Inhibition of CCR2 Ameliorates Insulin Resistance
and Hepatic Steatosis in db/db Mice
Yukinori Tamura, Masayuki Sugimoto, Toshinori Murayama, Yukihiko Ueda, Hiroshi Kanamori,
Koh Ono, Hiroyuki Ariyasu, Takashi Akamizu, Toru Kita, Masayuki Yokode, Hidenori Arai
Downloaded from http://atvb.ahajournals.org/ by guest on October 2, 2016
Objective—Recently, adipose tissue inflammation induced by macrophage infiltration through MCP-1/C-C chemokine
receptor-2 (CCR2) pathway is considered to play a role in the development of visceral obesity and insulin resistance.
In the present study, to further examine the role of CCR2 in the development of obesity and type 2 diabetes, we studied
the effect of pharmacological inhibition of CCR2 from the early stage of obesity in db/db mice.
Methods and Results—Db/⫹m (lean control) and db/db mice were fed with a standard diet with or without 0.005%
propagermanium, as a CCR2 inhibitor for 12 weeks from 6 weeks of age. Propagermanium treatment decreased body
weight gain, visceral fat accumulation, and the size of adipocytes only in db/db mice. Further, propagermanium
suppressed macrophage accumulation and inflammation in adipose tissue. Propagermanium treatment also ameliorated
glucose tolerance and insulin sensitivity, and decreased hepatic triglyceride contents in db/db mice.
Conclusions—Propagermanium improved obesity and related metabolic disorders, such as insulin resistance and hepatic
steatosis by suppressing inflammation in adipose tissue. Our data indicate that inhibition of CCR2 could improve obesity
and type 2 diabetes by interfering adipose tissue inflammation, and that propagermanium may be a beneficial drug for
the treatment of the metabolic syndrome. (Arterioscler Thromb Vasc Biol. 2008;28:2195-2201.)
Key Words: cytokines 䡲 diabetes mellitus 䡲 insulin resistance 䡲 macrophages 䡲 receptors
T
drome,5,9 suggesting that inflammatory changes in the adipose tissue may contribute to the development of many
aspects of the metabolic syndrome and result in type 2
diabetes and atherosclerosis.
Recent studies have demonstrated that obese adipose tissue
is characterized by increased infiltration of macrophages,
suggesting that they are important sources of inflammation in
adipose tissue.10,11 C-C chemokine receptor-2 (CCR2),
known as a receptor for MCP-1, play a role in monocyte/
macrophage recruitment and macrophage-dependent inflammatory response and the development of atherosclerosis.12
Mouse models have demonstrated that adipose tissue macrophages (ATMs) accumulation via the MCP-1/CCR2 pathway
both necessary and sufficient for the development of insulin
resistance with obesity. Mice with targeted deletions in the
genes for MCP-1 or CCR2 have decreased ATM content,
decreased inflammation in adipose tissue, and protection
from high-fat diet–induced insulin resistance.13,14 In contrast,
mice overexpressing MCP-1 have increased numbers of
ATMs along with increased insulin resistance.13,15 Although
these data suggest that the recruitment of ATMs through
MCP-1/CCR2 is required for the development of type 2
diabetes with obesity, the effect of postnatal inhibition of
he metabolic syndrome, characterized by a clustering of
visceral obesity, impaired glucose tolerance, hypertension, and dyslipidemia, is a major cause of type 2 diabetes
mellitus and cardiovascular disease.1 Visceral obesity and
insulin resistance are thought to represent common underlying factors of the syndrome.2 Therefore, it is very important
to clarify the mechanism of the development of obesity and
insulin resistance and to establish the therapeutic method
based on its mechanism.
Many reports have shown that obesity is associated with a
state of chronic, low-grade inflammation, suggesting that
inflammation may be a potential mechanism whereby obesity
leads to insulin resistance.3 Indeed, obesity and insulin
resistance are strongly associated with systemic markers of
inflammation, and clinically, inflammation has been recognized as a major predictor of atherosclerotic disease.3,4
The adipose tissue is an important endocrine organ that
secretes many biologically active molecules, such as leptin,
adiponectin, tumor necrosis factor (TNF-␣), and monocyte
chemoattractant protein 1 (MCP-1), which are collectively
termed adipocytokines.5– 8 Dysregulated production of proinflammatory and antiinflammatory adipocytokines seen in
visceral fat obesity is associated with the metabolic syn-
Original received April 14, 2008; final version accepted September 7, 2008.
From the Departments of Clinical Innovative Medicine (Y.T., M.S., T.M., M.Y.), Cardiovascular Medicine (Y.U., K.O., T.K.), Nephrology (H.K.), and
Geriatric Medicine (H.A.), Kyoto University Graduate School of Medicine (H.A., T.A.), Translational Research Center, Kyoto University Hospital (H.A.,
T.A.), Japan.
Correspondence to Hidenori Arai, MD, PhD, Department of Geriatric Medicine, Kyoto University Graduate School of Medicine, 54 Kawahara-cho,
Shogoin, Sakyo-ku, Kyoto, 606-8507, Japan. E-mail harai@kuhp.kyoto-u.ac.jp
© 2008 American Heart Association, Inc.
Arterioscler Thromb Vasc Biol is available at http://atvb.ahajournals.org
2195
DOI: 10.1161/ATVBAHA.108.168633
2196
Arterioscler Thromb Vasc Biol
December 2008
CCR2 on obesity and type 2 diabetes during the development
of these pathological states is not fully understood.
An organic germanium compound, propagermanium, has
been clinically used for the treatment of hepatitis B virus–
induced chronic hepatitis in Japan. Previous studies demonstrated that this drug potently inhibits the infiltration of
macrophages in vivo and in vitro.16,17 One of the mechanisms
of this drug is mediated through the inhibition of CCR2
function.16
In the present study, we examined the preventive effect of
administration with propagermanium from the early stage of
obesity on the development of obesity-associated metabolic
disorders and type 2 diabetes in db/db mice.
