From www.bloodjournal.org by guest on October 2, 2016. For personal use only.
RAPID COMMUNICATION
A Novel Mutation in the Coding Sequence of the FY*B Allele of the Duffy
Chemokine Receptor Gene Is Associated With an Altered Erythrocyte Phenotype
By Niva Parasol, Marion Reid, Maria Rios, Lilian Castilho, Ilana Harari, and Nechama S. Kosower
The Duffy blood group system is of clinical and biological
significance. Antibodies to Duffy antigens are responsible for
some cases of transfusion incompatibility and newborn
hemolytic disease. The Duffy protein is a receptor for the
Plasmodium vivax erythrocyte-binding protein and is also a
receptor for various chemokines (thus renamed Duffy Antigen Receptor for Chemokines [DARC]). The two Duffy polymorphic antigens, Fya and Fyb (coded by the FY*A and FY*B
alleles), are present on erythrocyte membranes. The
Fy(a2b2) phenotype is the predominant one in populations
of black people and also occurs in other populations, including some non-Ashkenazi Jewish groups. The Fy(a2b2)
phenotype has been associated with a mutation in the FY*B
promoter at the GATA box that abolishes the expression of
erythrocyte Duffy protein. We describe here a novel muta-
tion, present in the FY*B coding sequence (271C = T), that is
associated with some Fy(b2) phenotypes among nonAshkenazi Jews and among Brazilian blacks. The mutation is
present in Fy(b2) individuals, who have wild-type FY*B
GATA and carry the previously described 304G = A substitution. The 271C = T and 304G = A can be identified by
restriction enzyme–generated restriction fragment length
polymorphisms. The 271C = T substitution represents a
considerable change in chemical nature (Arg91 = Cys), one
which may affect the antigenic determinants of DARC, and
thus be of clinical significance. The mutation may have
implications for some physiological roles of DARC and be of
interest in malaria research and in studies of population
genetics.
r 1998 by The American Society of Hematology.
T
African populations to infection by P vivax malarial parasites
has been attributed to the high incidence of Fy(a2b2) in these
populations.12 The Duffy protein has also been identified as a
receptor for various chemokines and renamed as Duffy Antigen
Receptor for Chemokines (DARC). DARC is expressed in
various tissues, where it has been identified in endothelial cells
lining postcapillary venules. It has also been identified in
cerebellar Purkinje cells. DARC may have important physiological functions in homeostatic processes in some brain regions
and in processes involving inflammatory chemokines.10,12-14
Several examples of erythrocytes have been described that
exhibit weak reactivity with some anti-Fyb sera, and no
reactivity with others, thereby giving apparent discrepancies
between the Fyb phenotype and genotype.3,12,15 In the course of
work on possible association of schizophrenia with Duffy
antigens,16,17 we found a sample for which the erythrocyte
phenotype of Fy(a2b2) (as determined by standard agglutination assays) did not correspond to the Duffy genotype. This
HE DUFFY BLOOD GROUP system is significant in
humans, and novel mutations with functional consequences, such as the one we report here, are of considerable
interest. The two Duffy polymorphic antigens, Fya and Fyb, are
carried on proteins produced by the Duffy gene alleles FY*A
and FY*B. The antisera, anti-Fya and anti-Fyb, define four
major erythrocyte Duffy phenotypes: Fy(a1b2), Fy(a2b1),
Fy(a1b1), and Fy(a2b2).1-3 The Fy(a2b2) phenotype is rare
among white and Asian populations, whereas it is the predominant phenotype among populations of black people, especially
those originating in West Africa.3 The gene, the first one to be
assigned to a specific autosome,4 has been mapped to 1q22-23.5
The gene has been cloned and sequenced6 and shown to have
two exons.7 The FY*A and FY*B alleles differ by a single-base
substitution at nucleotide 131 of the cDNA (A in FY*B and G in
FY*A), resulting in a polymorphism at amino acid residue 44,
with aspartic acid (Asp) in Fyb and glycine (Gly) in Fya.6-10 (The
numbering of nucleotides and amino acid residues used here is
according to the cDNA and predicted protein sequence based on
a single exon published by Chaudhuri et al.6 The amino acid 44
cited here would be amino acid 42, as predicted by Iwamoto et
al,7 based on a spliced transcript of two exons.) The presence of
guanine at this site generates a Ban I restriction site in FY*A,
thus allowing the identification of FY*A and FY*B by Ban I
restriction fragment length polymorphism (RFLP).9,10 A substitution of T to C at the GATA box of the FY*B promoter
(246T = C) (based on numbering by Tournamille et al11) has
been found in Fy(a2b2) black individuals.11 This mutation
disrupts the binding site for the GATA-1 erythroid transcription
factor, results in a silent FY*B allele in erythroid cells, and is
considered to be responsible for most cases of Fy(a2b2)
erythrocytes in the black populations.11 The GATA mutation
generates a Sty I restriction site, allowing the identification of
this mutation by RFLP.11
The Duffy gene product is a transmembrane glycoprotein of
35 to 43 kD. The Duffy antigens are important in transfusion
incompatibility and hemolytic disease of the newborn. In
addition, the Duffy protein is a receptor for the erythrocytebinding protein of Plasmodium vivax; the resistance in West
Blood, Vol 92, No 7 (October 1), 1998: pp 2237-2243
From the Department of Human Genetics, Sackler School of Medicine, Tel-Aviv University, Tel Aviv, Israel; the Department of Molecular
Genotyping, New York Blood Center, New York, NY; and the Blood
Services Center, Magen David Adom, Tel-Hashomer, Israel.
