Regulation of c-ret expression by retinoic acid in rat
metanephros: implication in nephron mass control
EVELYNE MOREAU, JOSÉ VILAR, MARTINE LELIÈVRE-PÉGORIER,
CLAUDIE MERLET-BÉNICHOU, AND THIERRY GILBERT
Institut National de la Santé et de la Recherche Médicale Unité 319,
Développement Normal et Pathologique des Fonctions Epithéliales,
Université Paris 7-Denis Diderot, 75251 Paris Cedex 05, France
renal differentiation; all-trans-retinoic acid; c-ret; glial cell
line-derived neurotrophic factor; glial cell line-derived neurotrophic factor receptor-a
IN THE MAMMALIAN EMBRYO,
kidney development depends on reciprocal interactions between two mesodermal derivatives: the ureteric bud, an epithelial outgrowth of the wolffian duct, and the metanephric
mesenchyme. On induction by the ureteric bud extremities, the metanephric mesenchyme undergoes a series
of morphogenetic events leading to nephron formation
via epithelial differentiation. In turn, the mesenchymal
tissue dictates growth and branching of the ureteric
bud (16, 33). Regulation of kidney organogenesis is
known to require proper activation of a set of genes (4,
23, 43). Advances in technique such as gene targeting
in mice have allowed identification of growth factors
and receptors as candidates to regulate the nephrogenic signals between the mesenchyme and the ureteric bud (26, 29, 31, 35, 36). At present, the glial cell
line-derived neurotrophic factor (GDNF)-GDNF receptor-a (GDNFR-a)-Ret signaling complex is among the
best candidates to mediate the early inductive events of
The costs of publication of this article were defrayed in part by the
payment of page charges. The article must therefore be hereby
marked ‘‘advertisement’’ in accordance with 18 U.S.C. Section 1734
solely to indicate this fact.
F938
renal organogenesis. GDNF is a mesenchyme-derived
secreted signal, considered to be the inducer of ureteric
bud formation and required for growth and branching
of the ureteric bud (30, 43). Ureteric epithelial cells
mediate their response to GDNF via activation of the
receptor tyrosine kinase Ret, which is expressed in the
ureter tips (10, 42). However, GDNF needs first to bind
a cell-surface-associated protein, GDNFR-a, to interact
with Ret (32, 41). The role of exogenous GDNF on in
vitro nephron formation on wild-type metanephros
remains to be clarified because contradictory data on
ureteric bud morphogenesis have been reported (29, 30,
44).
During embryonic development, retinoids play a
fundamental role in early differentiation, morphogenesis, and pattern formation in vertebrates (9, 24).
Evidence for a developmental retinoid requirement
during urogenital tract development originally came
first from analysis of the offspring of severely vitamin
A-deficient rats (46). Severe congenital malformations
occur in such rats, frequently including renal abnormalities (48). These can be reversed by vitamin A treatment
at various times during gestation (47). These morphogenetic abnormalities were recapitulated with murine
embryos having null mutations for two retinoid nuclear
receptor isoforms and exhibiting renal hypoplasia or
agenesis (25). However, these experiments did not
specify the underlying mechanisms of RA environment
on nephron ontogeny. Recently, using a model of in vitro
renal development, we showed that RA is a modulating
factor controlling renal organogenesis (45). We also
demonstrated that the branching pattern of the ureteric bud was significantly more developed on retinoid
exposure (45).
Up to now, the effect of all-trans-retinoic acid (RA) on
gene expression during renal development has received
little attention. In this study, we identify some of the
molecular targets of the retinoids in the developing rat
kidney. Using paired metanephroi grown in serum-free
medium, either RA-free or supplemented with RA, we
focus our analysis on the expression of the GDNFGDNFR-a-Ret complex components. We also study the
effects of exogenous GDNF on nephron formation. Our
results demonstrate that c-ret mRNA expression is
regulated by RA in a dose-dependent manner, highlighting the control that vitamin A derivatives exert on the
nephron mass.
MATERIALS AND METHODS
Metanephros organ culture. Metanephros organ culture
was performed as previously described (1, 14). Fetuses from
0363-6127/98 $5.00 Copyright r 1998 the American Physiological Society
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.1 on October 2, 2016
Moreau, Evelyne, José Vilar, Martine Lelièvre-Pégorier, Claudie Merlet-Bénichou, and Thierry Gilbert.
Regulation of c-ret expression by retinoic acid in rat metanephros: implication in nephron mass control. Am. J. Physiol. 275
(Renal Physiol. 44): F938–F945, 1998.—Vitamin A and its
derivatives have been shown to promote kidney development
in vitro in a dose-dependent fashion. To address the molecular
mechanisms by which all-trans-retinoic acid (RA) may regulate the nephron mass, rat kidneys were removed on embryonic day 14 (E14) and grown in organ culture under standard
or RA-stimulated conditions. By using RT-PCR, we studied
the expression of the glial cell line-derived neurotrophic
factor (GDNF), its cell surface receptor-a (GDNFR-a), and the
receptor tyrosine kinase c-ret, known to play a major role in
renal organogenesis. Expression of GDNF and GDNFR-a
transcripts was high at the time of explantation and remained unaffected in culture with or without RA. In contrast,
c-ret mRNA level, which was low in E14 metanephros and
dropped rapidly in vitro, was increased by RA in a dosedependent manner. The same is true at the protein level.
