Expression of Basic Fibroblast Growth Factor and Its
Receptor in the Retina of Royal College of Surgeons Rats
A Comparative Study
Piroska E. Rakoczy* Martin F. Humphrey,^ Dinah M. Cavaney,^ Yi Chu,"\ and IanJ. Constable*
Purpose. The aim of this study was to identify whether abnormalities in the synthesis of basic
fibroblast growth factor (bFGF) or its receptor (bFGF-R) were responsible for the photoreceptor dystrophy in Royal College of Surgeons (RCS) rats.
Methods. The polymerase chain reaction was used to detect the expression of bFGF and bFGFR messenger RNA in the retinal pigment epithelial (RPE) cells and the neural retina of RCS
dystrophic rats and in PVG/C and RCS-rrf)>+ control animals.
Results. In the RPE, it was found that there was no significant difference in the expression of
bFGF and bFGF-R between RCS rats and the controls at the ages of 21 days and 3 mo. In the
neural retina, the level of bFGF expression was lower in the 21-day-old RCS rats compared
with the control group, but bFGF-R expression was as strong as in the PVG/C and RCS-rd)>+
animals. However, in 3-mo-old RCS rat neural retina, the bFGF and bFGF-R expression was
found to be significantly lower than in the control animals.
Conclusions. Although the mutant gene in RCS rats is expressed in the RPE cells, these results
suggest that there is no significant defect in bFGF or bFGF-R expression in the RPE cells of
RCS rats, which would be an initiating factor in the development of photoreceptor degeneration in these animals. The lowered bFGF levels in the neural retina at early stages (postnatal
day 21) may explain the prolongation of photoreceptor survival when exogenous bFGF is
injected. Invest Ophthalmol Vis Sci. 1993; 34:1845-1852.
JLJegeneration of photoreceptors leads to permanent
blindness because, in common with other central nervous system neuronal cells, they cannot be replaced by
cell division in adults. The Royal College of Surgeons
(RCS) mutant strain of rats with inherited retinal dys-
From the *Linns Eye institute, Department of Surgery, University of Western
Australia, and Ike -[Western Australia Retinitis Pigmentosa Research Centre,
NedUinds, Western Australia, Australia.
Supported l/y the Western Australian Retinitis Pigmentosa Foundation (Perth), the
Australian Retinitis Pigmentosa Association (Spence), and the Lions Save-Sight
Foundation (Perth), Australia.
Submitted for publication: July 21, 1992; accepted November IS, 1992.
Proprietary interest category: N.
Reprint requests: Piroska F. Rakoczy, Lions Eye Institute, 2 Verdun Street,
Nedlands 6009, Western Australia, Australia.
Invesiiguiive Ophthalmology & Visual Science, April 1993, Vol. 34, No. 5
Copyright © Association for Research in Vision and Ophthalmology
trophy has been used widely as a model to study photoreceptor degeneration.1 Although this particular
type of defect is not common in humans, the procedures that prolong photoreceptor survival in this condition may be more widely applicable.
The cellular nature of the genetic abnormality in
RCS rats is known, but the underlying molecular defect has not yet been identified. In the RCS rat, the
retinal pigment epithelium (RPE) does not phagocytose shed outer segments,2 thus resulting in accumulation of membranous debris in the subretinal space and
subsequent death of the rod photoreceptors. Transplantation of RPE cells from normal rats results in
long-term (5 mo after treatment) rescue of photore-
1845
1846
Investigative Ophthalmology & Visual Science, April 1993, Vol. 34, No. 5
ceptors and significantly reduces the debris zone
thickness.34 By contrast, sham-injected surgical control animals and macrophage transplantation all reduce the thickness of the debris zone but have no
long-term effect on photoreceptor cell survival.5 It
was observed that the photoreceptor rescue effect extended beyond the immediate boundaries of the transplanted normal RPE cells,3"5 which suggested a possible trophic action of diffusible factors.