Submitted May 11, 1998; accepted July 9, 1998.
Supported in part by the Israel Mental Health Association (Enosh),
by the Pioneer Fund, and by the Igo Ornstein Chair for the Study of
Geriatrics (to N.S.K.); by a National Institutes of Health Specialized
Center of Research (SCOR) grant in Transfusion Medicine and Biology
No. HL54459 (to M.R.); and by Fundação de Amparo à Pesquisa do
Estado de São Paulo, Brazil (to L.C.). This work is in partial fulfillment
of the requirements for the PhD degree from Tel Aviv University (N.P.).
Address reprint requests to Nechama S. Kosower, MD, Department of
Human Genetics, Sackler School of Medicine, Tel-Aviv University, Tel
Aviv 69978, Israel; e-mail: nkosower@ccsg.tau.ac.il.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734 solely to indicate
this fact.
r 1998 by The American Society of Hematology.
0006-4971/98/9207-0057$3.00/0
2237
From www.bloodjournal.org by guest on October 2, 2016. For personal use only.
2238
PARASOL ET AL
sample was found to be FY*B/FY*B as determined by Ban I
RFLP, and only heterozygous for the mutation at the GATA box,
as identified by Sty I RFLP.11 DNA sequencing showed two
mutations in the coding sequence, a novel mutation at nucleotide (nt) 271 from C to T (271C = T), and the previously
reported mutation at nt 304 from G to A (304 G = A).8,13
Subsequently, polymerase chain reaction (PCR)-RFLP assays
were established to screen for these mutations. As described
here, the simultaneous presence of these two mutations resulted
in the silencing of the Fyb antigen in erythrocytes. This
phenomenon is of clinical significance and may have implications for physiological roles of DARC in tissues other than
erythrocytes, and it may be of interest in studies of population
genetics.
MATERIALS AND METHODS
Phenotyping of erythrocyte Duffy antigens. Blood samples were
from donors whose identity was unknown (unlinked). The Fy(b2)
samples were selected based on routine phenotyping of washed
erythrocytes with anti-Fya and anti-Fyb used according to the manufacturer’s instructions. Erythrocytes from the non-Ashkenazi Jews in Israel
were tested with antiserum from Gamma Biologicals Inc (Houston,
TX). Erythrocytes from Brazilian blacks were tested with antisera from
three companies (Gamma Biologicals Inc; Biotest-São Paulo, Brazil;
and DiaMed, Cressier sur Morat, Switzerland). It should be noted that
the serological testing used here does not distinguish between Fy(a2b2)
and Fy(a2bweak) erythrocyte phenotypes. Fy(a2bweak) erythrocytes
often type as Fy(a2b2) if only the usual anti-Fyb are used by routine
methods. Further testing with a variety of anti-Fyb reagents as well as a
quantitative adsorption and elution analysis have to be performed on
erythrocytes identified as Fy(b–) by standard agglutination assays, to
characterize such samples. DNA was prepared at the time of Fyb testing
and by the time that analysis of DNA showed the mutations described
here, erythrocytes were not available for further testing.