Exogenous GDNF barely promotes additional nephron formation in vitro. Thus the present data establish c-ret as a key
target of retinoids during kidney organogenesis.
F939
MODULATION OF RET BY RETINOIC ACID IN METANEPHROS
tides, was heated at 70°C for 5 min. After cooling, 10 µl of an
RT mixture was added to final concentrations of 50 mM
Tris · HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 10 mM
dithiothreitol, 0.6 mM of each dNTP (Stratagene), together
with 20 U RNase inhibitor (Promega) and 200 U Moloney
murine leukemia virus-RT (GIBCO-BRL). After incubation at
37°C for 1 h, the reaction was stopped at 90°C for 5 min to
inactivate the transcriptase enzymes and cooled at 4°C.
Reaction tubes without RT were prepared to control for the
absence of genomic DNA contamination.
The transcripts analyzed in this study were the tyrosine
kinase receptor c-ret, its proposed ligand GDNF, the accessory protein GDNFR-a, and b-actin as control. They were
studied by amplification of the obtained cDNA using different
primer pairs, chemically synthesized (Genosys, Cambridge,
UK), that are listed in Table 1. C-ret-specific primers were
chosen on the basis of the nucleotide sequence of the mouse
c-ret (GenBank accession no. X67812) (19). Oligonucleotide
primers were devised to amplify the region 1,578–2,018
encoding the transmembrane domain and most of the cysteinerich domain. No cross-reaction of these primers with known
sequences was found using BLAST/NCBI software. The GDNF
primers we used were based on the rat nucleotide sequence
(GenBank accession no. L15305) and located at positions
141–160 and 584–605 (34). GDNFR-a primers were selected
according to the rat nucleotide sequence (GenBank accession
no. U59486) and located at positions 1,177–1,201 and 1,598–
1,622, as suggested by P. Towers (personal communication).
The primers of the internal control were sequences 1,509–
1,528 and 2,457–2,476 of the rat b-actin sequence (GenBank
accession no. J00691) (27).
One-half of the RT reaction volume was added to 90 µl of
the following PCR Mastermix prepared immediately before
use: 75 mM Tris · HCl (pH 9), 20 mM (NH4 )2SO4, 0.01%
(wt/vol) Tween 20, 200 µM of each dNTP, and 2 U Taq DNA
polymerase (Pro-HA, Eurogentec). Primers (2 µl) were added
to a final concentration of 0.5 µM. The final MgCl2 concentration was 4.5, 1.5, and 1 mM for c-ret, GDNF, and GDNFR-a,
respectively, and 1.5 mM for b-actin. The reaction mixture
was overlaid with 100 µl mineral oil and then placed in a
thermal cycler (Perkin-Elmer) programmed as follows: first a
3-min step at 95°C, then n cycles [95°C (1 min), annealing
temperature (1 min), 72°C (1 min)] (see Table 1). PCR
amplification was followed by a 7-min step at 72°C. For each
amplification, the number of cycles was chosen such that the
Table 1. Oligonucleotides and main reaction conditions used for the RT-PCR study
cDNA
c-ret
S
AS
GDNF
S
AS
GDNFR-a
S
AS
b-Actin
S
AS
Fragment
Length, bp
Annealing
Temperature, °C
Cycles,
number
Restriction
Enzymes
Products
Size, bp
439*
63
35
442†
63
35
Pvu II
Msp I
Pvu II
Msp I
347/92
154/285
no site
163/154
86/39
CGCCCGCCGAAGACCACTCC
GTCGAAGGCGACCGGCCTGC
464
60
30
BstE II
325/139
ATTGGCACAGTCATGACTCCCAAC
GAGGAGCAGCCATTGATTTTGTGG
445
58
30
Msp I
Pst I
237/208
375/70
GGCCATCTCTTGCTCGAAGT
AAGAGAGGCATCCTGACCCT
504
63
25
Primers
GCGCCCCGAGTGTGAGGAATGTGG
GCTGATGCAATGGGCGGCTTGTGC
All primers are outlined in 58–38 orientation. S, sense; AS, antisense; GDNF, glial cell line-derived neurotrophic factor; GDNFR-a, GDNF
receptor-a; * and †: expected sizes according to the mouse (19) and rat sequence (submitted to GenBank), respectively.
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.1 on October 2, 2016
Sprague-Dawley female rats of known mating date (day 0 of
pregnancy was the day after overnight mating) were taken at
embryonic day 14 (E14), and whole metanephroi were collected and freed of exogenous tissue. Kidney rudiments were
placed onto a 0.8-µm Millipore AA filter (Millipore, SaintQuentin-en-Yvelines, France), floating on a defined serumfree medium and incubated for 2, 4, or 6 days in 35-mm petri
dishes at 37 6 0.5°C in a humidified incubator (5% CO2 ). The
medium originally described by Avner and colleagues (1, 2)
was used. Culture medium was changed daily. No antibiotic
was present throughout the experiment, because we previously showed that they alter in vitro nephrogenesis via
impaired ureteric bud branching morphogenesis (13).
Special care was taken to prepare stock solutions of RA.