Fibroblast growth factors (aFGF and bFGF)
emerged as possible candidates because they are
known to be present in the retina67 and RPE cells,8
and bFGF is known as a neurotrophic agent.9 In 1990,
it was demonstrated that subretinal and intravitreal
injection of bFGF at the beginning of photoreceptor
degeneration (postnatal day 23) results in a delay of
photoreceptor degeneration in RCS rats.10 Widespread photoreceptor rescue was detected across almost the entire retina for at least 2 mo. The mechanism of the rescue effect is not understood, but a possible neurotrophic role for bFGF in the retina was
suggested by the authors. Thus, bFGF may have a general protective effect on compromised photoreceptors
because there is preliminary evidence that it can decrease the photoreceptor loss caused by excessive light
exposure.10 The role of bFGF in normal retinal development is not well understood.11 It is possible that
bFGF normally maintains the photoreceptors and that
a defect in this system in the RCS rat is the prime
stimulus for photoreceptor cell death. In addition,
other effects of bFGF could be important. For example, vascular endothelial cells are known to respond to
bFGF,12 and the vessel ingrowth to the retina could be
controlled by it. Abnormalities occur in the retinal and
choroidal vasculature of the RCS rat as early as 3 mo
after birth.13 At later stages of the degeneration, when
all the photoreceptors have been lost, considerable
neovascularization occurs.14 The aim of this study was
to identify any possible abnormalities in the bFGF and
bFGF receptor (bFGF-R) messenger RNA expression
in the neural retina and RPE cells of RCS rats.
MATERIALS AND METHODS
Experimental Animals
This research adhered to the ARVO Statement on the
Use of Animals in Ophthalmic and Vision Research.
The rats (PVG/C, RCS-rdy+, and RCS) were deeply
anesthetized, the eyes enucleated, and the animals
then killed. The eyes were immersed in HEPES buffered Hank's salt solution, and the cornea, iris, and lens
were removed. The sclera and choroid were gently
peeled away, the optic nerve head was excised, and the
retina with attached RPE layer was then flattened by
making radial cuts. It was placed with the pigment
layer down onto a 0.45-^m membrane filter (Sartor-
ius, Gottingen, Germany).15 A second membrane filter
was then gently placed on the top of the retina. The
resulting retinal sandwich was immersed in HEPES
buffered Hank's salt solution and incubated for 30
min at 37°C. After incubation, the RPE and the neural
retina were easily separated, snap frozen in liquid nitrogen, and stored at —70°C until use.
At each stage, the retinas and RPE were examined
histologically and compared with the intact eye. After
separation, the filters with attached tissue were immersed in 1.25% glutaraldehyde and 3% paraformaldehyde in 0.1 mol/1 phosphate buffer, pH 7.4, overnight. These were then dehydrated in a graded ethanol
series and embedded in Epon/Araldite (Fluka Chemie
A. G., Bruchs, Switzerland) using a Lynx tissue processor (Australian Biomedical Corporation, Mount Waverly, Australia). We cut 1-2-jiim thick sections, counterstained them with toluidine blue, and examined
them with the light microscope.
Extraction of RNA
Filters containing neural retinas and RPE cells were
pooled (two animals, each of the same type and age)
and extracted using a modified published method.16
Briefly, immediately after removal from the freezer,
four filters were homogenized in 1 ml of denaturing
solution (4 mol/1 guanidinium thiocyanate, 25 mmol/1
sodium citrate, pH 7.0, 0.5% sarcosyl, and 0.1 mol/1
2-mercaptoethanol) with an Ultra Turrax homogenizer (IKA Labortechnik, Staufen, Germany) for 1-2
min (minimum) at medium speed at room temperature. After homogenization 0.1 ml of 2 mol/1 sodium
acetate, pH 4.0, 1 ml of phenol, and 0.2 ml of chloroform-isoamyl alcohol (49:1) mixture were added to
the homogenate. The final suspension was mixed, incubated on ice for 15 min, and then centrifuged at
10,000 X g for 20 min at 4°C. The aqueous phase was
removed and extracted further with 0.2 ml chloroform-isoamyl alcohol. The RNA that was present in
the aqueous phase was precipitated with one volume
of isopropanol at —20°C for 1 hr. The precipitated
RNA was dissolved in 100 ml of denaturing solution,
and an equal volume of isopropanol was added. It was
stored at —70°C until use. Before use, the RNA was
recovered by centrifugation, washed with 75% ethanol, and vacuum dried. The dry pellet was resuspended in 20 ml of water, and the amount of RNA was
measured by spectrophotometry at 260 nm."