Methods
glucose (1.5 g/kg body mass). For insulin tolerance tests, mice were
injected i.p. with human regular insulin (0.5 U/kg for db/⫹m and 2
U/kg for db/db mice; Eli Lilly and Co). Blood samples were
collected before and after injection, and plasma glucose concentration was measured with a Glutest Ace (Sanwa Kagaku Kenkyusho
Co).
Measurement of Hepatic Triglyceride Content
Hepatic triglyceride contents were measured as previously described.13 Tissue triglyceride contents were expressed mg/mg
protein.19
Histological Analysis
Macrophage in epididymal fat pads were visualized by F4/80
immunostaining and quantified as described previously.14 The size
of adipocyte area was measured with the use of Image Pro plus
software version 3.0.1 (Media Cybernetics Inc).
Downloaded from http://atvb.ahajournals.org/ by guest on October 2, 2016
Materials
Statistical Analysis
Propagermanium (3-oxygemylpropinic acid polymer) was kindly
provided by Sanwa Kagaku Kenkyusho Co (Nagoya, Japan).
All data were expressed as means⫾SD. The statistical significance
of differences was assessed by the unpaired t test and 1-way
ANOVA. Differences with P⬍0.05 were regarded as significant. All
statistical analyses were performed using StatView version 5.0
software (SAS Institute).
Animal Preparation and Experimental Design
Male db/db mice and db/⫹m mice were obtained from Charles River
(Yokohama, Japan) at 5 weeks of age. Two kinds of mice were
divided further into 2 groups (control and drug treated, n⫽10 in each
group). The mice were fed with normal chow without additional
supplementation (nontreated group) or with chow supplementation
with 0.005% propagermanium (propagermanium-treated group) for
12 weeks from 6 weeks of age. This concentration of propagermanium in the feeding chow results in a dose of 5 mg/kg body weight
per day in each mouse, adjusted by preceded measurement of food
intake. This dose of the drug had no significant effect on normal
mice17 and never caused death in this study. The IC50 value for
propagermanium inhibition of CCR2 is 0.52 ␮g/mL.16 Animals were
provided with the diet and water ad libitum and were maintained on
a 12-hour light/dark cycle. All animal experiments were conducted
according to the Guidelines for Animal Experiments at Kyoto
University School of Medicine.
Body Fat Composition Analysis
For computed tomography (CT) analysis of body fat composition,
mice were anesthetized with intraperitoneal injections of pentobarbital sodium (Nembutal; Dainippon Sumitomo Pharma Co Ltd) and
then scanned using a LaTheta (LCT-100 mol/L) experimental animal
CT system (Aloka).18 Contiguous 5-mm slice images between head
and tail were used for quantitative assessment using LaTheta
software (version 1.00). Visceral fat, subcutaneous fat, and muscle
were distinguished and evaluated quantitatively.
Quantitative Real-Time Polymerase
Chain Reaction
Total RNA was extracted from frozen adipose tissue (200 mg) and
liver tissue (50 mg) using RNeasy mini kit (Qiagen). The cDNA was
synthesized from total RNA using Super Script III (Invitrogen).
Real-time PCR was performed on an ABI PRISM 7700 using the
SYBR GREEN PCR Master Mix (Applied Biosystems). Primer sets
were shown supplemental Table I (available online at http://atvb.
ahajournals.org). The mRNA levels were normalized relative to the
amount of 18s rRNA mRNA and expressed in arbitrary units.
Analysis of Metabolic Parameters
Plasma insulin concentration was measured with an insulin assay kit
(Morinaga Institute of Biological Science). Cholesterol and triglyceride were measured with Cholesterol E and Triglyceride E test
(Wako pure Chemical Industries Ltd), respectively. Plasma adiponectin level was measured with an adiponectin ELISA kit (Otsuka
Pharmaceutical Co Ltd) For glucose tolerance tests, mice were
deprived of food for 16 to 24 hours and then injected i.p. with
Results
Inhibition of CCR2 Suppressed Body Weight Gain
With No Effect on Food Intake in Obese Mice
Propagermanium treatment had no effect on body weight in
db/⫹m mice. In db/db mice, however, propagermanium treatment caused a decrease in body weight compared with control
group. We found no difference in food intake with or without
propagermanium treatment in both db/⫹m and db/db mice (data
not shown), indicating that propagermanium suppressed weight
gain only in db/db mice without causing appetite loss.
Effect of Inhibition of CCR2 on Lipid and Glucose
Metabolism in db/db Mice
There was no difference in the fasting plasma triglyceride (TG)
or total cholesterol (T-Cho) between nontreated and
propagermanium-treated db/⫹m mice. However, propagermanium treatment reduced fasting plasma TG, whereas propagermanium had no effect on plasma T-Cho in db/db mice (Table).
No difference was observed in fasting blood glucose,
HbA1c, or plasma insulin concentrations with or without
propagermanium treatment in db/⫹m mice. In db/db mice,
however, propagermanium treatment significantly reduced
fasting blood glucose, HbA1c, and insulin concentrations
compared with control group (Table).
To evaluate the effect of propagermanium on glucose
metabolism, we next conducted an intraperitoneal insulin
tolerance test (IPITT) and glucose tolerance test (IPGTT).
Propagermanium treatment had no effect on insulin sensitivity or glucose tolerance in db/⫹m mice (Figure 1A and
1B, left). However, propagermanium-treated db/db mice
showed a significant decrease of plasma glucose in response to insulin compared with nontreated db/db mice
(Figure 1A center). Meanwhile, propagermanium-treated
db/db mice showed a significant decrease of plasma
glucose compared with nontreated db/db mice at 15, 30,
60, and 120 minutes after intraperitoneal injection of
glucose (Figure 1B center), indicating improved glucose
Tamura et al
Table.