Ten-millimolar RA solution was prepared in absolute ethanol,
stored at 220°C in the dark, and used within 1 wk. RA was
used at a concentration ranging from 1 nM to 10 µM,
extemporaneously prepared. Experiments were performed
under paired conditions; i.e., one metanephros was grown as
a control, and the opposite kidney from the same fetus was
grown in the RA-supplemented medium. In some experiments, RA was added after 48 h of culture. Human recombinant GDNF (R & D Systems) was used at 15 or 150 ng/ml. All
tissue culture reagents were from Sigma France.
In vitro differentiation assessed by lectin histochemistry.
The effect of GDNF on in vitro renal development was studied
either on pairs of metanephroi grown in absence of RA or on
pairs of metanephroi grown with 100 nM RA in the culture
medium for 6 days. Briefly, metanephroi were fixed with 2%
paraformaldehyde in PBS, permeabilized with saponin,
treated with neuraminidase, and labeled with rhodaminecoupled Arachis hypogaea agglutinin that binds podocyte
membranes, as already described (14). The total number of
nephrons present within the cultured metanephroi was then
accurately determined.
RT-PCR. Due to the small size of the samples and thus to
the very low amounts of RNA recoverable from kidney
rudiments in vitro, we analyzed gene expression by RT-PCR.
Sixty metanephroi were collected on E14, and 30 or 15 were
pooled after 2 or 4 days of culture, respectively. Messenger
RNAs were extracted by using Dynabeads mRNA purification
kit (Dynal, Oslo, Norway), as recommended by the supplier,
and were quantified at A260 by spectrophotometry.
Single-stranded cDNAs were synthesized as follows: 0.1 µg
of mRNA in 10 µl, containing 5 µM of random hexanucleo-
F940
MODULATION OF RET BY RETINOIC ACID IN METANEPHROS
membrane (Hybond-C extra, Amersham). Membranes were
washed in Tris-buffered saline (TBS; 50 mM Tris · HCl, 150
mM NaCl, pH 8) and incubated in 5% skimmed milk in TBS
overnight. Then they were incubated in 0.2 µg/ml primary
antibody rabbit anti-Ret (Santa-Cruz Biotechnology) for 1 h
in TBS 1 Tween 20 at 0.05%. After washing, membranes were
incubated in secondary antibody donkey anti-rabbit and
probed with rabbit peroxidase anti-peroxidase soluble immune complexes (Jackson Immunoresearch) used at a 1:5,000.
The signal was visualized by enhanced chemiluminescence
(Amersham kit) using the recommended protocol.
Data analysis. Data are reported as means and SE. Comparisons between control and GDNF-exposed metanephroi
were performed using the Wilcoxon’s paired test. Significance
was determined by P , 0.05.
RESULTS
Analysis of the transcripts coding for Ret revealed
products of roughly the expected size (439 bp). However, based on the mouse sequence, Msp 1 enzymatic
treatment led to irrelevantly sized products, and Pvu II
was ineffective. The PCR product was sequenced (Eurogentec), and the nucleotide sequence of this fragment is
illustrated in Fig. 1. It displays 89% similarity with the
mouse homologous c-ret cDNA and had a threenucleotide insert (TGT) in position 1,928, giving a
length of 442 bp. Most of the differences between the
mouse and rat sequences are found within the transmembrane domain (,68% homology). The sequence of
the cysteine-rich domain is highly conserved, with 94%
homology with the mouse sequence (19). For the corresponding protein, amino acid sequence comparison
reveals 88% homology between mouse and rat Ret
proteins (Fig. 2). Note that the additional amino acid
Fig. 1. Comparison of mouse c-ret cDNA and amplified rat fragment. Match between nucleotides is marked by a dot.
A high degree of homology between mouse and rat sequences was found. In rat, 3 nucleotides (TGT) were inserted in
position corresponding to base 1,928 of mouse cDNA. Msp 1 and Pvu II restriction enzymes sites are indicated. No
Pvu II site is present in this partial rat sequence.
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.1 on October 2, 2016
reaction products do not reach the plateau phase. (As a
general rule, a plateau is reached when 5 additional cycles do
not yield at least twice as much product.) The RT products
solution was diluted 10 times before amplification of GDNF
and GDNFR-a, routinely performed with 30 cycles. Undiluted
RT products solution was used for 35 cycles of c-ret amplification. Plateau is reached after 40 cycles for GDNF and
GDNFR-a, but not for c-ret. Ten microliters of amplified
products were run on a 2% agarose gel containing ethidium
bromide and molecular markers. The size of PCR products
was analyzed and their identity confirmed by restriction
enzyme digestion. The PCR products were visualized by
ultraviolet transillumination and photographed using 667
Polaroid films.
Semiquantitative analysis of c-ret expression by PCR. To
study the effect of a wide range of RA concentrations on c-ret
gene expression, we performed simultaneous amplification of
c-ret and b-actin cDNA. The latter was used as an internal
control, and addition of its primers was delayed, as proposed
by Kinoshita et al. (20). After RT, c-ret and b-actin cDNAs
were amplified as follows: primers for c-ret sequence were
added to the PCR reaction mixture as described above. After
10 cycles of amplification, primers for b-actin were added for
22 additional cycles. The PCR products were visualized as
just described. Coamplification of c-ret and b-actin proceeds
exponentially, and semiquantitative analysis was performed
in the logarithmic phase of amplification (5). Intensity of the
bands was analyzed following scanner densitometry using
image analysis software (NIH Image).
