFMII ~PF XVlU)II,.SII( SVDCWRVFL GPKJa:M..NRL !>HIVH-Eta: -A'nU.NHSPP NVNlE.VDSNV IoSDlWVIQoIl,L APKYtlNJIP N-F'PY-GYKV RQf'R1m!Y.PP SVSIGVJ(S[JJ IoVI».VFXIFL CPKYDSN:;FI> SS'tPH-[pJQ RQ~ ~m~ IoVOl\.~flt ~ ~ VEIDSf'S¥KL D'I'G!(NSIVRN SQfl«trrE)'J MSVNI»CRMIli nMlm'LY1<L ETCKNI'IVRN SLEMII'JVIe;) H:S\INt:IOlLDi F'ELllSF'MYla. VlCKNI'IVRS SHtHilCFl PE IDrnRNRlRF VElDI'FLYKL N'lCKm'IVRN SYtMINLVKI) L~ ~ T1ICQ«IIRN SNEFVIF1<l!l) t~ ~ KI'GO'tHIVRQ SSDFLFFKED SLPKSEIYKL ~ ~ ~~ ~IFKOO SVPKrELYKL 550 RPW'l"lUtIl.D. IU'WI'RRII.HJ actin . . YISmRIIHES RI'HmDf'MKK SVPHTEIMKM SP1 . . transcript 60 0 Fig. 5. A. Developmental regulation of the accumulation of SPI transcript from fat body revealed by Northern blot analysis. 6L, late 6th instar larvae; 7E-L, early, middle, and late 7th instar larvae; PPE, PPL, early and late prepupae; PO-PIO, pupae at days 0-10 of development. B. Patterns of SP-I transcript accumulation among tissue types. The total RNA from different tissues were applied. For further explanation see Materials and Methods. Fb, fat body ; Gt, midgut; Ov, ovary ; Te, testis. TEEISIG'ITI'X NVDlESWWVX TRIGF'PHJU...L I,.l'LGRKGGLP HQKf'AZVI'PI HIG'1VGTISK 'iV'WESi*i'tX -RHRLPHRHL LPLGR.RGGHP tQ(FVIVI'PI1 Dt<fi>SGDG-- ~ ~ LPLGTlOOLE IQI'tVIVSPV VESIT'D--KR IlUUf'J)l.R- N YlnCF'PnU.L t.PKG:fP\IOGMH HHLYVrVl'PL =~===== =~~~ r:::--'I'G1ULPN lWSDIKERK K:RfSVCFDI' Hl't.GFPPmR IDT'SEPf"J'KN K--TNLlLPN lDINDIr:::ER.K 'l'CIoGASIISTR CR.SGPPFI:IUC ~ R--'roHLLPT I£IorlHoIXI:R: IoC»ISSCIST KPLGYPPDRP IIlO.SPFTSN RLVDNDINl lDINRXI:UIR. ~ Kl'LGPPPt:I!.R II:M:2iPF'I'PN 55================ ~~~~~ ~~. , RWSYKA\'I'!K1 .s:KJXMo!RH •• KR'J"tKDI.I!Ho ss-- -~ .. -----Il1K\IN PlNNLIIN" S:lPLRH'lltKI HlPQIUXF ., yKFN....PFYVP soo 0tW'E'J--- , . YXFNIIPSH'JM KSNWPKH . . Fig. 3. Alignment of the amino acid sequences of insect storage hexamers. HCSPI , H. cunea storage protein-I , BJHSP2, basic juvenile hormone suppressible protein I and 2 from T. ni (Jones et ai. , 1993), BMSPI and BMSP2, storage protein I (female specific protein, Levenbook and Bauer, 1984) and storage protein 2 from B. mori (Fujii et ai. , 1989), MSARA and MSARB , (X and p subunits of M. sexta arylphorin (Willott et at. , 1989) . Conserved amino acid residues are indicated by asterisks. transcript through the middle pupal stage (Seo et a!. , 1998). A profile of transcript accumulation generally mirrored the developmental profiles of SP-1 synthesis in Hyphantria cunea (Kim et a!. , 1989). The hemolymph storage protein in Hyphantria cunea begins to appear on the 4th day of the 7th larval instar and reach their peak on the 8th day. The hemolymph storage protein begins to decrease during the prepupal stage and is drastically reduced immediately after pupation (Kim et a!. , 1989) Hybridization of the SP-l eDNA insert to total RNA 224 Storage Prote in-l Gene in Hyphantria cunea from several ti ssues revealed the accumulation of a 2500 nt transcript in the ovary as well as in testi s, albeit at much lower levels than in the fat body (Fig. 5B). LHP synthesis in lepidopterans occurs primarily but not exclusively in larval fat body cells (Kanost et aI., 1990). In this report, we present definitive evidence fo r Met-rich storage protein transcription in both male and female reproductive organs. Levels of the SP-I transcript were much lower in the gonads than in the fat body cells. Of particular interest is the fac t that the expression of storage protein in the ovary has never been reported in other species. Storage protein synthesis and secretion has been identified in the fat body and other organs in Calpodes ethlius. The alternative sites of synthesis in thi s in sect included the epidermis (Palli