Role of CCR2 Insulin Resistance and Hepatic Steatosis
2197
Characteristics of db/tm and db/db Mice Treated With or Without Propagermanium
db/m (18 Weeks of Age)
db/db (18 Weeks of Age)
db/db (9 Weeks of Age)
Con
Pro
Con
Pro
Con
Pro
Body weight, g
32.1⫾1.0
33.3⫾1.4
54.1⫾3.5
47.0⫾4.3**
41.3⫾1.2
41.2⫾1.6
Plasma glucose, mg/dl
75.6⫾9.9
81.7⫾8.6
540.4⫾103.3
436.8⫾83.3**
347.7⫾79.5
333.3⫾86.3
HbA1c, %
2.6⫾0.1
2.5⫾0.1
9.4⫾0.7
8.0⫾1.4**
7.1⫾1.0
7.4⫾0.5
Plasma insulin, ng/ml
1.1⫾0.6
1.3⫾0.8
3.4⫾0.7
1.9⫾0.7**
1.9⫾0.4
Plasma TG, mg/dl
87.2⫾9.9
88.0⫾23.1
164.4⫾49.9
117.6⫾31.6**
117.8⫾25.0
98.3⫾30.0
Plasma T-Cho, mg/dl
90.6⫾11.4
81.6⫾9.9
203.3⫾16.3
208.5⫾22.9
155.8⫾26.3
148.4⫾23.0
1.3⫾0.2**
Results are expressed as mean⫾SD. ** P⬍0.01 vs control group in each mice.
Downloaded from http://atvb.ahajournals.org/ by guest on October 2, 2016
tolerance by propagermanium treatment. In addition,
propagermanium treatment increased expression of glucose transporter-2 and 4 (GLUT2, 4) mRNA in adipose
tissue, liver, and muscle (supplemental Figure IIIA
through IIIE), suggesting that propagermanium improved
insulin action in all insulin sensitive organs in db/db mice.
Furthermore, we observed that propagermanium decreased
plasma insulin concentration (Table) and improved insulin
sensitivity and glucose tolerance (Figure 1A and 1B, right)
in weight-matched db/db mice at 9 weeks of age, suggesting that propagermanium improves insulin resistance before the suppression of weight gain in db/db mice.
Effect of Inhibition of CCR2 on Adiposity in
Obese Mice
Propagermanium treatment reduced visceral fat mass only in
db/db mice (supplemental Figure IA and IB). Epididymal fat
mass was also decreased in propagermanium-treated db/db
mice compared with nontreated db/db mice (supplemental
Figure IC).
We next measured adipocyte size by histological analysis.
Although propagermanium treatment had no effect on average adipocyte size in db/⫹m mice (1702⫾84 versus
1660⫾100 ␮m2; Figure 2A), the average adipocyte size of
propagermanium-treated db/db mice was 40% lower than
those of nontreated db/db mice (4332⫾960 versus 7588⫾
1360 ␮m2; P⬍0.001).
Adipose tissue expression of adiponectin mRNA was
markedly decreased in db/db mice by 50% compared with
nontreated db/⫹m mice at 18 weeks of age (Figure 2C).
However, propagermanium treatment increased adipose
tissue adiponectin expression by 1.4-fold in db/db mice
at 18 weeks of age. Similar to the gene expression,
propagermanium-treated db/db mice showed 1.3-fold
higher plasma adiponectin levels than nontreated db/db
mice (17.1⫾0.9 versus 13.0⫾0.9 ␮g/mL; P⬍0.01; Figure
2C). In weight-matched db/db mice at 9 weeks of age,
propagermanium increased expression of adiponectin
mRNA (supplemental Figure IIB), but not plasma adiponectin level (supplemental Figure VA).
Effect of Inhibition of CCR2 on ATM
Accumulation and Adipose Tissue Inflammation
in Obese Mice
The percentage of F4/80-positive cells in adipose tissue was
increased in db/db mice compared with db/⫹m mice
(38.1⫾10.3 versus 4.3⫾1.0%; P⬍0.001; Figure 3A). However, propagermanium treatment reduced macrophage infiltration in adipose tissue of db/db mice (24.6⫾8.1 versus
38.1⫾10.3%; P⬍0.001; Figure 3A). Consistently, F4/80
(Emr1) and CD68 mRNA levels were significantly decreased
in propagermanium-treated db/db mice compared with nontreated db/db mice, whereas propagermanium had no effect
on the expression of F4/80 and CD68 mRNA in db/⫹m mice,
Figure 1. A and B, The
response of plasma glucose to
single intraperitoneal injection
of insulin (A) or glucose (B) in
db/⫹m at 18 weeks of age
(left), db/db mice at 18 weeks
of age (center) and 9 weeks of
age (right) with (closed triangle)
or without (open circle)
propagermanium treatment.
*P⬍0.05, **P⬍0.01 vs nontreated db/db mice (n⫽8 per
group).
2198
Arterioscler Thromb Vasc Biol
December 2008
Figure 2. A, A representative
histological picture of the adipose tissue in db/⫹m and
db/db mice at 18 weeks of
age (nontreated (Con) and
propagermanium-treated (Pro),
magnification 100x, bar;
100 ␮m). B and C, Mean area
size of the adipocyte (B),
expression of adiponectin
mRNA and plasma adiponectin
level (C) in nontreated (open
columns) or propagermaniumtreated (closed columns)
db/⫹m and db/db mice.
*P⬍0.05, **P⬍0.01 vs nontreated db/db mice (n⫽7 to 9
per group).
Downloaded from http://atvb.ahajournals.org/ by guest on October 2, 2016
indicating that propagermanium reduced ATM accumulation
only in obese mice (Figure 3B). In accordance with the results
of macrophage infiltration, MCP-1 and TNF-␣ mRNA expression in adipose tissue was markedly reduced in
propagermanium-treated db/db mice by 60% and 65%, respectively, compared with nontreated db/db mice (Figure
3C). We also observed that propagermanium treatment reduced ATM accumulation and suppressed adipose inflammation in adiposity-matched db/db mice at 9 weeks of age
(supplemental Figure IIA and IIB), suggesting that propagermanium suppresses adipose tissue inflammation by reduction of ATM content in obese mice.