DNA preparation. White blood cells (WBCs) from whole blood
were obtained after erythrocyte lysis with a solution containing 155
mmol/L NH4Cl, 10 mmol/L KHCO3, and 1.0 mmol/L Na2-EDTA. The
washed pellets were suspended in buffer containing 10 mmol/L
Tris-HCl, pH 7.5, 75 mmol/L NaCl, 24 mmol/L EDTA, 0.5% sodium
dodecyl sulfate, and 150 µg proteinase K/mL, and kept for 4 hours at
55°C. Proteins were precipitated by salting out, using saturated NaCl
solution, vigorous mixing, and centrifugation.18 The supernatants were
mixed with cold ethanol. The precipitated DNA was solubilized in 10
mmol/L Tris-HCl, pH 7.5, 1.0 mmol/L EDTA. Alternatively, WBC
DNA was extracted using DNAzol Kit (GIBCO-BRL, Gaithersburg,
MD), according to the manufacturer’s recommendations. The DNA
solutions were analyzed for quality by agarose gel electrophoresis and
for quantity by optical density measurements at 260 nm.
DNA amplification. PCR was performed using 100 to 200 ng of
DNA, 3 pmol of each primer, 2 nmol of each dNTP, 1.0 U Taq
polymerase and buffer (Perkin Elmer, Norwalk, CT), in a total volume
of 40 µL. The primers used for PCR amplification, FY3, 58CCCTCTTGTGTCCCTCCCTTT, located at 2276 = 2256, and FY4,
58-CAGAGCTGCGAGTGCTACCTA, located at 385 = 365, were
designed to encompass the coding region containing nt 131 (site for
FY*A/FY*B polymorphism9,10), nt 271 (site of novel mutation described here), and nt 304 (site of mutation previously described8,13).
Reactions were performed in an automated thermal cycler (PTC 100 MJ
Research, Watertown, MA), with denaturation at 94°C for 4 minutes,
followed by 30 cycles of amplification (94°C, 1 minute; 60°C, 1 minute;
72°C, 1 minute) and a final extension at 72°C for 10 minutes. A second
PCR amplification of a DNA segment containing the GATA mutation
site (nt 246) was performed using the published conditions and primers
P38 and P3911 (here named FY1 and FY2).
RFLP analysis of PCR products. The restriction enzymes, buffers,
and details for their use were supplied by New England BioLabs
(Beverly, MA). For the identification of FY*A and FY*B, 15 µL of the
PCR product (DNA amplified by the FY3 and FY4 primers) was
digested with Ban I. The restriction fragments were resolved by
electrophoresis on 1% agarose gel. For the identification of the GATA
mutation, 25 µL of the PCR product (DNA amplified by the FY1 and
FY2 primers) was digested with Sty I,11 followed by electrophoresis on
12% acrylamide gel. For the identification of the 271C = T mutation,
10 µL of the PCR product (DNA amplified by the FY3 and FY4 primers)
was digested with Aci I, and for the identification of the 304G = A
mutation, 10 µL of the same PCR product was digested with Mwo I. The
restriction fragments were resolved on 1% agarose gel.
Nucleotide sequence analysis. The PCR-amplified fragments were
sequenced on both strands by thermocycling sequencing with automatic
377 DNA sequencer (Perkin Elmer). For the initial sample that showed
the discrepancy between the phenotype and genotype determined by
Ban I and Sty I [phenotype Fy(a2b2), and genotype FY*B/FY*B-46T
= C, ie, being only heterozygous for the GATA mutation], sequencing
was carried out between nt 2276 to nt 1944, on overlapping DNA
fragments, amplified by several primers. After the identification of the
271C = T and 304G = A mutations, other samples were sequenced
using FY3 for the PCR products generated by FY3 and FY4.
RESULTS
Alleles FY*A and FY*B in Fy(b2) phenotypes among
non-Ashkenazi Jews. Although the phenotype Fy(a2b2) is
known to be present in about 20% of Jews from Yemen and has
also been observed among other non-Ashkenazi Jews,19,20 there
is no published information on the genotypes among these
ethnic groups. Using the Ban I RFLP for the identification of the
FY*A and FY*B alleles,5-7 we analyzed the DNA samples of
unrelated individuals having Fy(a2b2) and Fy(a1b2) phenotypes (Fig 1). Among the Fy(a1b2) phenotypes, we found
FY*A/FY*A (lanes 4, 6, and 7) and FY*A/FY*B (lanes 3 and
9); the Fy(a2b2) phenotypes were found to be FY*B/FY*B
(lanes 5, 8, and 10). The Ban I restriction patterns of the PCR
products indicate that the FY*B allele is the silent one in the
Fy(a2b2) samples from non-Ashkenazi Jews, as is the case for
the Fy(a2b2) phenotypes in the black populations.10,11
The GATA mutation in Fy(b2), FY*B non-Ashkenazi Jews.