and Locke, I 987a), midgut (Pal\i and Locke, 1987b), and pericardial cell s (Fife et aI. , 1987). Analogous results were obtained with M. sexta through the demonstration that arylphorin genes are transcribed in several larval ti ssues (Webb and Riddiford, 1988). The two cDNAs coding 76 and 79 kDa polypeptides, which had been earlier shown to be storage proteins in G. mellonella, are not expressed in midgut, silk gland, and Malpighi an tubul es (Ray et aI. , 1987a). Although seve ral ti ss ues are prese nted as candidates for alternate expression sites of storage protein, the types of ti ssues showing a positive signal are not co nsistent between the different spec ies. Th e SP-l transcript in the ovary and testis might have accessory roles, compared to the bulk of hemolymphatic SP-l , but it mi ght constitute an organ-specific storage system that allows the insect to keep its reproductive activity under nutritional stress. Acknowledgments We are very g rateful to Dr. D . L. Silhacek (USDA, Gainsville, Florida) for valuable comments on this wo rk a nd Dr. Jac que s d ' A layer (L a borato ire d e Microsequencage des Proteines, Institut Pasteur) for the protein sequence. Thi s work was supported by a grant from the Researc h Institute of Natural Science, Gyeo ngsang National University. References Corpuz, L. M., Choi , H. , Muthukrishnan, S., and Kramer, K. J. ( 199 1) Sequences of two cDNAs and expression of the genes encoding methionine- ri ch storage proteins of Manduca sexta. Insect Biochem. 21, 265- 276. Delaney, S. J. , Smith, D. E, McClelland, A., Sunkel, e., and Glover, D. M. (1986) Sequence conservati on around the 5' e nds of the larval serum protein I genes of Drosophila melanogaster. 1. Mol. BioI. 189, 1-11 Fe inberg, A. P. and Vo lgelstein , B. (1983) A tec hniqu e for radiolabe ling D A restriction endonuclease fragments to high specific activity. Anal. Biochem. 132, 6--13. Fife, H. U. , Palli , S. R., and Locke, M. ( 1987) A function fo r the pericardial cell in an insect. Insect Biochem. 17, 829-840. Fuji i, T. , Sakurai , H., Izumi , S., and Tomino, S. (1989) Structure of the gene for the arylphorin-type protein SP2 of Bombyx mori. 1. BioI. Chem. 264, 11 020- 11025. Izumi , S. , Sakurai, H., Fujii, T., Ikeda, w., and Tomino, S. ( 1988) Cloni ng of mRNA sequence coding for sex-specific storage protein of Bombyx mori. Biochim, Biophys. Acta. 949, 181 188. Jones, G. , Brown, N. , Manczak, M ., Hiremath, S., and Kafatos, E e. ( 1990) Molec ular cloni ng, regul ation , and co mpl e te sequ e nce of a he mo cya nin-re la ted , ju ve nil e ho rm o ne suppressible prote in from insect hemol ymph . 1. BioI. Chem. 265, 8596--8602. Jon es, G ., M anczak, M. , and Horn , M. ( 1993) Hormo na l regulati on and properti es of a new group of basic hemolymph prote in s ex pressed during insect metamorphos is. 1. BioI. Chem. 268, 1284-- 129 1. Kanost, M . R., Kawooya, J. K. , Ryan, R. D., Van Heusden, M . e., and Ziegler, R. (1990) Insect hemolymph proteins. Adv. Insect Physiol. 22, 299-366. Kim , H. R., Kang, e. S., and Mayer, R. T. ( 1989) Storage proteins of the fa ll webworm, Hyphantria cunea Drury. Arch. Insect Biochem. Physiol. 10, 115-130. Leclerc, R. E and Miller, S. G. (1990) Identificati o n and mol ec ul ar a nal ys is of sto rage prote in s from Heliothis virescens. Arch. Insect Biochem. Physiol. 14, 13 1- 150. Lepesant, 1. A. , Maschat, E , Kejzlarova-Lepesant, 1., Benes, H., and Yani costas, e. ( 1986) Developmental and ecdys teroid regul ati on of gene ex press io n in the larv a l fat body of Drosophila melanogaster. Arch. Insect Biochem. Physiol. 