Oligonucleotide Primer and Probe Selection
and Synthesis
Oligonucleotide primers and probes were selected using the Automatic Sequence Alignment program from
DNA Sequence Analysis Software (International Biotechnologies, New Haven, CT). Upstream and downstream primers and specific oligonucleotide probes
were selected from known bFGF and bFGF-receptor
1847
bFGF and Its Receptor in Rats
DNA sequences1819 listed in GenBank (Table 1). Upstream and downstream primers for the amplification
of rat /3-actin was synthesized as published earlier,20
and the specific oligonucleotide probe was selected by
DNA analysis. All primers were purified using OPC
cartridges (rapid purification cartridges, Applied Biosystems, Richmond, CA). Oligonucleotide probes
were purified by ethanol precipitation.
Polymerase Chain Reaction (PCR)
Amplification of bFGF and bFGF-R
Messenger RNA
From the freshly recovered total RNA, 3 mg was subjected to DNase I digestion (Boehringer Mannheim,
Mannheim, Germany) at 37°C for 45 min. PCR amplifications were performed using a GeneAmp RNA PCR
kit from Perkin Elmer Cetus (Norwalk, CT) with or
without reverse transcription. The PCR conditions for
bFGF and bFGF-R primers were optimized using annealing temperatures ranging from 50-70°C and
MgCl2 concentration of 0.8-5 mmol/1 (data not
shown). The optimized PCR conditions for bFGF,
bFGF-R, and /3-actin amplification included 2-min denaturation at 96°C, one cycle, which was followed by
35 cycles of denaturation at 96°C for 30 sec, annealing at 63°C for bFGF and 68°C for bFGF-R for 30 sec,
and extension at 72°C for 30 sec. The 35 cycles were
followed by 1 cycle of 7 min of additional extension at
72°C.
From each DNase I digested, total RNA samples
1.5 mg were subjected to reverse transcription using
oligo d(T)16 primer, following the protocol as described in GeneAmp RNA PCR kit. From each sample
(using 0.5 mg each), PCR amplification for bFGF and
bFGF-R were setup from reverse transcribed messenger RNA with controls using samples not digested with
DNase I and not containing complementary DNA (not
reverse transcribed). /3-Actin was used as internal control, and each PCR amplification included a negative
control containing all the reagents except the sample.
As a positive control for bFGF and bFGF-R amplification, PVG/C brain RNA sample was used. After PCR
amplification, the samples were chloroform extracted
and ethanol precipitated. The precipitated DNA was
loaded onto 2% Agarose (Bio-Rad, Richmond, CA)
gels and analyzed after ethidium bromide staining and
Southern blot hybridization or subjected to dot-blot
hybridization.
Southern blots of PCR-amplified samples were
prepared on Zeta- probe membranes (Bio-Rad, Richmond, CA) following the manufacturer's protocol.
The filters were hybridized with the appropriate
probes (bFGF probe, bFGF-R probe, or /3-actin
probe). They were prehybridized for 2 hr in a mixture
of 10% dextran sulfate, 5X SSC (IX SSC equals 0.15
mol/1 NaCl and 0.015 mol/1 sodium citrate), 20
mmol/1 NaH2PO4, pH 7.0, 7% sodium dodecyl sulfate,
10X Denhardt's (50X Denhardt's equals 1% Ficoll
[Sigma, St. Louis, MO], 1% polyvinylpyrrolidone, and
1% bovine serum albumin) and 0.1 mg/ml salmon
sperm DNA at 50°C. Oligonucleotide probes were 5'end labeled with 32P-deoxyadenosine triphosphate.21
The filters were hybridized overnight with a probe
concentration of 2 X 106dpm/ml. After hybridization,
they were washed twice at 50°C for 30 min each in 3X
SSC, 10X Denhardt's, 5% sodium dodecyl sulfate, 25
mmol/1 NaH2PO4, pH 7.5, and once at 50°C for 30
min in 1X SSC and 1% sodium dodecyl sulfate. Autoradiographs were developed overnight at —70°C.