To determine whether the GATA mutation, identified in the
Fy(a2b2) black population,11 was associated with the Fy(b2)
phenotype among the non-Ashkenazi Jews, Sty I RFLP11 were
performed on PCR-amplified genomic DNA from samples of
Fy(a2b2) FY*B/FY*B, Fy(a1b2) FY*A/FY*A, and
Fy(a1b2) FY*A/FY*B (genotypes as identified by Ban I). As
can be seen in Fig 2, the Sty I RFLP identifies samples that are
homozygous and heterozygous for the mutation, with several
samples that exhibit discrepancy between their phenotypes and
genotypes, as determined by Ban I and Sty I RFLPs (genotypes
of samples shown in lanes 1, 2, 4, and 7 corresponded to their
phenotypes; genotypes of samples shown in lanes 3, 5, and 6 did
not correspond to their phenotypes). As shown in Table 1,
among 16 Fy(b2) individuals, the genotype corresponded to
the phenotype in 12: 6 individuals were Fy(a2b2), FY*B/
FY*B by Ban I and homozygous for the GATA mutation; 4
individuals were Fy(a1b2), FY*A/FY*B by Ban I and heterozygous for the GATA mutation; and 2 were Fy(a1b2),
From www.bloodjournal.org by guest on October 2, 2016. For personal use only.
NOVEL MUTATION IN DARC ASSOCIATED WITH ALTERED PHENOTYPE
2239
Fig 1. Ban I RFLP for the identification of FY*A and FY*B alleles in non-Ashkenazi Jews. DNA
was amplified using FY3 and FY4
primers for the amplification of a
DARC fragment containing the
131G 8 A substitution, responsible for FY*A and FY*B, respectively. Restriction fragments
were separated on 1% agarose
gel. (A) Schematic diagram of
fragments generated by the Ban
I digestion of FY*A and FY*B
DNA. (B) RFLP patterns of DNA
from samples with the indicated
phenotypes, identified by antisera (the 52- and 44-bp fragments are not detected in this
gel). Lanes: 1, 100-bp ladder; 2,
uncut; 3, 4, 6, 7, and 9, Fy (a1b2);
5, 8, and 10, Fy(a2b2).
FY*A/FY*A by Ban I and homozygous for the wild-type
promoter. In contrast, 4 individuals showed a discrepancy
between the phenotype and genotype: 2 individuals, who were
Fy(a2b2), FY*B/FY*B by Ban I, were only heterozygous for
the GATA mutation, and two individuals, who were Fy(a1b2),
FY*A/FY*B by Ban I, were homozygous for wild-type promoter, ie, lacked the GATA mutation. These results indicate that
in some of the Fy(b2) FY*B individuals among the nonAshkenazi Jews, some mutation(s) other than the GATA mutation is responsible for the erythrocyte ‘‘silent’’ FY*B.
Identification of mutations at nucleotides 271 and 304.
DNA from the first discordant sample, identified as Fy(a2b2)
FY*B/FY*B and heterozygous for the GATA mutation, was
sequenced and found to have two mutations in the coding
Fig 2. Sty I RFLP for the identification of the GATA mutation
(246 T 8 C). DNA was amplified
using FY1 and FY2 primers11 for
the amplification of a DARC fragment encompassing nt 246. The
restriction fragments were separated on 12% acrylamide gel. (A)
Schematic diagram of fragments
generated by Sty I digestion of
the DARC fragment encompassing nt 246 FY*B, GATA mutation. (B) RFLP patterns of DNA
from samples with the indicated
phenotyes, identified by antisera, and genotypes, as determined by Ban I (the 12-bp fragment is not detected in this
gel). Lanes: 1, 2, and 4, Fy
(a1b2)FY*A/FY*A; 3 and 7, Fy(ab-)FY*B/FY*B; 5 and 6, Fy
(a1b2)FY*A/FY*B.
From www.bloodjournal.org by guest on October 2, 2016. For personal use only.
2240
PARASOL ET AL
Table 1. Duffy Phenotypes and Genotypes in Fy(b2)
Non-Ashkenazi Jews
Samples
(n 5 16)
6
2
4
2
2
Phenotype
[Anti-Fya]†
[Anti-Fyb]
Genotype
FY*A, FY*B
[Ban I]†
Fy(a2b2) FY*B/FY*B
Fy(a2b2) FY*B/FY*B
Fy(a1b2) FY*A/FY*B
Fy(a1b2) FY*A/FY*B
Fy(a1b2) FY*A/FY*A
Genotype
FY, FY-‡
[Sty I]†
Genotype
271 (C = T)
[Aci I]†
Genotype
304 (G = A)
[Mwo I]†
FY-/FYFY/FYFY/FYFY/FY
FY/FY
C/C
T/C
C/C
T/C
C/C
G/G
A/G
G/G
A/G
G/G
†[ ], Identified by antisera, by restriction enzymes.