7, 133- 141. Levenbook, L. (1985) Insect storage proteins; in Comprehensive Insect Physiology, Biochemistry and Pharmacology Kerkut, G . A. and Gilbert, L. I. (eds.) , Vol. 9, pp. 307- 346, Pergamon Press, Oxford. Levenbook, L. and Bauer, A. e. (1984) The fate of the larva l storage protein ca lliphorin durin g adult development of Calliphora vicina. Insect Biochem. 14, 77-86. Locke, M. and Co llin s , J . V. (1968) Protein upt ake into mu lti vesicular bodies and storage granules in the fat body of an insect. 1. Cell BioI. 36, 453--483. Memmel, N. A. , Trewitt, P. M ., SiLhacek, D. L. , and Kumaran, A. K. ( 1992) Nuc leotide sequence and structure of the ary lphorin gene from Galleria mellonella. Insect Biochem. Molec. BioI. 22, 333-342. Memmel, N. A. , Trewitt, P. M. , Grezlak, K., Rajaratn am, V. S. , and Kumaran, A. K. ( 1994) Nucleotide sequence, structure and developmental regulation of LHP82, a juvenil e hormone suppressible hexamerin gene from the wax moth Galleria mellonella. Insect Biochem. Molec. BioI. 24, 133-144. Miller, S. G. and Silhacek, D. L. ( 1982) The sy nthesis and uptake of haemolymph storage proteins by the fat body of the greater wax moth, Galleria mellonella (L). Insect Biochem. 12, 292300. Palli, S. R. and Locke, M . (l987a) The sy nthesis of hemolymph proteins by the larval midgut of an insect, Calpodes ethlius (Lepidoptera: Hesperiidae) . Insect Biochem. 17, 561-572. Palli , S. R. and Locke, M. (l987b) The sy nthesis of hemolymph proteins by the larva l epidermis of an insect, Calpodes ethlius (Lepidoptera: Hesperiidae). Insect Biochem. 17,711- 722. Pearlm an, D . and Halvorson, H. D . ( 1983) A putati ve signal peptidase recognition site and sequence in eukaryotic and prokaryotic signal peptides. 1. Mol. BioI. 167,391--409. Ray, A. , Memmel , N. A., Orcheko wski, R. P., and Kumaran, A. K. (1987 a) Isolation of two cDN A clones coding for larval hemolymph proteins of Galleria mellonella. Insect Biochem. 17,603-6 17. Ray, A. , Memm e l, N. A., a nd Kum ara n, A . K . ( 1987 b ) Develop mental regul ation of the larva l hemolymph protein genes in Galleria mellonella. Roux's Archs Dev. BioI. 196, 4 14--420. Cheon Hyang Mi et al. Sakurai, H., Fujii , T. , Izumi, S. , and Tomino, S. (1988a) Structure and expression of gene coding for sex-specific storage protein of Bombyx mori. 1. BioI. Chem. 263, 7876-7880. Sakurai , H., Fujii, T. , Izumi , S. , and Tomino, S. (1988b) Complete nucleotide sequence of gene for sex-specific storage protein of Bombyx mori. Nucleic Acids Res. 16,7717-7718 . Sambrook, J., Fritsch, E. F. , and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Sanger, E , Nicklen, S., and Coulson, A. R . (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl. A cad. Sci. USA 74,5463-5467. Seo, S. J., Kang, Y J., Cheon, H. M. , and Kim , H . R . (1998) Distribution and accumu lation of storage protein- I in ovary of Hyphantria cunea. Arch. Insect Biochem. Physiol. 37, 115128. 225 Smith, D. F. , McClellend, A., White, B. N. , Addison, C. F. , and Glover, D. M . (1981) The molecular cloning of a dispersed set of developmentally regulated genes which encode the major larval serum protein of Drosophila melanogaster. Cell 23, 441-449. Telfer, W. H. and Kunkel , J. G. (1991) The function and evolution of insect storage hexamers. Annu. Rev. Entomol. 36, 205-228. Webb , B . A . and Riddiford , L. M. (1988) Regulation of expression of arylphorin and female-specific protein mRNAs in the tobacco horn worm, Manduca sexta. Dev. BioI. 130, 671-681. Willott, E ., Wang, X . Y , and Wells, M. A . (1989) cDNA and gene sequence of Manduca sexta arylphorin, an aromatic amino acid -rich larval serum protein: hom o logy to arthropod hemocyanins. 1. BioI. Chem. 264, 19052- 19059.