Effect of Inhibition of CCR2 on Hepatic Steatosis
in Obese Mice
Liver tissue appearance in nontreated db/db mice was more
whitish in color than that in db/⫹m mice. However, the liver
in propagermanium-treated db/db mice looked more dark-red
than that in nontreated db/db mice (Figure 4A). The liver
weight was increased by 2-fold in nontreated db/db mice
compared with nontreated db/⫹m mice (3.4⫾0.3 versus
1.3⫾0.4 g, P⬍0.001). However, the liver weight of
propagermanium-treated db/db mice was reduced by 30%
compared with that of nontreated db/db mice (2.3⫾0.1 versus
3.4⫾0.3 g, P⬍0.01). Similarly, nontreated db/db mice had
more than 3-fold higher hepatic TG contents than nontreated
db/⫹m mice (0.66⫾0.23 versus 0.18⫾0.08 mg/mg protein;
P⬍0.001; Figure 4A). Propagermanium-treated db/db mice
showed 45% lower hepatic TG contents than nontreated
db/db mice (0.34⫾0.08 versus 0.66⫾0.23 mg/mg protein,
P⬍0.01). Consistently, the expression of sterol regulatory
element binding protein-1c (SREBP-1c), a transcription factor that regulates the expression of genes important in lipid
synthesis, was decreased by 30% in propagermanium-treated
db/db mice, suggesting that reduced hepatic TG content by
propagermanium treatment is caused by a decrease in hepatic
lipogenesis (Figure 4B).
Expression of TNF-␣ mRNA in the liver was increased in
db/db mice compared with db/⫹m mice, and its increase was
Figure 3. A, Macrophage content of white adipose tissue as
assessed by F4/80 staining
(bar; 50 ␮m). The fraction of
ATMs (F4/80-stained cells/
total cells) in eWAT of nontreated (open columns) or
propagermanium-treated (closed
columns) db/⫹m and db/db
mice (n⫽7 per group). B and
C, Expression of Emr1 (F4/80),
CD68 (B), MCP-1, TNF-␣
mRNA (C) in eWAT of nontreated (open columns) or
propagermanium-treated
(closed columns) db/⫹m and
db/db mice (n⫽8 per group).
*P⬍0.05, **P⬍0.01 vs nontreated db/db mice.
Tamura et al
Role of CCR2 Insulin Resistance and Hepatic Steatosis
Downloaded from http://atvb.ahajournals.org/ by guest on October 2, 2016
Figure 4. A through C, Liver appearance of nontreated (Con) or
propagermanium-treated (Pro) db/⫹m and db/db mice and
hepatic TG contents (A), expression of SREBP-1c mRNA (B),
and TNF-␣ mRNA (C) in nontreated (open columns) or
propagermanium-treated (closed columns) db/⫹m and db/db
mice are shown (n⫽8 per group). *P⬍0.05, **P⬍0.01 vs nontreated db/db mice.
inhibited by propagermanium treatment (Figure 4C) suggesting that propagermanium also suppresses the liver tissue
inflammation. In addition, we also detected amelioration of
hepatic steatosis and hepatic inflammation in adipositymatched db/db mice at 9 weeks of age (supplemental Figure
IIC and IID).
Discussion
In this study, we have clearly shown that treatment with
propagermanium improved obesity, insulin resistance, and
hepatic steatosis by inhibiting macrophage infiltration into
adipose tissue through the suppression of CCR2 function
during the development of obesity in db/db mice.
Propagermanium has been used as a therapeutic agent
against hepatitis B virus–induced chronic hepatitis in Japan.
Previous reports showed that propagermanium reduces
monocyte/macrophage infiltration into the liver and inhibits
liver damage in 2 different experimental mouse liver injury
models.17,20 In addition, another report showed that propagermanium attenuates atherogenesis via the inhibition of macrophage infiltration into the lesion area in apoE-deficient
mice.21 Furthermore, Yokochi et al demonstrated that this
drug suppressed monocyte migration in vitro and macrophage
infiltration in vivo.16 Thus the inhibition of CCR2 function is
shown as a potential mechanism of this drug. It does not
affect the function of other chemokines, such as interleukin
(IL)-8 or RANTES, except MCP-1 and MCP-3, which are the
ligands for CCR2. These results suggest that the inhibitory
effect of propagermanium on monocyte migration would be
CCR2 dependent. The molecular mechanism of the action
of propagermanium has been shown that it targets
glycosylphosphatidylinositol-anchored proteins that are
closely associated with CCR2 and interferes with MCP-1–
induced monocyte chemotaxis.16
In this study we demonstrated that inhibition of CCR2
function by propagermanium treatment reduced macrophage
infiltration in adipose tissue. We also found that propagermanium treatment suppressed adipose tissue inflammation, as
2199
well as decreased TNF-␣ and MCP-1 expression. Recent data
suggest that the expression of proinflammatory cytokines by
adipose tissue is in part attributable to the expression of these
cytokines by nonadipocytes, including macrophages.10,11,22
Further, Suganami et al have recently developed an in vitro
coculture system composed of adipocytes and macrophages
and demonstrated that a paracrine loop involving free fatty
acids (FFAs) and TNF-␣ derived from adipocytes and macrophages, respectively, establishes a vicious cycle that augments the inflammatory changes in both adipocytes and
macrophages: ie, marked upregulation of proinflammatory
cytokines such as MCP-1 and TNF-␣ and downregulation of
antiinflammatory cytokine adiponectin.23 These reports and
our results suggest that macrophage infiltration via CCR2
play a pivotal role in the induced inflammatory changes and
dysregulated adipokine expression in adipose tissue.
Recent investigation suggests that adipose tissue inflammatory changes contribute to the development of insulin
resistance. It has been shown that adipose tissue– derived
proinflammatory cytokines such as TNF-␣ and IL-6 can
actually cause insulin resistance in experimental models.6,24,25
In this study, propagermanium treatment only for 3 weeks
reduced plasma IL-6 level in db/db mice (supplemental
Figure VB), suggesting that propagermanium suppressed
systemic inflammation by inhibiting ATM accumulation in
db/db mice. Further, TNF-␣ dose-dependently reduces the
expression of adiponectin in adipocytes by suppressing its
promoter activity.26 Adiponectin works as an insulinsensitizing agent,27,28 and hence a decrease in plasma adiponectin is related to insulin resistance in obesity. In this
study, we observed that adiponectin expression in adipose
tissue and plasma adiponectin level decreased in db/db mice
compared with db/⫹m mice, as well as impaired insulin
sensitivity and glucose tolerance. However, we could improve insulin resistance by propagermanium treatment possibly by suppressing adipose tissue inflammation and increasing plasma adiponectin level. This result strongly suggests
that dysregulated adipokine expression and secretion induced
by macrophage infiltration through CCR2 causes insulin
resistance in obesity.