Having established the specificity of PCR and hybridization for bFGF, bFGF-R, and /3-actin, all samples
were routinely analyzed with slot—blot hybridization as
described, and the intensity of the signals was assessed
by visual observation and graded from one to three.
RESULTS
Separation of Retinal Cell Layers
The successful separation of rat retina from the choroid is demonstrated in Figure 1. There was no adherent choroid present on the RPE cells, which appeared
as an intact layer bordering the retina (Fig. 1A). The
RPE cell layer was further separated from the neural
retina, and in Figure IB, an intact RPE cell sheet attached to a membrane filter is demonstrated. Figure
2B shows the separated neural retina with no sign of
RPE cells present. The histologic findings confirmed
that, at 21 days, degeneration had begun in the retinas
of the RCS rats (Fig. 2A). By 3 mo, there were almost
TABLE l. Specific Oligonucleotide Primers and Probes
Name
Origin
DNA Sequence
FGF260 primer
FGF699 primer
FGF322 probe
FGFR2 primer
FGFR272 primer
FGFR probe
b-Actin probe
bFGF cDNA
bFGF cDNA
bFGF cDNA
bFGF receptor cDNA
bFGF receptor cDNA
bFGF receptor cDNA
b-Actin cDNA
5'GGCAGCATCACTTCGCTTC
5'CAGCTCTTAGCAGACATTG
5'GCTTGGGATCCTTGAAGTGG
5'GTCCAGAGAACTTGCCGTAT
5'CTTGTAGATGATGACGGAGC
5TCA'CTCTGCATGGTTGACGGT
5'GTCAGAAGGACTCCTACGTG
GC Content
58%
48%
55%
50%
50%
52%
55%
1848
Investigative Ophthalmology 8c Visual Science, April 1993, Vol. 34, No. 5
showed the presence of DNA contamination in the
RNA (Fig. 3A, lane 4; Fig. 3B, Lane 3; Fig. 4, Lane 3).
Samples, which were DNase I digested and PCR
amplified after reverse transcription, detected the
presence of bFGF messenger RNA (Fig, 3A, Lane 5;
Fig. 3B, Lane 4) or bFGF-R (Fig. 4, Lane 2). DNase I
digested but not reverse transcribed samples did not
give any signals (Fig. 3A, Lane 6), even after hybridization (Fig. 3B, Lane 5; Fig. 4, Lane 4). The amount of
messenger RNA per sample was estimated on the basis
of the /8-actin signal intensity after DNase I digestion
and reverse transcription (Fig. 3A, Lane 11; Fig. 4,
Lane 8).
Detection of bFGF Messenger RNA With PCR
Amplification Followed by Hybridization
The expression of bFGF was detected in the RPE cells
and neural retina of 21-day-old PVG/C, RCS-rdy+,
and RCS rats (Table 2) with a weaker signal present in
the retina of 21-day-old RCS rats. This difference in-
I. Separation of rat retina from the choroid at postnatal day 21. (A) A 12-/*m thick cryostat cross section of
PVG/C retina periphery, the arrow pointing to RPE nucleus. There was no adherent choroid attached. Layers of
the choroid-free retina were further separated with the
sandwich technique. (B) Whole-mount RPE layer showing
RPE sheet, separated from the neural retina and attached to
a membrane filter. Both sections were stained with hematoxylin.
FIGURE
no photoreceptors remaining in the RCS rat retinas
Specificity of Messenger RNA Detection With
PCR Amplification
PVG/C brain messenger RNA was used as positive
control. The presence of bFGF and bFGF-R was detected with signals appearing at 458 and 290 base
pairs, respectively (Fig. 3A, Lane 3) and hybridizing to
specific oligonucleotide probes (Fig. 3B, Lane 2). Samples that were not DNase I digested but underwent
reverse transcription usually showed the presence of a
signal for bFGF and bFGF-R representing reverse
transcribed messenger RNA and DNA contamination
(Fig. 3A, Lane 4; Fig. 3B, Lane 3; Fig. 4, Lane 1).