Western blotting analysis. Twenty-five metanephroi were
collected on E14, and 10 or 5 were pooled after 2 or 4 days of
culture with or without RA. After homogenization in 50 µl of
lysis buffer (Tris · HCl 50 mM, pH 8.6 containing 5 mM EDTA
and protease inhibitors), samples were boiled in Laemmli
buffer. Twenty micrograms of each homogenate were loaded
on top of a 6–20% gradient gel, electrophoretically separated
under reducing conditions, and blotted onto nitrocellulose
MODULATION OF RET BY RETINOIC ACID IN METANEPHROS
F941
Fig. 2. Comparison of mouse and rat protein
partial sequences. Transmembrane domain is
represented by shaded area, and cysteine
residues located in extracellular domain are
enclosed by boxes. Identical amino acids are
identified by a single dot. Asterisks above
some amino acids represent mutation sites in
multiple endocrine neoplasia syndromes or
Hirschsprung’s disease. Insertion of nucleotides results in addition of a valine (V) residue
in transmembrane domain at position 344.
Fig. 3. Product analysis of RT-PCR for c-ret mRNA and Western
blotting. Pairs of metanephroi were grown in absence (2) or presence
(1) of 100 nM RA for 2 or 4 days (d). In some experiments,
all-trans-retinoic acid (RA) was added during the 3rd and 4th days
(3–4d). Two percent agarose gel stained with ethidium bromide
revealed c-ret (442 bp) and b-actin control (504 bp) bands. Western
blot of Ret reveals one band at ,170 kDa, as expected. RA stimulates
both c-ret mRNA and protein amounts. E14, embryonic day 14.
Because we previously demonstrated that RA was
able to promote nephron formation in organ culture in a
dose-dependent manner via enhanced branching morphogenesis (45), we subjected metanephroi cultures to
a wide range of RA concentrations over a period of 4
days to analyze c-ret expression levels. As shown in Fig.
4, the presence of an RA concentration as low as 1 nM
was able to significantly sustain a high level of c-ret
expression, compared with paired controls. The c-ret
mRNAs augmented in a dose-dependent manner, linearly from 1029 to 1026 M RA (r 5 0.82, P , 0.001, n 5
12). The highest expression of c-ret was found in
metanephroi cultured with 1 µM of RA, leading to an
eightfold increase compared with metanephroi grown
in the absence of RA. A concentration of 1025 M RA
caused c-ret mRNA levels to drop.
Fig. 4. Semiquantitative RT-PCR of c-ret expression. Pairs of metanephroi were grown for 4 days in absence or presence of RA concentration
ranging from 1029 to 1025 M. A: after simultaneous amplification,
detection of both b-actin (top) and c-ret (bottom) bands were visualized in 2% agarose gel stained with ethidium bromide. Quantification
of the relative amount of c-ret to b-actin is presented in B. A linear
increase of c-ret expression is observed in response to increasing RA
concentration in the medium (log scale). Ratio was normalized to
value obtained with 1 nM of RA. Experiments were done in triplicate.
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.1 on October 2, 2016
we detected was a valine, a residue that is present at
this position in both human and chicken Ret proteins
(37, 40). All cysteine residues are conserved, and none
of the amino acids known to be mutated in multiple
endocrine neoplasia syndromes or Hirschsprung’s disease are modified in the amplified rat c-ret sequence
(12). Thus the amplified fragment corresponds to rat
c-ret transcripts.
The profile of c-ret expression in E14 kidney before
and during organ culture is depicted in Fig. 3. After 2–4
days of culture of metanephros in a RA-free medium,
c-ret expression in the metanephros decreases significantly. By contrast, in the presence of 100 nM of RA in
the culture medium, c-ret is strongly expressed throughout the culture period, even reaching a level of expression higher than the level at the time of explantation.
To determine whether RA is able to upregulate c-ret
expression, metanephroi were grown for 2 days without
RA so as to lower c-ret expression, and then RA was
added to the culture medium for the third and fourth
day of in vitro development (Fig. 3). C-ret expression is
markedly stimulated under these conditions. Western
blot analyses directed against Ret proteins yield the
same results (Fig. 3).
F942
MODULATION OF RET BY RETINOIC ACID IN METANEPHROS
concomitant presence of 150 ng/ml of GDNF allowed
the formation of 33% supernumerary nephrons (179 6
9 vs. 231 6 9, n 5 8 pairs, P , 0.02) (Fig. 6, C and D).
DISCUSSION
Concerning GDNF and GDNFR-a expression, their
mRNAs were present at very high levels in E14 kidneys
compared with c-ret. In vitro development did not
modify their expressions, irrespective of the presence of
RA in the culture medium (Fig. 5). The amount of
GDNF peptides remained unaffected by the duration of
the culture and by the presence or absence of RA (data
not shown).