In the present study, we successfully ameliorated hepatic
steatosis by propagermanium treatment in db/db mice. Several reports suggest that insulin resistance contributes to the
development of hepatic steatosis by impairing the ability of
insulin to suppress lipolysis, leading to increased delivery of
FFAs to the liver.29,30 In this study, propagermanium decreased hepatic expression of CD36, which takes up FFA into
liver, and hepatic FFA in db/db mice at 18 weeks of age, but
not at 9 weeks age (supplemental Figure IV). These findings
suggest that propagermanium decreases FFA influx into liver
in db/db mice. Increased de novo lipogenesis may also
contribute to hepatic fat accumulation. This increased de
novo lipogenesis may be a result of insulin resistance and the
resulting hyperinsulinemia in subjects with hepatic steatosis,
as insulin stimulates lipogenic enzymes via SREBP-1c even
in an insulin-resistant state.31 Thus, improved hyperinsulinemia and decreased SREBP-1c by propagermanium treatment
could also be involved in amelioration of hepatic steatosis.
2200
Arterioscler Thromb Vasc Biol
December 2008
Downloaded from http://atvb.ahajournals.org/ by guest on October 2, 2016
We also observed that propagermanium treatment markedly suppressed liver inflammation, as shown by decreased
MCP-1 and TNF-␣ expression. Cai et al reported that
inflammatory gene expression increases in liver along with
the increase in adiposity, without increasing a number of
Kupffer cells,32 suggesting that hepatocyte lipid accumulation
by increasing FFA delivery from adipose tissue might induce
a subacute inflammatory response in the liver. Further, Arkan
et al showed that suppression of liver-specific inflammatory
response by hepatocyte-specific deletion of IKK␤ protects
from high fat diet-induced systemic insulin resistance and
hepatic steatosis in mice.33 These reports suggest that liver
tissue inflammation is responsible for impairment of systemic
insulin resistance and hepatic steatosis. Therefore, suppression of liver inflammation through the reduction of FFAs
delivery from adipose tissue and lipogenesis in liver by
propagermanium treatment might also cause amelioration of
insulin resistance and hepatic steatosis in db/db mice. However, we also found that propagermanium decreased expression of CD68 mRNA in liver of db/db mice (supplemental
Figure VI). Therefore, propagermanium might affect Kupffer
cell number or activity in liver of db/db mice.
We found that inhibition of CCR2 by propagermanium
treatment suppressed body weight gain mainly by reducing
visceral fat mass and liver weight without affecting food
intake in db/db mice. Although Weisberg et al report that
obese CCR2-deficient mice induced by HFD had lower body
weight compared with obese wild-type mice, they discussed
that this phenomenon may be caused by modulated feeding
behavior by deletion of CCR2 in central nerve system.14 In
the present study, however, oral inhibition of CCR2 did not
affect food intake, suggesting that propagermanium might not
affect CCR2 function in central nerve system. In addition, we
found that propagermanium treatment only for 3 weeks
increased the enzymes associated lipid oxidation including
carnithine palmitoyltransferase (CPT) and acyl-coenzyme A
(CoA) oxidase (ACOX) in muscle and liver of db/db mice as
well as reduction of plasma IL-6 level (supplemental Figures
III and VB). These data suggest suppressed systemic inflammation by propagermanium treatment causes increased energy expenditure in db/db mice. Furthermore, we detected an
increase in plasma adponectin by propagermanium treatment
in db/db mice from 15 weeks of age (supplemental Figure
VA). MCP-1– deficient mice, which develop improved insulin resistance, showed a decrease in adiposity as reduced fat
pad weight and adipocyte size, and an increase in plasma
adiponectin level.13 Further, Fruebis et al reported that exogenous administration of globular adiponectin induced weight
loss by increasing FFA oxidation in muscle of obese mice.27
Thus an increase in plasma adiponectin by propagermanium
treatment might cause further suppression of obesity in db/db
mice. Therefore, we suggest that insulin resistance, which is
induced by dysregulated production of adipokines, contributes to the development of obesity.
Furthermore, the present beneficial effects of propagermanium treatment, such as suppressed weight gain, adipose
tissue inflammation, and increased insulin sensitivity and
reduced hepatic TG contents, were observed only in db/db
mice, not in db/⫹m mice. Macrophage contents and expres-
sion of proinflammatory cytokines in adipose tissue of
db/⫹m mice are limited. Therefore, these data strongly
suggest that effects of propagermanium are associated with
macrophage-dependent inflammatory responses induced by
obesity. However, further study using a pure CCR2 antagonist34 would be necessary for the confirmation of these
findings.
In summary, we have shown that blockade of CCR2
function ameliorated both insulin resistance and hepatic
steatosis along with decreased macrophage infiltration into
adipose tissue and liver of obese mice. Our results thus
suggest that CCR2 plays an important role in the pathogenesis of the metabolic syndrome and propagermanium may be
a promising drug for treatment of the metabolic syndrome.
Acknowledgments
We thank Ayumi Hosotani (Kyoto University) for excellent technical
assistance, and Maki Tsujita (Nagoya city university) for advice for
our experiments.
Sources of Funding
This study was supported by Grants-in Aid from the Ministry of
Education, Science, Sports, Culture, and Technology of Japan and a
research grant for health sciences from the Japanese Ministry of
Health and Welfare.
Disclosures
None.
References
1. Grundy SM, Brewer HB Jr, Cleeman JI, Smith SC Jr, Lenfant C. Definition of metabolic syndrome: Report of the National Heart, Lung, and
Blood Institute/Am Heart Association conference on scientific issues
related to definition. Circulation. 2004;109:433– 438.