‡FY, wild-type GATA; FY-, GATA mutation.
sequence, as compared with the sequence of the wild FY*B
allele.8-10 The first one was a novel mutation of C = T at
nucleotide 271 (271C = T) and the second one was a
previously described mutation of G = A at nucleotide 304
(304G = A).8,13 Based on these mutations, PCR-RFLP were
developed for the identification of the mutations, Aci I RFLP for
271C = T (Fig 3) and Mwo I RFLP for 304G = A (Fig 4). As
can be seen in Table 1, all four individuals, whose GATA
genotypes did not correspond to their phenotypes were found to
be heterozygous for both mutations. The mutations detected by
RFLP using Aci I and Mwo I were further confirmed by
sequencing the PCR-amplified DNA of these samples. The
simultaneous presence of the 271C = T and 304G = A in the
discordant cases implies that these mutations are responsible for
some cases of Fy(b2), wild-type GATA erythrocytes among
Fy(b2) non-Ashkenazi Jews.
Identification of the 271C = T and 304G = A mutations
among Brazilian black Fy(b2) individuals. Thirty-four
Fy(a2b2) and 15 Fy(a1b2) samples from Brazilian black
people were analyzed for FY*A and FY*B alleles, using the
Ban I RFLP. As shown in Table 2, all Fy(a2b2) phenotypes
were homozygous for the FY*B allele. Among the Fy(a1b2),
3 were homozygous for FY*A and 12 were heterozygous,
FY*A/FY*B. These results correspond to those observed in
other studies on black populations,11,12 in which homozygosity
for the FY*B allele was found in Fy(a2b2), and homozygosity
for FY*A or heterozygosity for FY*A/FY*B was shown in
Fy(a1b2), as determined by Ban I RFLP. Analysis of the 49
samples with Sty I showed that 33 Fy(a-b-)FY*B/ FY*B were
homozygous for the GATA mutation; thus, their phenotype can
be accounted for by the GATA mutation. One Fy(a2b2)FY*B/
FY*B individual was heterozygous for the GATA mutation,
thus showing a discrepancy between his phenotype and genotype. Among the 15 Fy(a1b2) individuals, the FY and GATA
genotypes corresponded to their phenotypes in 12: as expected,
the three Fy(a1b2)FY*A/FY*A had the wild-type GATA and
9 Fy(a1b2)FY*A/FY*B were heterozygous for the GATA
mutation. In contrast, in three individuals, who were
Fy(a1b2)FY*A/FY*B, wild-type GATA was found. Thus, in
four individuals of the 49 analyzed, their Duffy phenotypes and
genotypes could not be explained by FY and GATA genotyping.
RFLP analysis by Aci I and Mwo I showed that all four
individuals were heterozygous for both the 271C = T mutation
and the 304G = A mutation. These two mutations were not
found in the other 45 Fy(b2) individuals, in whom the genotype
Fig 3. Aci I RFLP for the identification of the 271C 8 T mutation. DNA was amplified using
the FY3 and FY4 primers. Restriction fragments were separated
on 1% agarose gel. (A) Schematic diagram of fragments generated by Aci I digestion of
the DARC fragment encompassing nt 271. (B) RFLP patterns of
DNA from samples with the
indicated phenotypes, identified
by antisera, and genotypes,
determined by Ban I and Sty I
(FY*B 5 wild-type GATA; FY*B2 5
GATA mutation). Lanes: 1 through
3, Fy(a2b2)FY*B2/FY*B2; 4,
Fy(a2b2)FY*B/FY*B2; 5 through
7, Fy(a1b2)FY*A/FY*B2; 8, Fy
(a1b2)FY*A/FY*B.
From www.bloodjournal.org by guest on October 2, 2016. For personal use only.
NOVEL MUTATION IN DARC ASSOCIATED WITH ALTERED PHENOTYPE
2241
Fig 4. Mwo I RFLP for the
identification of the 304G 8 A
mutation. DNA was amplified using the FY3 and FY4 primers.