We studied the effect of exogenous GDNF on rat
metanephros development in vitro in cultures grown
with or without RA. The total number of nephrons
present within the explanted metanephroi was quantified after 6 days of culture. Addition of 15 ng/ml of
GDNF to the standard culture medium had no effect on
in vitro nephron formation. However, the presence of a
10-fold higher concentration of GDNF induced a 35%
stimulation of in vitro nephrogenesis (65 6 4 vs. 90 6 6,
n 5 15 pairs, P , 0.01) (Fig. 6, A and B). In the presence
of 100 nM of RA, a concentration known to induce per se
a 200% increase in nephron formation in vitro (45), the
Fig. 6. Microphotographs showing metanephroi differentiation in vitro assessed by lectin histochemistry.
Pairs of metanephroi were grown under control (A and
B) or RA-stimulated conditions (C and D), in absence (A
and C) or presence (B and D) of 150 ng/ml GDNF in the
medium. A moderate increase in nephron number had
occurred with GDNF, far from the stimulation observed
with RA alone. Bar represents 150 µm.
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.1 on October 2, 2016
Fig. 5. RT-PCR analysis of glial cell line-derived neurotrophic factor
(GDNF) and GDNF receptor-a (GDNFR-a) mRNAs. Pairs of metanephroi were grown in absence (2) or presence (1) of 100 nM RA for 2
or 4 days. Two percent agarose gel stained with ethidium bromide
revealed GDNF (464 bp) and GDNFR-a (445 bp) bands.
Whole metanephros organ culture has emerged as an
attractive system for studying the underlying mechanisms of renal organogenesis because it allows optimal
metanephros differentiation. Here we demonstrate that
the c-ret tyrosine kinase receptor expression is highly
dependent on the presence of RA. Moreover, c-ret
mRNA level is regulated by RA concentrations in a
dose-dependent manner. The increased abundance of
Ret proteins by RA is consistent with the stimulated
branching morphogenesis we observed leading to enhanced nephron formation (45), i.e., the greater the
number of ureter tips, the greater the number of sites to
induce differentiation of the metanephric mesenchyme
into nephrons. Therefore, not only is c-ret involved in
the initial outgrowth of the ureter from the wolffian
duct (35), but also its level of expression correlates with
the number of nephrons formed in vitro (45).
At the time we explanted the embryonic kidney, the
ureteric bud had few extremities. Whereas c-ret is
expressed all over the T-shaped bud at an earlier stage,
c-ret is only expressed at the tips of the ureter at the
moment of explantation (28). This contributes to c-ret’s
relatively low level of expression compared with GDNF
or GDNFR-a, which, in turn, are highly expressed in
the metanephrogenic blastema (17, 38, 41). Analysis of
Ret proteins clearly indicates that more tyrosine kinase
receptors are present on the ureteric bud, which allows
a more effective response to the high level of endogenous GDNF. Because the dichotomous branching pattern of the ureteric bud was maintained in RA-exposed
metanephroi (45), we speculate that Ret proteins are
not ectopically expressed, but further investigations
are needed to clarify this point. It remains an open
question whether RA acts primarily on the bud itself or
whether an enhanced production of mesenchymal sig-
MODULATION OF RET BY RETINOIC ACID IN METANEPHROS
remains open. The fact that superior cervical ganglion
neurons do not survive in Ret 2/2 mice whereas they
are almost unaffected in GDNF 2/2 mice supports this
hypothesis (11, 31, 35). This suggests that the Ret
receptor can be activated by other signaling molecules.
Interestingly, a new neurotrophic factor structurally
related to GDNF and named neurturin (NTN) has been
identified (22). Its responsiveness, like GDNF, requires
a glycosyl-phosphatidylinositol-linked receptor (NTNR-a)
to induce Ret activation (8, 21). Its role during renal
development is not yet established but is likely, given
the large amounts of NTNR-a detected in the metanephros (3, 6). RA may thus control the effects of a variety of
differentiation factors interacting first with a specific
glycosyl-phosphatidylinositol membrane-anchored protein before transducing their signals via a shared
transmembrane protein kinase receptor such as c-ret.
In conclusion, we demonstrate here that RA stimulates the expression of the proto-oncogene c-ret in
serum-free metanephros organ culture, suggesting that
the vitamin A environment may play a crucial role in
nephron formation. In the cascade of events resulting
in the initial interaction between the metanephric
blastema and the ureteric bud, the local RA concentrations could be the triggering event leading to c-ret
expression, to respond to GDNF or to another as yet
uncharacterized signaling molecule. Thus the RAdependent c-ret expression within the differentiating
metanephros may control the nephron mass.
The authors thank H. Gutowitz for help with the manuscript.
All of this work was supported by Institut National de la Santé et
de la Recherche Médicale funds.
Part of this work was presented at the Thirty-Sixth Annual
Meeting of the American Society of Cell Biology, San Francisco, CA,
and published in abstract form (15).
Address for reprint requests: T. Gilbert, Institut National de la
Santé et de la Recherche Médicale Unité 319, ‘‘Développement
normal et pathologique des fonctions épithéliales,’’ Université Paris
7-Denis Diderot, 2 place Jussieu, Tour 33–43, 75251 Paris Cedex 05,
France.
Received 5 May 1998; accepted in final form 3 September 1998.
REFERENCES
1. Avner, E. D., D. Ellis, T. Temple, and R. Jaffe. Metanephric
development in serum free organ culture. In Vitro Cell. Dev. Biol.
18: 675–682, 1982.