2. Kahn BB, Flier JS. Obesity and insulin resistance. J Clin Invest. 2000;
106:473– 481.
3. Dandona P, Aljada A, Bandyopadhyay A. Inflammation: the link between
insulin resistance, obesity and diabetes. Trends Immunol. 2004;25:4 –7.
4. Semenkovich CF. Insulin resistance and atherosclerosis. J Clin Invest.
2006;116:1813–1822.
5. Matsuzawa Y, Funahashi T, Nakamura T. Molecular mechanism of metabolic syndrome X: contribution of adipocytokines adipocyte-derived
bioactive substances. Ann N Y Acad Sci. 1999;892:146 –154.
6. Hotamisligil GS, Shargill NS, Spiegelman BM. Adipose expression of
tumor necrosis factor-alpha: direct role in obesity-linked insulin
resistance. Science. 1993;259:87–91.
7. Sartipy P, Loskutoff DJ. Monocyte chemoattractant protein 1 in obesity
and insulin resistance. Proc Natl Acad Sci U S A. 2003;100:7265–7270.
8. Takahashi K, Mizuarai S, Araki H, Mashiko S, Ishihara A, Kanatani A,
Itadani H, Kotani H. Adiposity elevates plasma MCP-1 levels leading to
the increased CD11b-positive monocytes in mice. J Biol Chem. 2003;
278:46654 – 46660.
9. Lyon CJ, Law RE, Hsueh WA. Minireview: adiposity, inflammation, and
atherogenesis. Endocrinology. 2003;144:2195–2200.
10. Weisberg SP, McCann D, Desai M, Rosenbaum M, Leibel RL, Ferrante
AW Jr. Obesity is associated with macrophage accumulation in adipose
tissue. J Clin Invest. 2003;112:1796 –1808.
11. Xu H, Barnes GT, Yang Q, Tan G, Yang D, Chou CJ, Sole J, Nichols A,
Ross JS, Tartaglia LA, Chen H. Chronic inflammation in fat plays a
crucial role in the development of obesity-related insulin resistance.
J Clin Invest. 2003;112:1821–1830.
12. Boring L, Gosling J, Cleary M, Charo IF. Decreased lesion formation in
CCR2⫺/⫺ mice reveals a role for chemokines in the initiation of atherosclerosis. Nature. 1998;394:894 – 897.
13. Kanda H, Tateya S, Tamori Y, Kotani K, Hiasa K, Kitazawa R, Kitazawa
S, Miyachi H, Maeda S, Egashira K, Kasuga M. MCP-1 contributes to
macrophage infiltration into adipose tissue, insulin resistance, and hepatic
steatosis in obesity. J Clin Invest. 2006;116:1494 –1505.
Tamura et al
Role of CCR2 Insulin Resistance and Hepatic Steatosis
Downloaded from http://atvb.ahajournals.org/ by guest on October 2, 2016
14. Weisberg SP, Hunter D, Huber R, Lemieux J, Slaymaker S, Vaddi K,
Charo I, Leibel RL, Ferrante AW Jr. CCR2 modulates inflammatory and
metabolic effects of high-fat feeding. J Clin Invest. 2006;116:115–124.
15. Kamei N, Tobe K, Suzuki R, Ohsugi M, Watanabe T, Kubota N,
Ohtsuka-Kowatari N, Kumagai K, Sakamoto K, Kobayashi M, Yamauchi
T, Ueki K, Oishi Y, Nishimura S, Manabe I, Hashimoto H, Ohnishi Y,
Ogata H, Tokuyama K, Tsunoda M, Ide T, Murakami K, Nagai R,
Kadowaki T. Overexpression of monocyte chemoattractant protein-1 in
adipose tissues causes macrophage recruitment and insulin resistance.
J Biol Chem. 2006;281:26602–26614.
16. Yokochi S, Hashimoto H, Ishiwata Y, Shimokawa H, Haino M, Terashima Y, Matsushima K. An anti-inflammatory drug, propagermanium,
may target GPI-anchored proteins associated with an MCP-1 receptor,
CCR2. J Interferon Cytokine Res. 2001;21:389 –398.
17. Ishiwata Y, Yokochi S, Hashimoto H, Ninomiya F, Suzuki T. Protection
against concanavalin A-induced murine liver injury by the organic germanium compound, propagermanium. Scand J Immunol. 1998;48:
605– 614.
18. Oike Y, Akao M, Yasunaga K, Yamauchi T, Morisada T, Ito Y, Urano T,
Kimura Y, Kubota Y, Maekawa H, Miyamoto T, Miyata K, Matsumoto
S, Sakai J, Nakagata N, Takeya M, Koseki H, Ogawa Y, Kadowaki T,
Suda T. Angiopoietin-related growth factor antagonizes obesity and
insulin resistance. Nat Med. 2005;11:400 – 408.
19. Tomimoto S, Tsujita M, Okazaki M, Usui S, Tada T, Fukutomi T, Ito S,
Itoh M, Yokoyama S. Effect of probucol in lecithin-cholesterol
acyltransferase-deficient mice: inhibition of 2 independent cellular cholesterol-releasing pathways in vivo. Arterioscler Thromb Vasc Biol. 2001;
21:394 – 400.
20. Yokochi S, Ishiwata Y, Hashimoto H, Ninomiya F, Suzuki T. Hepatoprotective effect of propagermanium on Corynebacterium parvum and
lipopolysaccharide-induced liver injury in mice. Scand J Immunol. 1998;
48:183–191.
21. Yamashita T, Kawashima S, Ozaki M, Namiki M, Inoue N, Hirata K,
Yokoyama M. Propagermanium reduces atherosclerosis in apolipoprotein
E knockout mice via inhibition of macrophage infiltration. Arterioscler
Thromb Vasc Biol. 2002;22:969 –974.
22. Di Gregorio GB, Yao-Borengasser A, Rasouli N, Varma V, Lu T, Miles
LM, Ranganathan G, Peterson CA, McGehee RE, Kern PA. Expression of
CD68 and macrophage chemoattractant protein-1 genes in human adipose
and muscle tissues: association with cytokine expression, insulin
resistance, and reduction by pioglitazone. Diabetes. 2005;54:2305–2313.