Samples amplified without reverse transcriptase
FIGURE 2. (A) Histologic appearance of 21-day-old RCS rat
retina. (B) The separated neural retina of the same animal
showing no adherent RPE cells. Scale bar = 50 /im.
bFGF and Its Receptor in Rats
1849
B. 1
A
" 1 2
3 4
5
6
7
8
9 10 11 12 13 14 15
2
3
6
7
458
FIGURE 3.
Detection of bFGF messenger RNA in the neural retina of 21 -day-old RCS rats. (A)
PCR amplification followed by gel electrophoresis and ethidium bromide staining of samples.
Lane 1: molecular weight marker V (Boehringer Mannheim); Lane 2: PVG/C brain; Lane 3:
undigested sample with reverse transcription; Lane 4: undigested sample without reverse
transcription; Lane 5: DNase I-digested sample with reverse transcription; Lane 6: DNase
1-digested sample without reverse transcription; Lane 7: negative control; Lanes 8, 9: empty
wells; Lanes 10-13: PCR amplification with jS-aciin primers; Lane 10: undigested sample
with reverse transcription; Lane I 1: DNase I-digested sample with reverse transcription;
Lane 12: undigested sample without reverse transcription; Lane 13: DNase I-digested sample
without reverse transcription; Lane 15: molecular weight marker. (B) Southern blot hybridization with bFGF specific probe. Lane 1: PVG/C positive control; Lane 2: undigested sample with reverse transcription; Lane 3: undigested sample without reverse transcription;
Lane 4: DNase I-digested sample with reverse transcription; Lane 5: DNase I-digested sample without, reverse transcription; Lane 6: negative control.
creased significantly in 3-mo-old animals (Table 2 and
Fig. 5). By contrast, the intensity of bFGF expression
signal intensity in the RPE cells of PVG/C, RCS-rdy+,
and RCS rats was the same. During these experiments,
the intensity of the relevant /3-actin signals were simi-
1
8
290
FIGURE 4. Detection of bFGF-R messenger RNA in the
neural retina of 21-day-old RCS rats with PCR amplification
and Southern blot analysis. Lane 1: undigested sample with
reverse transcription; Lane 2: DNase 1-digested sample with
reverse transcription; Lane 3: undigested sample without reverse transcription; Lane 4: DNase I-digested sample without reverse transcription; Lane 5: negative control; Lane 6:
empty well; Lane 7: undigested sample with reverse transcription and PCR amplification with 0-actin primers; Lane
8: DNase 1-digested sample with reverse transcription and
PCR amplification with /3-actin primers.
lar, and no DNA signal was detected in any of the
DNase I-digested samples.
Detection of bFGF-R Messenger RNA With
PCR Amplification Followed by Hybridization
There was a different level of bFGF-R expression in
the RPE cells of different types of rats at the age of 21
days. The most intense signal was detected in PVG/C
rats, and a slightly weaker signal was seen in RCS rats.
Even after several repeats, no signal could be obtained
from the RPE of RCS-rd)>+ rats. The presence of
bFGF-R messenger RNA expression was detected in
all types of 3-mo-old rats, with weaker signals in the
RCS-rdy+ rats.
An intense receptor signal was detected in the
neural retina of 21-day-old PVG/C RCS-rdy+ and RCS
rats, which significantly decreased in the 3-mo-old
RCS rats (Table 2 and Fig. 5). There was no DNA
present in the samples, and the intensity of the 0-actin
signals was similar.
DISCUSSION
The role of bFGF in the developing retina has been
demonstrated both in vivo22 and in vitro,7-23 and it has
been suggested that it plays an important role in cell
differentiation,24 proliferation, and mitogenesis.25 By
contrast, the role of bFGF in adult retinas has not been
studied widely. Recently, it was reported that, in young
1850
Investigative Ophthalmology & Visual Science, April 1993, Vol. 34, No. 5
2. bFGF and bFGF-R in the Retina of PVG/C,
RCS-rdy, and RCS Rats
TABLE
bFGF
PVG/C
RCS-rrfjif
RCS
bFGF-R
RPE Cells
Neural Retina
RPE Cells
Neural Retina
+*
++
++
+++ 000
+++ 000
++ 0
+++00
?