2. Avner, E. D., W. E. J. Sweeney, N. P. Piesco, and D. Ellis.
Growth factor requirements of organogenesis in serum-free
metanephric organ culture. In Vitro Cell. Dev. Biol. 21: 297–304,
1985.
3. Baloh, R. H., M. G. Tansey, J. P. Golden, D. J. Creedon, R. O.
Heuckeroth, C. L. Keck, D. B. Zimonjic, N. C. Popescu,
E. M. Johnson, and J. Milbrandt. TrnR2, a novel receptor that
mediates neurturin and GDNF signaling through Ret. Neuron
18: 793–802, 1997.
4. Bard, J. B. L., J. E. McConnell, and J. A. Davies. Towards a
genetic basis for kidney development. Mech. Dev. 48: 3–11, 1994.
5. Bobadilla, N. A., J. P. Herrera, A. Merino, and G. Gamba.
Semi-quantitative PCR: a tool to study low abundance messages
in the kidney. Arch. Med. Res. 28: 55–60, 1997.
6. Buj-Bello, A., J. Adu, L. G. P. Pinon, A. Horton, J. Thompson, A. Rosenthal, M. Chinchetru, V. L. Buchman, and A. M.
Davies. Neurturin responsiveness requires a GPI-linked recep-
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.1 on October 2, 2016
nals by RA is the leading event that stimulates the
branching pattern. There may be a direct effect of RA on
c-ret expression: the nucleotide sequence of the c-ret
promoter region thus far identified (453 bp) does not
show any RA-responsive elements (18), but this does
not rule out the possibility that c-ret expression is
directly controlled by RA because RA-responsive elements can be located further upstream from the transcription start sites. It is significant that the dosedependent response we measured clearly indicates that
lowering or increasing the RA concentration below or
above some value may impair renal organogenesis via
inadequate Ret expression. Upregulation of c-ret expression by RA exposure has also been reported in neuroblastoma cells before neuronal differentiation, but only for
very high RA concentrations (7, 39). It is very unlikely
that c-ret is the only target of RA in the embryonic
kidney because numerous potentially RA-responsive
genes are known to be expressed in the developing
kidney (4). But, so far, c-ret is the first identified gene
present in the ureteric bud that may play a role in
controlling the number of nephrons to be induced.
Given the strong stimulation of in vitro nephron
formation on RA exposure we observed (Fig. 5C; Ref.
45) and the RA-dependent Ret expression we have
reported here (Fig. 4), we would have expected a much
more pronounced stimulation of in vitro nephrogenesis
on simultaneous exposure to RA and GDNF. The most
likely explanation of the observed moderate response to
large concentrations of exogenous GDNF, and as also
reported for branching morphogenesis of the ureteric
bud by others (44), is that the amount of endogenous
GDNF was not limiting, as suggested by the presence of
abundant GDNF transcripts and proteins. In this regard, it should be noted that although GDNF is able to
promote primary ureteric buds from the wolffian duct
(29), Sainio et al. (30) have shown recently that exogenous GDNF is not critical for ureteric bud branching of
late T-shaped bud. It is clear that there is an absolute
requirement for a sufficient amount of GDNF produced
by the mesenchymal cells to allow the ureter to bud out
from the wolffian duct leading to metanephros formation. The occurrence of unilateral renal agenesis in
GDNF heterozygous deficient embryos supports this
view (26, 31). It seems, however, that later in metanephros development, the levels of endogenous GDNF remain high, as they do in vitro, suggesting that it may
act as a ureteric bud survival factor. Despite the
unchanged amount of GDNF in the metanephros
throughout the culture period, c-ret expression decreased sharply, indicating that GDNF does not modulate c-ret expression. In addition, the weak GDNF
responsiveness cannot rely on a limiting amount of
GDNFR-a because GDNFR-a expression remained unchanged in cultured metanephroi regardless of whether
RA was present. The same results were obtained using
the rat instead of human recombinant GDNF (data not
shown).
The question of whether GDNF is the more potent
ligand to induce c-ret signaling in the embryonic kidney
F943
F944
7.
8.
9.
10.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
tor and the Ret receptor tyrosine kinase. Nature 387: 721–724,
1997.
Bunone, G., M. Borrello, R. Picetti, I. Bongarzone, F.
Peverali, V. De Franciscis, G. Della Valle, and M. Pierotti.
Induction of RET proto-oncogene expression in neuroblastoma
cells precedes neuronal differentiation and is not mediated by
protein synthesis. Exp. Cell Res. 217: 92–99, 1995.
Creedon, D. J., M. G. Tansey, R. H. Baloh, P. A. Osborne,
P. A. Lampe, T. J. Fahrner, R. O. Heuckeroth, J. Milbrandt,
and E. M. Johnson. Neurturin shares receptors and signal
transduction pathways with glial cell line-derived neurotrophic
factor in sympathetic neurons. Proc. Natl. Acad. Sci. USA 94:
7018–7023, 1997.
Deluca, L. M. Retinoids and their receptors in differentiation,
embryogenesis, and neoplasia. FASEB J. 5: 2924–2933, 1991.
Durbec, P., C. V. Marcos-Gutierrez, C. Kilkenny, M. Grigoriou, K. Wartiowaara, P. Suvanto, D. Smith, B. Ponder, F.
Costantini, M. Saarma, H. Sariola, and V. Pachnis. GDNF
signalling through the ret receptor tyrosine kinase. Nature 381:
789–793, 1996.