Restriction fragments were separated on 1% agarose gel. (A)
Schematic diagram of fragments
generated by Mwo I digestion of
the DARC fragment encompassing nt 304. (B) RFLP patterns of
DNA from samples with the indicated phenotypes, identified by
antisera, and genotypes, determined by Ban I and Sty I (FY*B 5
wild-type GATA; FY*B2 5 GATA
mutation). Lanes: 1 and 2,
Fy(a1b2)FY*A/FY*B; 3 and 8,
Fy(a2b2)FY*B/FY*B2; 4 and 5,
Fy(a1b2)FY*A/FY*B2; 6 and 7,
Fy (a2b2) FY*B2/FY*B2.
corresponded to the phenotype according to the FY and GATA
analysis (Table 2). These results show that, as in non-Ashkenazi
Jews, an FY*B mutation different from the common GATA
mutation in black populations is also associated with some
Fy(b2) phenotypes among the Brazilian blacks. The findings
indicate that the presence of both mutations result in an Fy(b2)
phenotype.
DISCUSSION
We describe here a novel mutation in the FY*B allele of the
Duffy chemokine receptor gene. This mutation, together with a
previously described mutation, results in erythrocyte Fy(b2)
phenotype as identified by standard agglutination assays (see
Materials and Methods). The phenotype Fy(a2b2), similarly
identified by standard reagents, is present in about 70% of both
American blacks2,3 and Brazilian blacks,21 and is also present in
non-Ashkenazi Jews, notably in about 20% of Yemenite Jews.19,20
The promoter GATA mutation in the FY*B allele11 accounts for
the Fy(b2) phenotype among African black populations.8-12 As
is shown here, the same mutation is prevalent among the
Brazilian blacks and is also found in the FY*B allele among
Table 2. Duffy Phenotypes and Genotypes in Fy(b2) Brazilian Blacks
Samples
(n 5 49)
33
1
9
3
3
Phenotype
[Anti-Fya]†
[Anti-Fyb]
Genotype
FY*A, FY*B
[Ban I]†
Fy(a2b2) FY*B/FY*B
Fy(a2b2) FY*B/FY*B
Fy(a1b2) FY*A/FY*B
Fy(a1b2) FY*A/FY*B
Fy(a1b2) FY*A/FY*A
Genotype
FY, FY-‡
[Sty I]†
Genotype
271 (C = T)
[Aci I]†
Genotype
304 (G = A)
[Mwo I]†
FY-/FYFY/FYFY/FYFY/FY
FY/FY
C/C
T/C
C/C
T/C
C/C
G/G
A/G
G/G
A/G
G/G
†[ ], Identified by antisera, by restriction enzymes.
‡FY, wild-type GATA; FY-, GATA mutation.
Fy(b2) non-Ashkenazi Jews. However, in some individuals
there appeared to be a discrepancy between their Fy(b2)
phenotype and genotype, with a discordant FY*B allele having
the promoter wild-type GATA. In these individuals, two mutations in the coding sequence (271C = T and 304G = A) were
found in the discordant FY*B allele.
Both mutations were identified among the Fy(b2)FY*B
non-Ashkenazi Jews and among the Brazilian blacks, suggesting an association with FY*B gene silencing in erythroid cells.
The 304G = A mutation, which codes for Ala = Thr at amino
acid residue 102, has been previously described in a study using
reverse transcriptase (RT)-PCR of placental RNA as a source
for cloning and sequencing of the Duffy gene.13 In another
study, the same mutation was found in Fy(a1b1) and Fy(a1b2)
samples.8 Based on these studies, the 304G = A mutation may
be a polymorphic one, as has been suggested.13 Further studies
are required to establish whether 304G = A is a polymorphic
mutation, whether the 271C = T mutation occurred in this
variant and whether the expression of both is necessary for the
Fy(b2) phenotype. It is of interest to note that according to the
proposed three-dimensional structure of DARC (involving
seven transmembrane segments),12 the amino acid 102 (amino
acid residue according to Chaudhuri et al6; residue 100 according to Iwamoto et al7) would be in the second transmembrane
segment, and a substitution of Ala = Thr might not lead to more
than a modest change in receptor properties The 271C = T
mutation, on the other hand, converts the residue 91 (amino acid
residue according to Chaudhuri et al6; residue 89 according to
Iwamoto et al7), assumed to be in the first cytoplasmic loop,
from Arg = Cys. This substitution represents a considerable
change in the chemical nature of the local region and may affect
the behavior of DARC and its extracellular antigenic sites.
The finding that a combination of two mutations within the
From www.bloodjournal.org by guest on October 2, 2016. For personal use only.
2242
PARASOL ET AL
coding sequence may result in an apparent erythrocyte Fy(b2)
phenotype raises several important questions. The promoter
GATA substitution, which impairs the binding site of the
erythroid transcription factor and results in a silent erythroid
FY*B allele and lack of erythrocyte Duffy receptor, does not
affect the expression of the gene in other cells.10-12 It is not
known at present whether the DARC Arg91 = Cys, Ala102 =
Thr mutant protein is present in the erythrocyte membranes.