0
++ 00
+++ 000
+++00
+++0
00
00
00
* Signal intensity increases from 1-3.
121-day-old rat.
0 3-month-old rat.
RCS rats with inherited retinal dystrophy, the loss of
photoreceptor cells can be delayed for at least 2 mo by
administering subretinal injections of bFGF.10 Our
own experiments confirmed the rescue effect of
bFGF, although to a lesser degree than that reported
(unpublished observations).
Previous studies have localized the abnormality in
the RCS rat to the RPE cells.226 To be able to identify
any abnormality in the expression of bFGF or bFGF-R
in the RPE cells in vivo, we separated first the retina
from the choroid (Fig. 1A) and then the neural retina
from the RPE cells (Figs. IB, 2B). Although RPE cells
separated with the sandwich technique might have
"contaminating" rod outer segment particles, the
complete population of RPE cells present in the rat
eye could be analyzed in this way and not just a representative population, as in RPE cell cultures. In this
study, we used PCR amplification to provide relative
comparison of the amounts of messenger RNA. Although the applied number of cycles was relatively
high, using the conditions described in this article, the
PCR signal remained proportional to the messenger
RNA present in the samples (data not shown).
There was no difference in the expression of
bFGF in the RPE cells of PVG/C, RC$-rdy+, and RCS
rats at the age of 21 days or 3 mo. This result suggests
that a defect of bFGF expression by RPE cells is not
the initiating factor in the development of photoreceptor degeneration in RCS rats. However, a defect in
the structure of the bFGF produced by a mutated messenger RNA sequence cannot be dismissed, and the
sequence of bFGF expressed by RCS rats should be
analyzed in the future. At the later stages of the degeneration, the absence of a significant change in bFGF
messenger RNA expression suggests that this aspect of
RPE cell function is not strongly regulated by the condition of the neural retina.
By contrast with the RPE, we found a lower level
of bFGF messenger RNA in the neural retina of 21day-old RCS rats than that of the controls and a signifi-
bFGF-R
bFGF
Age
RPE
neural retina
RPE
neural retina
21 days
3 months
FIGURES. Deieuion of bFGF and bFGF-R in the retina of 21-day-old and 3-nu>-old RCS ral[s
with PCR amplification and oligonucleotide hybridization.
bFGF and Its Receptor in Rats
cant decrease in 3-mo-old RCS rats (Fig. 5). In the
neural retina, bFGF messenger RNA has been localized to several regions, such as the ganglion cell layer22
and the inner segments of photoreceptors.27 We believe that the significant decrease of retinal bFGF messenger RNA in 3-mo-old RCS rats is probably the result of a loss of the main source of expression, the
photoreceptors, as a result of the dystrophy. The relative decrease at earlier stages was not as great as at 3
mo. There were few signs of photoreceptor loss at 21
days. However, it is possible that either a low level of
photoreceptor loss28 or a shutting down of gene expression before cell death could explain the decreased
bFGF messenger RNA levels. Alternatively, there may
be another source of bFGF at this stage that is important for retinal development but deficient in the RCS
rat. In situ hybridization studies for bFGF messenger
RNA are required to settle this issue.
In previous studies, it was shown that bFGF messenger RNA expression did not always coincide with
the presence of bFGF in the neural retina,27 and it was
suggested that bFGF proteins synthesized in the photoreceptor cells are secreted and diffuse to the target
cells in the neural retina, although they are cellular
rather than secreted proteins.29 The role of exogenous
bFGF in the normal function of retinal cells gives increased importance to the expression of the bFGF
messenger RNA receptor. The level of bFGF-R expression in this study was found to be the same in the
RPE cells of PVG/C, RCS-rdy+, and RCS rats at both
study points. However, although there was a strong
signal in 21-day-old RCS rat neural retina, only a weak
signal was detected in 3-mo-old animals. The decrease
in the expression in bFGF-R followed the same pattern as the bFGF expression. bFGF-R has been shown
to be present in the rod outer segments of normal
animals, which suggests that the decrease in the expression of bFGF-R is the result of photoreceptor
loss.30
By contrast with the neural retina, the RPE in RCS
rats seems to be similar to that of PVG/C and RCSrdy+ rats. If the presence of exogenous bFGF is required for the normal functioning of neural retinal
cells, RPE cells might continuously externalize bFGF,
which diffuses to the neural retina. With the development of the dystrophy in RCS rats, less and less exogenous bFGF would be used by the neural retina, which
might result in the accumulation of bFGF around the
RPE cells and initiate the vascularization of the retina
in dystrophic animals.