Durbec, P. L., L. B. Larsson-Blomberg, A. Schuchardt, F.
Costantini, and V. Pachnis. Common origin and developmental dependence on c-ret of subsets of enteric and sympathetic
neuroblasts. Development 122: 349–358, 1996.
Edery, P., C. Eng, A. Munnich, and S. Lyonnet. RET in
human development and oncogenesis. Bioessays 19: 389–395,
1997.
Gilbert, T., C. Cibert, E. Moreau, G. Géraud, and C. MerletBénichou. Early defect in branching morphogenesis of the
ureteric bud in induced nephron deficit. Kidney Int. 50: 783–795,
1996.
Gilbert, T., S. Gaonach, E. Moreau, and C. Merlet-Bénichou.
Defect of nephrogenesis by gentamicin in rat metanephric organ
culture. Lab. Invest. 70: 656–666, 1994.
Gilbert, T., J. Vilar, E. Moreau, and C. Merlet-Bénichou.
Modulation of c-ret and GDNF expression in rat metanephros
organ culture by retinoic acid (Abstract). Mol. Biol. Cell 7: 116a,
1996.
Grobstein, C. Inductive interaction in the development of the
mouse metanephros. J. Exp. Zool. 130: 319–340, 1955.
Hellmich, H., L. Kos, E. Cho, K. Mahon, and A. Zimmer.
Embryonic expression of glial cell-line derived neurotrophic
factor (GDNF) suggests multiple developmental roles in neural
differentiation and epithelial-mesenchymal interactions. Mech.
Dev. 54: 95–105, 1996.
Itoh, F., Y. Ishizaka, T. Tahira, M. Yamamoto, A. Miya, K.
Imai, A. Yachi, S. Takai, T. Sugimura, and M. Nagao.
Identification and analysis of the ret proto-oncogene promoter
region in neuroblastoma cell lines and medullary thyroid carcinomas from MEN2A patients. Oncogene 7: 1201–1206, 1992.
Iwamoto, T., M. Taniguchi, N. Asai, K. Ohkusu, I. Nakashima, and M. Takahashi. cDNA cloning of mouse ret
proto-oncogene and its sequence similarity to the cadherin
superfamily. Oncogene 8: 1087–1091, 1993.
Kinoshita, T., J. Imamura, H. Nagai, and K. Shimotohno.
Quantification of gene expression over a wide range by the
polymerase chain reaction. Anal. Biochem. 206: 231–235, 1992.
Klein, R. D., D. Sherman, W. H. Ho, D. Stone, G. L. Bennett,
B. Moffat, R. Vandlen, L. Simmons, Q. M. Gu, J. A. Hongo, B.
Devaux, K. Poulsen, M. Armanini, C. Nozaki, N. Asai, A.
Goddard, H. Phillips, C. E. Henderson, M. Takahashi, and
A. Rosenthal. A GPI-linked protein that interacts with Ret to
form a candidate neurturin receptor. Nature 387: 717–721, 1997.
Kotzbauer, P. T., P. A. Lampe, R. O. Heuckeroth, J. P.
Golden, D. J. Creedon, E. M. Johnson, and J. Milbrandt.
Neurturin, a relative of glial-cell-line-derived neurotrophic factor. Nature 384: 467–470, 1996.
Lechner, M. S., and G. R. Dressler. The molecular basis of
embryonic kidney development. Mech. Dev. 62: 105–120, 1997.
Means, A. L., and L. J. Gudas. The roles of retinoids in
vertebrate development. Annu. Rev. Biochem. 64: 201–233, 1995.
25. Mendelsohn, C., D. Lohnes, D. Décimo, T. Lufkin, M.
LeMeur, P. Chambon, and M. Mark. Function of the retinoic
acid receptors (RARs) during development. II. Multiple abnormalities at various stages of organogenesis in RAR double
mutants. Development 120: 2749–2771, 1994.
26. Moore, M., R. Klein, I. Farinas, H. Sauer, M. Armanini, H.
Phillips, L. Reichardt, A. Ryan, K. Carver-Moore, and A.
Rosenthal. Renal and neuronal abnormalities in mice lacking
GDNF. Nature 382: 76–79, 1996.
27. Nudel, U., R. Zakut, M. Shani, S. Neuman, Z. Levy, and D.
Yaffe. The nucleotide sequence of the rat cytoplasmic beta-actin
gene. Nucleic Acids Res. 11: 1759–1771, 1983.
28. Pachnis, V., B. Mankoo, and F. Costantini. Expression of the
c-ret proto-oncogene during mouse embryogenesis. Development
119: 1005–1017, 1993.
29. Pichel, J., L. Shen, H. Sheng, A. Granholm, J. Drago, A.
Grinberg, E. Lee, S. Huang, M. Saarma, B. Hoffer, H.
Sariola, and H. Westphal. Defects in enteric innervation and
kidney development in mice lacking GDNF. Nature 382: 73–76,
1996.
30. Sainio, K., P. Suvanto, J. Davies, J. Wartiovaara, K. Wartiovaara, M. Saarma, U. Arumae, X. Meng, M. Lindahl, V.
Pachnis, and H. Sariola. Glial-cell-line derived neurotrophic
factor is required for bud initiation from ureteric epithelium.