The point mutations leading to amino acid substitutions would
be expected to allow the expression of the protein, albeit in a
possibly altered conformation and altered ligand-binding properties. However, it cannot be excluded that such mutations
result in a deficiency or absence of the protein (eg, due to failure
of being incorporated into the cell membrane, or being susceptible to degradation). It would be of interest to study whether
this DARC mutant is fully or partially expressed in or absent
from erythrocytes and from other cells. In addition, because the
spliced transcript may normally be the predominant one,7 it may
be relevant to find out whether there is any preferential effect on
the expression of one of the two transcripts6,7 in the mutant
cells. In any case, the overall phenotype of the mutant described
here is expected to be different from the GATA mutation,
because both the erythrocytes and other DARC expressing cells
would be affected by mutations in the coding sequence that alter
the expression and/or ligand-binding properties of the protein.
Additional studies on the binding of a variety of anti-Fyb,
including quantitative titrations of antibody binding, are necessary to determine whether the mutant erythrocytes described
here behave as a Fy(bweak) variant. It may be important to define
the properties of the mutant erythrocytes and other DARCexpressing cells for binding malarial parasites and chemokines.
It should also be pointed out that chemokine binding to DARC
has characteristics different from those of antibody binding,22
and that differences exist among various chemokines in their
interaction with DARC.23 Thus, DARC mutant erythrocytes
that do not bind anti-Fyb may nevertheless react with chemokines. Although the precise roles of DARC in various tissues are
not known at present, the properties of a mutant such as the one
described here may be of physiological significance.
In view of the importance of Duffy blood group system in
clinical medicine, eg, in cases of transfusion incompatibility
and hemolytic disease of the newborn,24,25 in forensic medicine,
and in malaria epidemiology, screening procedures are being
developed for detection of the known common variants and
mutations.26,27 The restriction enzyme–generated RFLPs described here provide a means for screening samples for the
271C = T and the 304G = A. Screening for these mutations in
samples identified as Fy(b2) and Fy(bweak) phenotypes would
be important both for clinical purposes and for population
genetic studies.
REFERENCES
1. Cutbush M, Mollison PL, Parkin DM: A new human blood group.
Nature 165:188, 1950
2. Sanger R, Race RR, Jack J: The Duffy blood groups of New York
negroes: The phenotype Fy(a2b2). Br J Haematol 1:370, 1955
3. Reid ME, Lomas-Francis C: The Blood Group Antigen Facts
Book. San Diego, CA, Academic, 1996
4. Donahue RP, Bias WB, Renwick JH, McKusick VA: Probable
assignment of the Duffy blood group locus to chromosome 1 in man.
Proc Natl Acad Sci USA 61:949, 1968
5. Mathew S, Chaudhuri A, Murty VV, Pogo AO: Confirmation of
Duffy blood group antigen locus (FY) at 1q22 = 23 by fluorescence in
situ hybridization. Cytogenet Cell Genet 67:68, 1994
6. Chaudhuri A, Polyakova J, Zbrzezna V, Williams K, Gulati S,
Pogo AO: Cloning of glycoprotein D cDNA, which encodes the major
subunit of the Duffy blood group system and the receptor for the
Plasmodium vivax malaria parasite. Proc Natl Acad Sci USA 90:10793,
1993
7. Iwamoto S, Li J, Omi T, Ikemoto S, Kajii E: Identification of a
novel exon and spliced form of Duffy mRNA that is the predominant
transcript in both erythroid and postcapillary venule endothelium.
Blood 87:378, 1996
8. Mallinson G, Soo KS, Schall TJ, Pisacka M, Anstee DJ: Mutations
in the erythrocyte chemokine receptor (Duffy) gene: The molecular
basis of the Fya/Fyb antigens and identification of a deletion in the Duffy
gene of an apparently healthy individual with the Fy(a2b2) phenotype.