In summary, on the basis of this study, we conclude that the level of bFGF or bFGF-R expression in
RCS rat RPE cells is similar to that of normal animals
and is therefore unlikely to be involved in the photoreceptor dystrophy. However, there is a lower level of
bFGF messenger RNA expression in RCS rat neural
1851
retina compared with that in the controls, although
the bFGF-R signal is similar to that of the controls.
The introduction of exogenous bFGF might contribute to the survival of photoreceptors by a restoration
of lowered bFGF levels to normal levels and explain
the previously described rescue effect.10 We cannot,
however, exclude the possibility that the exogenous
bFGF acts by stimulating abnormal processes.
Key Words
Royal College of Surgeons (RCS) rats, basic fibroblast
growth factor (bFGF), basic fibroblast growth factor receptor (bFGF-R), polymerase chain reaction (PCR), photoreceptor dystrophy, pigment epithelium
Acknowledgments
The authors thank Dr. M. M. La Vail (University of California at San Francisco, San Francisco, California) for providing the RCS rats to establish the colony and for critical reading of the manuscript and Kelly Sailer for typing the manuscript.
References
1. Mullen RJ, La Vail MM. Inherited retinal dystrophy:
Primary defect in pigment epithelium determined
with experimental rat chimeras. Science. 1976;
192:799-801.
2. Chaitin MH, Hall MO. Defective ingestion of rod
outer segments by cultured dystrophic rat pigment epithelial cells. Invest Ophthalmol Vis Sci. 1983; 24:812820.
3. Li L, Turner JE. Inherited retinal dystrophy in the
RCS rat: Prevention of photoreceptor degeneration
by pigment epithelial cell transplantation. Exp Eye Res.
1988;47:911-917.
4. Lopez R, Gouras P, Kjeldbye H, et al. Transplanted
retinal pigment epithelium modifies the retinal degeneration in the RCS rat. Invest Ophthalmol Vis Sci.
1989;30:586-588.
5. Li L, Sheedlo HJ, Gaur V, Turner JE. Effects of macrophage and retinal pigment epithelial cell transplants
on photoreceptor cell rescue in RCS rats. Cuir Eye
Res. 1991; 10:947-958.
6. Baird A, Esch F, Gospodarowicz D, Guillemin R. Retina- and eye-derived endothelial cell growth factors:
Partial molecular characterization and identity with
acidic and basic fibroblast growth factors. Biochemistry. 1985; 24:7855-7860.
7. Schweigerer L, Malerstein B, Neufeld G, Gospodarowicz D. Basic fibroblast growth factor is synthesized in
cultured retinal pigment epithelial cells. Biochem
Biophys Res Commun. 1987; 143:934-940.
8. Sternfeld MD, Robertson JE, Shipley GD, Tsai J, Rosenbaum JT. Cultured human retinal pigment epithelial cells express basic fibroblast growth factor and its
receptor. Curr Eye Res. 1989;8:1029-1037.
9. Emoto N, Gonzalez A-M, Walicke PA, et al. Basic fibroblast growth factor (bFGF) in the central nervous sys-
1852
Investigative Ophthalmology & Visual Science, April 1993, Vol. 34, No. 5
tern: Identification of specific loci of basic FGF expression in the rat brain. Growth Factors 1989; 2:2129.
10. Faktorovich EG, Steinberg RH, Yasumura D, Matthes
MT, LaVail MM. Photoreceptor degeneration in inherited retinal dystrophy delayed by basic fibroblast
growth factor. Nature. 1990; 347:83-86.