23. Suganami T, Nishida J, Ogawa Y. A paracrine loop between adipocytes
and macrophages aggravates inflammatory changes: role of free fatty
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
2201
acids and tumor necrosis factor alpha. Arterioscler Thromb Vasc Biol.
2005;25:2062–2068.
Hotamisligil GS, Spiegelman BM. Tumor necrosis factor alpha: a key
component of the obesity-diabetes link. Diabetes. 1994;43:1271–1278.
Klover PJ, Clementi AH, Mooney RA. Interleukin-6 depletion selectively
improves hepatic insulin action in obesity. Endocrinology. 2005;146:
3417–3427.
Maeda N, Takahashi M, Funahashi T, Kihara S, Nishizawa H, Kishida K,
Nagaretani H, Matsuda M, Komuro R, Ouchi N, Kuriyama H, Hotta K,
Nakamura T, Shimomura I, Matsuzawa Y. PPARgamma ligands increase
expression and plasma concentrations of adiponectin, an adipose-derived
protein. Diabetes. 2001;50:2094 –2099.
Fruebis J, Tsao TS, Javorschi S, Ebbets-Reed D, Erickson MR, Yen FT,
Bihain BE, Lodish HF. Proteolytic cleavage product of 30-kDa adipocyte
complement-related protein increases fatty acid oxidation in muscle and
causes weight loss in mice. Proc Natl Acad Sci U S A. 2001;98:
2005–2010.
Maeda N, Shimomura I, Kishida K, Nishizawa H, Matsuda M, Nagaretani
H, Furuyama N, Kondo H, Takahashi M, Arita Y, Komuro R, Ouchi N,
Kihara S, Tochino Y, Okutomi K, Horie M, Takeda S, Aoyama T,
Funahashi T, Matsuzawa Y. Diet-induced insulin resistance in mice
lacking adiponectin/ACRP30. Nat Med. 2002;8:731–737.
Marchesini G, Brizi M, Bianchi G, Tomassetti S, Bugianesi E, Lenzi M,
McCullough AJ, Natale S, Forlani G, Melchionda N. Nonalcoholic fatty
liver disease: a feature of the metabolic syndrome. Diabetes. 2001;50:
1844 –1850.
Luyckx FH, Lefebvre PJ, Scheen AJ. Non-alcoholic steatohepatitis: association with obesity and insulin resistance, and influence of weight loss.
Diabetes Metab. 2000;26:98 –106.
Tamura S, Shimomura I. Contribution of adipose tissue and de novo
lipogenesis to nonalcoholic fatty liver disease. J Clin Invest. 2005;115:
1139 –1142.
Cai D, Yuan M, Frantz DF, Melendez PA, Hansen L, Lee J, Shoelson SE.
Local and systemic insulin resistance resulting from hepatic activation of
IKK-beta and NF-kappaB. Nat Med. 2005;11:183–190.
Arkan MC, Hevener AL, Greten FR, Maeda S, Li ZW, Long JM,
Wynshaw-Boris A, Poli G, Olefsky J, Karin M. IKK-beta links inflammation to obesity-induced insulin resistance. Nat Med. 2005;11:191–198.
Kitagawa K, Wada T, Furuichi K, Hashimoto H, Ishiwata Y, Asano M,
Takeya M, Kuziel WA, Matsushima K, Mukaida N, Yokoyama H.
Blockade of CCR2 ameliorates progressive fibrosis in kidney. Am J
Pathol. 2004;165:237–246.
Downloaded from http://atvb.ahajournals.org/ by guest on October 2, 2016
Inhibition of CCR2 Ameliorates Insulin Resistance and Hepatic Steatosis in db/db Mice
Yukinori Tamura, Masayuki Sugimoto, Toshinori Murayama, Yukihiko Ueda, Hiroshi
Kanamori, Koh Ono, Hiroyuki Ariyasu, Takashi Akamizu, Toru Kita, Masayuki Yokode and
Hidenori Arai
Arterioscler Thromb Vasc Biol. 2008;28:2195-2201; originally published online September 25,
2008;
doi: 10.1161/ATVBAHA.108.168633
Arteriosclerosis, Thrombosis, and Vascular Biology is published by the American Heart Association, 7272
Greenville Avenue, Dallas, TX 75231
Copyright © 2008 American Heart Association, Inc. All rights reserved.
Print ISSN: 1079-5642. Online ISSN: 1524-4636
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://atvb.ahajournals.org/content/28/12/2195
Data Supplement (unedited) at:
http://atvb.ahajournals.org/content/suppl/2008/09/26/ATVBAHA.108.168633.DC1.html
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Arteriosclerosis, Thrombosis, and Vascular Biology can be obtained via RightsLink, a service of the
Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for
which permission is being requested is located, click Request Permissions in the middle column of the Web
page under Services. Further information about this process is available in the Permissions and Rights
Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Arteriosclerosis, Thrombosis, and Vascular Biology is online
at:
http://atvb.ahajournals.org//subscriptions/
Supplementary Methods
Materials
Antibodies directed to total AMPK, phosphorylated (Thr172) AMPKα and β-actin were
purchased from Cell Signaling. Antibodies directed to CD36 was purchased from R&D
systems Inc.