Br J Haematol 90:823, 1995
9. Iwamoto S, Omi T, Kajii E, Ikemoto S: Genomic organization of
the glycophorin D gene: Duffy blood group Fya/Fyb alloantigen system
is associated with a polymorphism at the 44-amino acid residue. Blood
85:622, 1995
10. Chaudhuri A, Polyakova J, Zbrzezna V, Pogo AO: The coding
sequence of Duffy blood group gene in humans and simians: Restriction
fragment length polymorphism, antibody and malarial parasite specificities, and expression in nonerythroid tissues in Duffy-negative individuals. Blood 85:615, 1995
11. Tournamille C, Colin Y, Cartron JP, Le Van Kim C: Disruption of
a GATA motif in the Duffy gene promoter abolishes erythroid gene
expression in Duffy-negative individuals. Nature Genet 10:224, 1995
12. Hadley TJ, Peiper SC: From malaria to chemokine receptor: The
emerging physiologic role of the Duffy blood group antigen. Blood
89:3077, 1997
13. Neote K, Mak JY, Kolakowski LF Jr, Schall TJ: Functional and
biochemical analysis of the cloned Duffy antigen: Identity with the red
blood cell chemokine receptor. Blood 84:44, 1994
14. Horuk R, Martin A, Hesselgesser J, Hadley T, Lu ZH, Wang ZX,
Peiper SC: The Duffy antigen receptor for chemokines: Structural
analysis and expression in the brain. J Leukoc Biol 59:29, 1996
15. Murphy MT, Templeton LJ, Fleming J, Ferguson M, Peterkin M,
Fraser RH: Comparison of Fy(b) status as determined serologically and
genetically. Transf Med 7:135, 1997
16. Saha N, Tay JSH, Tsoi WF, Kua EH: Association of Duffy blood
group with schizophrenia in Chinese. Genetic Epidemiol 7:303, 1990
17. Kosower NS, Gerad L, Goldstein M, Parasol N, Zipser Y,
Ragolsky M, Rozencwaig S, Elkabetz E, Abramovitch Y, Lerer B,
Weizman A: Constitutive heterochromatin of chromosome 1 and Duffy
blood group alleles in schizophrenia. Am J Med Genet 60:133, 1995
18. Miller SA, Dykes DD, Polesky HF: A simple salting out
procedure for extracting DNA from human nucleated cells. Nucleic
Acids Res 16:1215, 1988
19. Race RR, Sanger R: Blood Groups in Man. Oxford, UK,
Blackwell Scientific, 1975
20. Sandler SG, Kravitz C, Sharon R, Hermoni D, Ezekiel E, Cohen
T: The Duffy blood group system in Israeli Jews and Arabs. Vox Sang
37:41, 1979
21. Silva RC, Castilho LM, Milare MS, Pellegrino J Jr: Distribution
of the Kell, Duffy and Kidd blood groups in blood donors. Rev Paul
Med 110(S):33, 1992 (abstr, suppl)
22. Tournamille C, Le Van Kim C, Gane P, Blanchard D, Proudfoot
AE, Cartron JP, Colin Y: Close association of the first and fourth
From www.bloodjournal.org by guest on October 2, 2016. For personal use only.
NOVEL MUTATION IN DARC ASSOCIATED WITH ALTERED PHENOTYPE
extracellular domains of the Duffy antigen/receptor for chemokines by a
disulfide bond is required for ligand binding. J Biol Chem 272:16274,
1997
23. Szabo MC, Soo KS, Zlotnik A, Schall TJ: Chemokine class
differences in binding to the Duffy antigen-erythrocyte chemokine
receptor. J Biol Chem 270:25348, 1995
24. Sosler SD, Perkins JT, Fong K, Saporito C: The prevalence of
immunization to Duffy antigens in a population of known racial
distribution. Transfusion 29:505, 1989
25. Sandler SG, Mallory D, Wolfe JS, Byrne P, Lucas DM:
Screening with monoclonal anti-Fy3 to provide blood for phenotype-
2243
matched transfusions for patients with sickle cell disease. Transfusion
37:393, 1997
26. Mullighan CG, Marshall SE, Fanning GC, Briggs DC, Welsh KI:
Rapid haplotyping of mutations in the Duffy gene using the polymerase
chain reaction and sequence-specific primers. Tissue Antigens 51:195,
1998
27. Olsson ML, Hansson C, Avent ND, Akesson IE, Green CA,
Daniels GL: A clinically applicable method for determining the
three major alleles at the Duffy (FY) blood group locus using
polymerase chain reaction with allele-specific primers. Transfusion
38:168, 1998
From www.bloodjournal.org by guest on October 2, 2016. For personal use only.
1998 92: 2237-2243
A Novel Mutation in the Coding Sequence of the FY*B Allele of the Duffy
Chemokine Receptor Gene Is Associated With an Altered Erythrocyte
Phenotype
Niva Parasol, Marion Reid, Maria Rios, Lilian Castilho, Ilana Harari and Nechama S. Kosower
Updated information and services can be found at:
http://www.bloodjournal.org/content/92/7/2237.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of
Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.