Development 124: 4077–4087, 1997.
31. Sanchez, M., I. Silos-Santiago, J. Frisen, B. He, S. Lira, and
M. Barbacid. Renal agenesis and the absence of enteric neurons
in mice lacking GDNF. Nature 382: 70–73, 1996.
32. Sanicola, M., C. Hession, D. Worley, P. Carmillo, C. Ehrenfels, L. Walus, S. Robinson, G. Jaworski, H. Wei, R. Tizard,
A. Whitty, R. B. Pepinsky, and R. L. Cate. Glial cell linederived neurotrophic factor-dependent RET activation can be
mediated by two different cell-surface accessory proteins. Proc.
Natl. Acad. Sci. USA 94: 6238–6243, 1997.
33. Saxén, L. Organogenesis of the Kidney, edited by P. Barlow, P.
Green, and C. Wylie. Cambridge, UK: Cambridge University
Press, 1987. (Dev. Cell Biol. Ser. 19)
34. Schaar, D., B. Sieber, C. Dreyfus, and I. Black. Regional and
cell-specific expression of GDNF in rat brain. Exp. Neurol. 124:
368–371, 1993.
35. Schuchardt, A., V. D’Agati, L. Larsson-Blomberg, F. Costantini, and V. Pachnis. Defects in the kidney and enteric nervous
system of mice lacking tyrosine kinase receptor Ret. Nature 367:
380–383, 1994.
36. Schuchardt, A., V. D’Agati, V. Pachnis, and F. Costantini.
Renal agenesis and hypodysplasia in ret-k(2) mutant mice result
from defects in ureteric bud development. Development 122:
1919–1929, 1996.
37. Schuchardt, A., S. Srinivas, V. Pachnis, and F. Costantini.
Isolation and characterisation of a chicken homolog of the c-ret
proto-oncogene. Oncogene 10: 641–649, 1995.
38. Suvanto, P., J. O. Hiltunen, U. Arumae, M. Moshnyakov, H.
Sariola, K. Sainio, and M. Saarma. Localization of glial cell
line-derived neurotrophic factor (GDNF) mRNA in embryonic rat
by in situ hybridization. Eur. J. Neurosci. 8: 816–822, 1996.
39. Tahira, T., Y. Ishizaka, F. Itoh, M. Nakayasu, T. Sugimura,
and M. Nagao. Expression of the ret proto-oncogene in human
neuroblastoma cell lines and its increase during neuronal differentiation induced by retinoic acid. Oncogene 6: 2333–2338, 1991.
40. Takahashi, M., Y. Buma, T. Iwamoto, Y. Inaguma, H. Ikeda,
and H. Hiai. Cloning and expression of the ret proto-oncogene
encoding a tyrosine kinase with two potential transmembrane
domains. Oncogene 3: 571–578, 1988.
41. Treanor, J., L. Goodman, F. de Sauvage, D. Stone, K.
Poulsen, C. Beck, C. Gray, M. Armanini, R. Pollock, F.
Hefti, H. Phillips, A. Goddard, M. Moore, A. Buj-Bello, A.
Davies, N. Asai, M. Takahashi, R. Vandlen, C. Henderson,
and A. Rosenthal. Characterization of a multicomponent receptor for GDNF. Nature 382: 80–83, 1996.
42. Trupp, M., E. Arenas, M. Fainzilber, A. S. Nilsson, B. A.
Sieber, M. Grigoriou, C. Kilkenny, E. Salazar-Grueso, V.
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.1 on October 2, 2016
11.
MODULATION OF RET BY RETINOIC ACID IN METANEPHROS
MODULATION OF RET BY RETINOIC ACID IN METANEPHROS
Pachnis, U. Arumae, H. Sariola, M. Saarma, and C. F.
Ibanez. Functional receptor for GDNF encoded by the c-ret
proto-oncogene. Nature 381: 785–789, 1996.
43. Vainio, S., and U. Muller. Inductive tissue interactions, cell
signaling, and the control of kidney organogenesis. Cell 90:
975–978, 1997.
44. Vega, Q. C., C. A. Worby, M. S. Lechner, J. E. Dixon, and
G. R. Dressler. Glial cell line-derived neurotrophic factor activates the receptor tyrosine kinase RET and promotes kidney
morphogenesis. Proc. Natl. Acad. Sci. USA 93: 10657–10661,
1996.
F945
45. Vilar, J., T. Gilbert, E. Moreau, and C. Merlet-Bénichou.
Metanephros organogenesis is highly stimulated by vitamin A
derivatives in organ culture. Kidney Int. 49: 1478–1487, 1996.
46. Warkany, J., and C. Roth. Congenital malformations induced
in rats by maternal vitamin A deficiency. J. Nutr. 35: 1–11, 1948.
47. Wilson, J. G., C. B. Royh, and J. Warkany. An analysis of the
syndrome of malformations induced by maternal vitamin A
deficiency. Effects of restoration of vitamin A at various times
during gestation. Am. J. Anat. 92: 189–217, 1953.
48. Wilson, J. G., and J. Warkany. Malformations in the genitourinary tract induced by maternal vitamin A deficiency in the
rat. Am. J. Anat. 83: 357–407, 1948.
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.1 on October 2, 2016