Quantitative Real-time PCR
Total RNA was extracted from frozen adipose tissue (200 mg), liver and muscle tissue
(50 mg) using RNeasy mini kit (Qiagen, Valencia, CA). The cDNA was synthesized
from total RNA using Super Script III (Invitrogen). Real-time polymerase chain
reaction was performed on an ABI PRISM 7700 using the SYBR GREEN polymerase
chain reaction Master Mix (Applied Biosystems, Warrington, UK). Primer sets were
following; CD36 forward; TGTACCTGGGAGTTGGCGAG, CD36 reverse;
CTGCTGTTCTTTGCCACGTC,
Acyl
CoA
oxidase
forward;
ATGAATCCCGATCTGCGCAAGGAGC,
Acyl
CoA
oxidase
reverse;
AAAGGCATGTAACCCGTAGCACTCC,
CPT1a
forward;
GTCCCAGCTGTCAAAGATAC, CPT1a reverse; GGAAGTATTGAAGAGTCGC,
CPT1b
forward;
CAAGTTCAGAGACGAACGCC,
CPT1b
reverse;
TCAAGAGCTGTTCTCCGAACTG, HSL forward; CTGCTGACCATCAACCGAC,
HSL
reverse;
CGATGGAGAGAGTCTGCA,
LPL
forward;
TTCTCCTCCTACTCCTCCTC, LPL reverse; TGTCCTCAGCTGTGTCTTCA,
GLUT4
forward;
CATGGCTGTCGCTGGTTTC,
GLUT4
reverse;
AAACCCATGCCGACAATGA, GLUT2 forward; GGCTAATTTCAGGACTGGTT,
GLUT2
reverse;
TTTCTTTGCCCTGACTTCCT,
β-actin
forward;
TACCACAGGCATTGTGATGG, β-actin reverse; TTTGATGTCACGCACGATTT, The
mRNA levels were normalized relative to the amount of β-actin and expressed in
arbitrary units.
Immunoblot analysis
Cell lysates were prepared by the addition of lysis buffer (cell signaling). After heated at
95 °C for 5 min, equal protein concentrations of the cell lysates were subjected to
SDS-polyacrylamide (12%) gel electrophoresis and transferred onto nitrocellulose
membranes (PROTRAN, Schleicher & Schuell) by electroblotting. After preincubation
with blocking buffer (PBS containing 0.1% Tween 20 and 5% nonfat dry milk) for 1 h
at room temperature, blotted membranes were incubated with each primary antibody for
1 h at room temperature or overnight at 4 °C, followed by washing twice with blocking
buffer. Membranes were then incubated with a horseradish peroxidase-conjugated
anti-mouse or anti-rabbit IgG (Amersham) for 30 min at room temperature, followed by
washing three times in PBS containing 0.1% Tween 20, and visualized by ECL western
blotting detection reagents (Amersham)
Measurement of adipocytokine concentration
Plasma IL-6 was measured by ELISA kit (eBioscience). Plasma resistin was measured
by ELISA kit (R&D systems)
Measurement of hepatic free fatty acid contents
For determination of hepatic free fatty acid contents in db/+m and db/db mice, liver
tissue (50 mg) was homogenized for 2 min at 20 Hz in 500 ml PBS with a Mixer Mill
MM 300 (Retsch GmbH & Co, Haan, Germany). The tissue-suspending solution (equal
to 0.1 mg protein) was adjusted 1.25 ml with PBS and was added with 5 ml
chloroform/methanol (2:1, vol/vol), and was extracted for 16 hours at 4℃. The extract
was centrifuged at 2000 g for 20 min. The organic layer was collected and dried and the
residue was dissolved in isopropanol and assayed for free fatty acid content with a
NEFA C test (Wako). Tissue free fatty acid contents were expressed µmol/mg protein.
Supplementary Figure Legend
Supplementary Figure 1
A: Representative CT images of propagermanium-treated (Pro) or non-treated (Con)
db/+m and db/db mice at the L3 level. B, C: CT-estimated amount of visceral fat weight
(B), and epididymal fat weight (C) in propagermanium-treated (closed columns) or
non-treated (open columns) db/+m and db/db mice. Values are expressed as means ±
S.D. *, p<0.05; **, p<0.01; vs. non-treated db/db mice (n=8 per group).
Supplementary Figure 2
A, B; Effect of propagermanium on the fraction of ATMs (F4/80-stained cell/ total cell)
in eWAT (A), adipokine expression in eWAT (B) of db/db mice at 9 weeks of age. C;
Effect of propagermanium on hepatic TG content in db/db mice at 9 weeks of age. D;
Effect of propagermanium on TNF-alpha and SREBP-1c expression in liver of db/db
mice at 9 weeks of age. Values are expressed as means ± S.D. *, p<0.05 and **, p<0.01
compared with non-treated db/db mice (n=9 per group).
Supplementary Figure 3
A, B; Effect of Pro treatment on expression of CPT1a (carnithine palmitoyltransferase
1a) , ACOX (acyl CoA oxidase) and GLUT2 mRNA in liver from db/m and db/db mice
at 18 weeks (A), 9 weeks (B) of age. C, D; Effect of Pro treatment on expression of
CPT1b, ACOX and GLUT4 mRNA in muscle from db/+m and db/db mice at 18 weeks
(C), 9 weeks (D) of age. E; Effect of Pro treatment on expression of GLUT4 mRNA in
adipose tissue from db/db mice at 9 weeks of age. F; Effect of Pro treatment on
expression of Phospho-AMPK (p-AMPK) and total AMPK (t-AMPK) protein in liver
and muscle from db/db mice at 18 weeks of age. Values are expressed as mean±SD. *;
p<0.05 vs db/db control (n=10 in each group).
Supplementary Figure 4
A, B; Effect of Pro treatment on expression of CD36 protein (A) and mRNA (B) in liver
from db/m or db/db mice at 9, 18 weeks of age. C; Effect of Pro treatment on free fatty
acid content in liver from db/m or db/db mice at 18 weeks of age. Values are expressed
as mean±SD. *; p<0.05, **; p<0.01 vs db/db control (n=10 in each group).
Supplementary Figure 5
A; Time-dependent effect of Pro treatment on plasma adiponectin level in db/+m and
db/db mice. B; Effect of Pro treatment on plasma IL-6 level in db/+m and db/db mice at
9, 18 weeks of age. Values are expressed as mean±SD. *; p<0.05, **; p<0.01 vs db/db
control (n=10 in each group).
Supplementary Figure 6
A, B; Effect of Pro treatment on expression of CD68 mRNA in liver of db/+m and
db/db mice at 18 weeks (A) or 9 weeks (B) of age. Values are expressed as mean±SD.
*; p<0.05, **; p<0.01 vs db/db control (n=10 in each group).