11. Politi LE, Lehar M, Adler R. Development of neonatal
mouse retinal neurons and photoreceptors in low
density cell culture. Invest Ophthahnol Vis Sc.
1988;29:534-543.
12. Gospodarowicz D, Bialecki H, Thakral TK. The angiogenic activity of the fibroblast and epidermal growth
factor. ExpEyeRes. 1979;28:501-514.
13. Roque RS, Caldwell RB. Pigment epithelial cell
changes precede vascular transformations in the dystrophic rat retina. Exp Eye Res. 1991;53:787-798.
14. Seaton AD, Turner JE. RPE transplants stabilize retinal vasculature and prevent neovascularization in the
RCS rat. Invest Ophthahnol Vis Sci. 1992;33:83-91.
15. Shiosaka S, Kiyama H, Tohyama M. A simple method
for the separation of retinal sublayers from the entire
retina with special reference to application for cell
culture. J Neurosci Methods. 1984; 10:229-235.
16. Chomczynski P, Sacchi N. Single-step method of RNA
isolation by acid guanidinium thiocyanate-phenolchloroform extraction. Anal Biochem. 1987; 162:
156-159.
1 7. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning. A Laboratory Ma?iual. 2nd ed. New York: Cold
Spring Harbor Laboratory Press, 1989:E.5.
18. Shimasaki S, Emoto N, Koba A, et al. Complementary
DNA cloning and sequencing of rat ovarian basic fibroblast growth factor and tissue distribution study of
its mRNA. Biochem Biophys Res Commun. 1988;
57:256-263.
19. Kurokawa T, Seno M, Igarashi K. Nucleotide sequence of rat basic fibroblast growth factor cDNA.
Nucleic Acids Res. 1988; 16:5201.
20. Koos RD, Olson CE. Expression of basic fibroblast
growth factor in the rat ovary: Detection of mRNA
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
using reverse transcription-polymerase chain reaction
amplification. Mol Endocrinol. 1989; 12:2041-2048.
Rakoczy P, Demeter T, Hutchinson L, Sterrett GF,
Pixley EC, Kulski JK. Detection of human papillomavirus type 16 DNA in cervical swabs and formalinfixed, paraffin-embedded squamous cell carcinomas
of non-genital tissues using a synthetic oligodeoxynucleotide probe./ Virol Methods. 1989;25:325-336.
Wanaka A, Milbrandt J,d Johnson EM. Expression of
FGF receptor gene in rat development. Development.
1991; 111:455-468.
Mascarelli D, Raulais D, Counis MF, Courtois Y. Characterization of acidic and basic fibroblast growth factors in brain, retina and vitreous chick embryo. Biochem Biophys Res Commun. 1987; 146:478-486.
De Juan E, Stefansson E, Ohira A. Basic fibroblast
growth factor stimulates 3H-thymidine uptake in retinal venular and capillary endothelial cells in vivo. Invest Ophthahnol Vis Sci. 1990; 31:1238-1244.
Wong HC, Boulton M, McLeod D, Bayly M, Clark P,
Marshall J. Retinal pigment epithelial cells in culture
produce retinal vascular mitogens. Arch Ophthahnol.
1988; 106:1439-1443.
Berman ER, Segal N, Photiou S, Rothman H, FeeneyBurns L. Inherited retinal dystrophy in RCS rats: A
deficiency in vitamin A esterification in pigment epithelium. Nature. 1981; 293:217-219.
Noji S, Matsuo T, Koyama E, et al. Expression pattern
of acidic and basic fibroblast growth factor genes in
adult rat eyes. Biochem and Biophys Res Commun.
1990; 168:343-349.
LaVail MM, Battelle BA. Influence of eye pigmentation and light deprivation on inherited retinal dystropy in the rat. Exp Eye Res. 1975; 21:167-1 74.
Wiedemann P. Growth factors in retinal diseases: Proliferative vitreoretinopathy, proliferative diabetic retinopathy, and retinal degeneration. Surv Ophthahnol.
1992;36:373-384.
Mascarelli F, Raulais D, Courtois Y. Fibroblast growth
factor phosphorylation and receptors in rod outer
segments. EMBOJ. 1989;8:2265-2273.